Toward Improvement of Erythromycin A Production in an Industrial Saccharopolyspora erythraea Strain via Facilitation of Genetic Manipulation with an Artificial attB Site for Specific Recombination

Jiequn Wu; Qinglin Zhang; Wei Deng; Jiangchao Qian; Siliang Zhang; Wen Liu

doi:10.1128/AEM.06034-11

. 2011 Nov;77(21):7508–7516. doi: 10.1128/AEM.06034-11

Toward Improvement of Erythromycin A Production in an Industrial Saccharopolyspora erythraea Strain via Facilitation of Genetic Manipulation with an Artificial attB Site for Specific Recombination^{^▿}

Jiequn Wu ^1,², Qinglin Zhang ^1,², Wei Deng ², Jiangchao Qian ¹, Siliang Zhang ¹, Wen Liu ^2,^*

PMCID: PMC3209160 PMID: 21841022

Abstract

Large-scale production of erythromycin A (Er-A) relies on the organism Saccharopolyspora erythraea, in which lack of a typical attB site largely impedes the application of phage ΦC31 integrase-mediated recombination into site-specific engineering. We herein report construction of an artificial attB site in an industrial S. erythraea strain, HL3168 E3, in an effort to break the bottleneck previously encountered during genetic manipulation mainly from homologous or unpredictable nonspecific integration. Replacement of a cryptic gene, nrps1-1, with a cassette containing eight attB DNA sequences did not affect the high Er-producing ability, setting the stage for precisely engineering the industrial Er-producing strain for foreign DNA introduction with a reliable conjugation frequency. Transfer of either exogenous or endogenous genes of importance to Er-A biosynthesis, including the S-adenosylmethionine synthetase gene for positive regulation, vhb for increasing the oxygen supply, and two tailoring genes, eryK and eryG, for optimizing the biotransformation at the late stage, was achieved by taking advantage of this facility, allowing systematic improvement of Er-A production as well as elimination of the by-products Er-B and Er-C in fermentation. The strategy developed here can generally be applicable to other strains that lack the attB site.

INTRODUCTION

Saccharopolyspora erythraea is the organism currently used in industry for large-scale production of erythromycin A (Er-A; Fig. 1), a potent 14-membered macrolide antibiotic active against pathogenic Gram-positive bacteria (20). Er-A has been widely used in the clinic and further developed by semisynthesis into a number of new drugs (e.g., azithromycin, flurithromycin, and telithromycin) showing an expanded antibacterial spectrum and improved pharmaceutical properties (6, 15). Over the past 50 years, the commercial importance of Er-A has prompted extensive efforts toward improving the production of Er-A and its purity at the fermentation stage. Historically, this improvement mainly depends on the traditional methods that typically require multiple rounds of random mutagenesis of the Er-producing strain S. erythraea in association with heroic large-scale screening (1, 26).

In recent years, the application of genetic engineering as a promising biotechnique complements use of the traditional mutagenesis method alone (2, 10), showing the significant increase in production that can be achieved by rationally enhancing the oxygen or precursor (e.g., methylmalonyl coenzyme A [methylmalonyl-CoA]) supply and positive regulation of Er-A biosynthesis (5, 23, 29, 30). As a model system for forming complex natural products, Er-A biosynthesis has been well established and shows a set of multifunctional type I polyketide synthases (PKSs) responsible for the formation of a macrolide intermediate, 6-deoxyerythronolide B (6-DEB) (34, 39), which is then subjected to elaborate modifications to furnish the end product (Fig. 1) (12, 21, 27, 33). On the basis of systematically modulating the expression of the tailoring genes eryK (encoding a P450 protein for C-12 hydroxylation) and eryG (encoding an O-methyltransferase for C-3″ O-methylation), the biotransformation process has recently been optimized in an industrial strain, S. erythraea HL3168 E3, leading to the improvement of Er-A purity in fermentation by converting the by-products Er-C (pathway I) and Er-B (pathway II) into Er-A (Fig. 1) (7).

The current success in genetic engineering of S. erythraea relies mainly on homologous recombination-based manipulations, particularly for endogenous biosynthetic gene duplication via a single-crossover integration (7, 29, 30). The application of this strategy raises a common concern regarding the stability of the resulting recombinant strains, which, without the given selective pressure, may undergo elimination of the insertion and reversion back to the original genotype during DNA replication. Though the double-crossover mutation is genetically stable, the process used to make the crossover is laborious and often requires multiple rounds of screening to introduce the desired gene. In contrast, phage ΦC31 integrase-catalyzed site-specific exchange provides an efficient method for precise engineering of various Streptomyces hosts to generate stable mutants with a clear genetic background (8, 11, 35). For integration, the bacterial attB site undergoes a conservative and reciprocal recombination with the phage attP site of the introduced DNA to form the hybrid sites attL and attR. However, the Er-producing strain S. erythraea apparently lacks the typical attB site on the chromosome (3, 31), largely impeding efforts to apply the site-specific integration approach to engineering for exogenous DNA delivery. Although in some cases ΦC31-based vectors, such as pSET152, can be introduced into S. erythraea, sequence analysis revealed the diverse distribution of their integration locations (31), which is consistent with the low efficiency often found, given the occurrence of nonspecific recombination.

Guided by the accessible genome information regarding S. erythraea NRRL 23338 (an original soil isolate from which many strains with improved yields have been derived) (25), we integrated an attB cassette into a selected site on the chromosome of the industrial Er-producing strain S. erythraea HL3168 E3 and herein report the findings. The engineered recombinant, which retains the high Er-producing ability comparable to that of the original strain, offered a useful platform significantly expediting genetic manipulation upon ΦC31 integrase-mediated, site-specific recombination. Introduction of either exogenous or endogenous genes of importance to Er-A biosynthesis was achieved upon this facility, leading to the continuously rational evolution of new Er-producing S. erythraea strains with improved Er-A production and purity. The strategy for constructing a system amenable to site-specific engineering can generally be applicable to other strains that lack the attB integration site.

MATERIALS AND METHODS

Bacterial strains, plasmids, and reagents.

The bacterial strains and plasmid used in this study are summarized in Table 1. Biochemicals, chemicals, media, restriction enzymes, and other molecular biological reagents were purchased from standard commercial sources.

Table 1.

Bacterial strains and plasmids used in this study

Strain/plasmid	Characteristic(s)	Source or reference
E. coli
DH5α	Host for general cloning	Invitrogen
ET12567(pUZ8002)	Host for genomic library construction	18
S. erythraea
HL3168 E3	Industrial Er-producing strain	7
ZL2001	Derivative of HL3168 E3 containing the artificial cassette with eight attB sequences	This study
ZL2002	Derivative of ZL2001 containing pSET152 integrated by ΦC31 integrase-mediated, site-specific recombination	This study
ZL2003	Derivative of ZL2001 containing pZL2003 integrated by ΦC31 integrase-mediated, site-specific recombination with the genotype PermE-*SAMS gene	This study
ZL2004	Derivative of ZL2001 containing pZL2003 integrated by ΦC31 integrase-mediated, site-specific recombination with the genotype PermE*-vhb-SAMS gene	This study
ZL2005	Derivative of ZL2001 containing pZL2003 integrated by ΦC31 integrase-mediated, site-specific recombination with the genotype PermE*-vhb-SAMS gene-PermE*-eryK-eryG-eryK	This study
Plasmids
pANT841	E. coli subcloning vector	AF438749
pUC19	E. coli subcloning vector	Invitrogen
pKC1139	E. coli-Streptomyces shuttle vector, temperature-sensitive replication	4
pSET152	E. coli-Streptomyces shuttle vector containing the ΦC31 attP site and the integrase gene	4
pZL1014	pKC1139 derivative for the PermE-controlled expression of eryK-eryG-eryK*	7
pZL2001	pANT841 derivative containing a continuous cassette with eight attB sites	This study
pZL2002	pKC1139 derivative for gene replacement of nrps1-1	This study
pZL2003	pKC1139 derivative containing the attB cassette flanked by the homologous fragments of nrps1-1, construct for ΦC31 attB cassette integration via double-crossover recombination	This study
pZL2004	pSET152 derivative containing the constitutive promoter PermE*	This study
pZL2005	pSET152 derivative for the PermE-controlled expression of SACE_2103* (SAMS gene)	This study
pZL2006	pUC19 derivative containing 457-bp BamHI-XbaI fragment of vhb	This study
pZL2007	pSET152 derivative for the PermE-controlled expression of vhb*	This study
pZL2007		This study
pZL2008	pSET152 derivative for the PermE-controlled expression of vhb* and the SAMS gene	This study
pZL2009	pSET152 derivative for the PermE-controlled expression of eryK-eryG-eryK*	This study
pZL2010	pSET152 derivative for both the PermE-controlled expression of vhb* and SAMS gene fragment and PermE-controlled expression of eryK-eryG-eryK*	This study

Open in a new tab

DNA isolation, manipulation, and sequencing.

DNA isolation and manipulation in Escherichia coli and Streptomyces were carried out according to standard methods (18, 32). PCR amplifications were carried out on an authorized thermal cycler (AG 22331; Eppendorf, Hamburg, Germany) using either Taq DNA polymerase or Pfu Ultra High-Fidelity DNA polymerase (Promega). Primer synthesis and DNA sequencing were performed at Shanghai GeneCore Biotechnology Inc.

Integration of an attB cassette.

A 426-bp DNA fragment that contains eight continuous ΦC31 attB sites (31) was synthesized at Shanghai Invitrogen Biotechnology Co. Ltd. as follows: CTTCTCAGATCTCGGGTGCCAGGGCGTGCCCTTGGGCTCCCCGGGCGCGTAACTAGTGGATCTCGGGTGCCAGGGCGTGCCCTTGGGCTCCCCGGGCGCGTAACTAGTGGATCTCGGGTGCCAGGGCGTGCCCTTGGGCTCCCCGGGCGCGTAACTAGTGGATCTCGGGTGCCAGGGCGTGCCCTTGGGCTCCCCGGGCGCGTAACTAGTGGATCTCGGGTGCCAGGGCGTGCCCTTGGGCTCCCCGGGCGCGTAACTAGTGGATCTCGGGTGCCAGGGCGTGCCCTTGGGCTCCCCGGGCGCGTAACTAGTGGATCTCGGGTGCCAGGGCGTGCCCTTGGGCTCCCCGGGCGCGTAACTAGTGGATCTCGGGTGCCAGGGCGTGCCCTTGGGCTCCCCGGGCGCGTAACTAGTGGATCCCTGGAG (sites of restriction enzymes BglII and BamHI are shown in italics, and attB sites are underlined). This fragment was cloned into the BglII/BamHI site of pANT841 to give pZL2001, which was subjected to BglII/BamHI digestion and sequencing to confirm the fidelity of the insertion.

Using the genomic DNA of S. erythraea HL3168 E3 as the template, a 1,409-bp fragment was amplified by PCR using the primers 5′-AAA GAA TTC CGG AAC CTG CTG GCC GAC CA-3′ (the EcoRI site is underlined) and 5′-TTT GGA TCC GAG AAG TCG AAG GCG TAG GA-3′ (the BamHI site is underlined), and a 1,412-bp fragment was obtained by using the primers 5′-TTT GGA TCC CTG GAG CTG GAC CGC GAG CA-3′ (the BamHI site is underlined) and 5′-AAA AAG CTT GGA TCA CCC TCC GCA CCG AG-3′ (the HindIII site is underlined). The 1.4-kb EcoRI/BamHI fragment and 1.4-kb BamHI/HindIII fragment described above were recovered and coligated into the EcoRI/HindIII site of pKC1139 to give pZL2002. After digestion with BglII/BamHI, the resulting 412-bp fragment from pZL2001 was recovered and inserted into the BamHI site of pZL2002 to generate the recombinant plasmid pZL2003, in which the 317-bp fragment of SACE_1035 (encoding NRPS1_1) was deleted and replaced by eight attB DNA sequences.

Introduction of pZL2003 into S. erythraea was carried out by E. coli-Streptomyces conjugation, following the procedure described previously (22). For single-crossover DNA exchange, colonies that were apramycin resistant at 37°C were identified as the mutants. Further screening of colonies that were sensitive to apramycin resulted in the double-crossover mutant ZL2001, the genotypes of which were confirmed by PCR amplification and sequencing. From the genomic DNA of ZL2001, an expected 3,773-bp product was amplified using the primers p1f (5′-TCG CCG CCG CAC TAC TGA A-3′) and p1r (5′-GCA CCA GGC TGT TGA CGA AGA A-3′). Sequencing of this PCR product by using the primers p2f (5′-GAC GCT GTT CCA CTC CTA CGC C-3′) and p2r (5′-CGC CCG CCA CGT ACA TCT CA-3′) revealed that DNA replacement occurred at the designed site of nrps1-1 in S. erythraea.

To test the effectiveness of the integrated attB cassette, pSET152 was introduced into ZL2001 to generate the recombinant strain ZL2002, whose genotype was confirmed by PCR amplification using the primers p2f and p2r. From the genomic DNA of ZL2002, an expected 6.0-kb product was obtained. Sequencing of this PCR product by using the same primer pair, p2f and p2r, revealed that pSET152 was inserted specifically at the attB site in ZL2001.

Introduction of endogenous or/and exogenous genes into ZL2001.

To enhance the expression of the S-adenosylmethionine (SAM) synthetase gene (SAMS gene) in ZL2001, a 1,432-bp DNA fragment that contains the complete sequence of SACE_2103 was amplified from the genomic DNA of S. erythraea HL3168 E3 by PCR using the primers 5′-A TTG GAT CCA CAT TGT GGG ATG CGG TGA GCC-3′ (the BamHI site is underlined) and 5′-CT GTC TAG ACT GAC GAC TGC CCG TAC AAC GAC-3′ (the XbaI is site underlined). After digestion with BamHI/XbaI, the resulting 1.4-kb fragment was recovered. This fragment was then inserted into the BamHI/XbaI site of pZL2004, a pSET152 derivative carrying a 0.5-kb fragment containing the constitutive promoter PermE*, yielding the recombinant plasmid pZL2005. In pZL2005, the expression of SACE_2103 was under the control of PermE*.

To express vhb in ZL2001, the 463-bp DNA fragment that contains the complete sequence of vhb was amplified from the DNA template (provided by Sheng Yang at the Institute of Plant Physiology and Ecology, Shanghai Institutes of Biological Sciences, Chinese Academy of Sciences) by PCR using the primers 5′-G TAG GAT CCA GCG GTG TTA GAC CAG CAA ACC A-3′ (the BamHI site is underlined) and 5′-ATT TCT AGA TTA TTC AAC CGC TTG AGC-3′ (the XbaI site is underlined) and cloned into the vector pUC19 to give pZL2006. After sequencing to confirm the fidelity, the 457-bp BamHI/XbaI fragment was recovered and coligated with a 285-bp PermE*-containing EcoRI/BamHI fragment amplified from pZL2004 by PCR using the primers 5′-ATT GAA TTC CCA GCC CGA CCC GAG CAC GC-3′ (the EcoRI site is underlined) and 5′-C GCT GGA TCC TAC CAA CCG-3′ (the BamHI site is underlined) into the EcoRI/XbaI site of pSET152, yielding pZL2007. To coexpress the SAMS gene with vhb, a 1,535-bp SACE_2103-containing fragment from ZL2005, which was amplified by PCR using the primers 5′-ATT ACT AGT GCC TTC GAG GGC GAG GAC AA-3′ (the SpeI site is underlined) and 5′-CT GTC TAG ACT GAC GAC TGC CCG TAC AAC GAC-3′ (the XbaI site is underlined), was digested with SpeI/XbaI and then inserted into the XbaI site of pZL2007, followed by enzymatic digestion to determine the orientation of sams. In the resulting recombinant plasmid, pZL2008, the expression of vhb and sams was under the control of PermE*.

To coexpress the tailoring genes eryK and eryG along with vhb and the SAMS gene, ZL1014, which carries the PermE*-eryK-eryG-eryK construction in pKC1139 (7), was digested with EcoRI/SpeI. The resulting 4.6-kb internal fragment was recovered and cloned into pSET152 to give pZL2009. With pZL2008 as the template, a 2.3-kb DNA fragment was amplified by PCR using the primers 5′-ATT GAA TTC CCA GCC CGA CCC GAG CAC GC-3′ (the EcoRI site is underlined) and 5′-ATT GAA TTC CGC CAG GGT TTT CCC AGT CAC GAC-3′ (the EcoRI site is underlined). This fragment was digested by EcoRI and then inserted into the same site of pZL2009, followed by enzymatic digestion to determine the orientation of PermE*-vhb-SAMS gene, yielding the recombinant plasmid pZL2010. In pZL2010, the expression of constructs vhb-SAMS gene and eryK-eryG-eryK was under the control of PermE*.

The recombinant plasmids pZL2005, pZL2008, and pZL2010 were introduced into S. erythraea individually by intergeneric conjugation using a method described previously (7). Colonies that were apramycin resistant were identified as the recombinant strains, including ZL2003 (PermE*-SAMS gene), ZL2004 (PermE*-vhb-SAMS gene), and ZL2005 (PermE*-vhb-SAMS gene-PermE*-eryK-eryG-eryK). Two sets of primers, the pair p2f and p3r (5′-CAG GGC GAG CAA TTC CGA GA-3′) for determining the region surrounding attL and the pair p3f (5′-CAG AGC AGG ATT CCC GTT GAG-3′) and p2r for determining the region surrounding attR, were used for PCR amplification and sequencing to confirm that each recombination specifically took place at the artificial attB site.

Er production in S. erythraea.

S. erythraea HL3168 E3 and recombinant strains were grown on agar plates (with appropriate antibiotics for recombinant strains) with medium consisting of 1% corn starch, 1% corn steep liquor, 0.3% NaCl, 0.3% (NH₄)₂SO₄, 0.5% CaCO₃, and 2% agar, pH 7.0, at 34°C for sporulation. For fermentation, an agar piece of about 1 cm² was inoculated into a 500-ml flask containing 50 ml of the seed medium [consisting of 5% corn starch, 1.8% soybean flour, 1.3% corn steep liquor, 0.3% NaCl, 0.1% (NH₄)₂SO₄, 0.1% NH₄NO₃, 0.5% soybean oil, and 0.6% CaCO₃, pH 6.8 to 7.0] and incubated at 34°C and 250 rpm for 2 days. To a 500-ml flask containing 50 ml of the fresh fermentation medium [consisting of 4% corn starch, 3% soybean flour, 3% dextrin, 0.2% (NH₄)₂SO₄, 1% soybean oil, and 0.6% CaCO₃] was then added 5 ml of the seed culture, and incubation was continued at 34°C and 250 rpm for 6 days. The mixture was supplemented with an additional 0.5 ml of n-propanol after 1 day of cultivation.

Chemical analysis of Er production.

Er isolation from the fermentation culture was carried out according to the methods described previously (36). High-pressure liquid chromatography (HPLC) analysis of Ers was carried out on a Nucleosil 100-5 CN column (250 by 4.6 mm; catalog no. 720090.46; Macherey-Nagel Inc., Germany), which was equilibrated with 69% solvent A (32 mM potassium phosphate buffer, pH 8.0) and 31% solvent B (acetonitrile/methanol at a ratio of 75/25). An isocratic program (9) was carried out at a flow rate of 1 ml/min, and UV detection was performed at 215 nm using an Agilent 1100 HPLC system (Agilent Technologies, Palo Alto, CA). Liquid chromatography-mass spectrometry (LC-MS) analysis of Ers was carried out on a Microsorb-MV C₁₈ column (250 by 4.6 mm; catalog no. 281505; Varian Inc.), which was equilibrated with 62% solvent A (30 mM ammonium acetate, pH 4.8) and 38% solvent B (acetonitrile). An isocratic program (36) was carried out on an LC-MS 2010 A liquid chromatograph-mass spectrometer (Shimadzu, Japan) at a flow rate of 1 ml/min (UV detection at 215 nm), showing (M − H)⁻ ions at m/z 734.2 (for Er-A, C₃₇H₆₇NO₁₃), 718.3 (for Er-B, C₃₇H₆₇NO₁₂), and 720.3 (for Er-C, C₃₆H₆₅NO₁₃). For qualitative analysis of Ers, standards Er-A, Er-B, and Er-C were used (7). For quantitative analysis, the concentrations of Er-A, Er-B, and Er-C were individually calculated according to the standard curve of each reference Er (7).

Bioassay-based titration of Er production.

From the liquid culture, fermentation supernatant (250 μl) was added to stainless steel cylinders on agar plates containing the test medium (consisting of 0.5% peptone, 0.3% beef extract, 0.3% K₂HPO₄, and 1.5% agar), which was preseeded with an overnight Bacillus pumilus CMCC(B)63 202 culture at a concentration of 0.8% (vol/vol). The plates were incubated at 37°C for 16 h, and the Er production was estimated by measuring the sizes of the inhibition zones and calculated according to the standard curve made by using the commercially available Er as a control. Since Er-A is biologically much higher in activity than the other Er components, the production of Er-A is nearly equal to the total Er production, according to the titration done by assaying antibacterial activity against Bacillus pumilus.

RESULTS

Insertion of an attB cassette into an NRPS gene site on the chromosome of S. erythraea HL3168 E3.

The genome of S. erythraea contains 25 biosynthetic gene clusters (25), including that encoding Er biosynthesis, for forming putative polyketides, terpenes, and nonribosomally synthesized peptides. Among them we chose the location of the gene nrps1-1 (SACE_1305) for the attB cassette integration (Fig. 2A). The predicted product of nrps1-1 belongs to a family of nonribosomal peptide synthetases (NRPSs), which incorporate into peptide products the amino acids, instead of the short carboxylic acids, for PKS to synthesize polyketides (37). Of importance, nrps1-1 is functionally cryptic, given the presence of frameshift mutations (25), avoiding the possibility that the product may have an impact on Er-A production via the complicated metabolic network in S. erythraea. Thus, we synthesized a DNA cassette in a form with eight attB sequences which was used for replacing the 317-bp internal fragment of nrps1-1 (Fig. 2A).

Fig. 2. — Integration of artificial *attB* cassette into the chromosome for site-specific recombination. (A) Construction of ZL2001 by replacing *nrps1-1* with eight *attB* sequences via double-crossover mutation and of ZL2002 by taking advantage of the *attB* site in ZL2001 via site-specific recombination. Primer sets are labeled along with their predicted fragment sizes. (B) Validation of the genotypes by PCR amplification. Lane 1, marker I; lane 2, 3.7-kb product from the original strain, *S. erythraea* HL3168 E3, using primers p1f and p1r (control); lane 3, 3.8-kb product from ZL2001 using primers p1f and p1r; lane 4, 0.6-kb product from ZL2001 using primers p2f and p2r; lane 5, 6.0-kb product from ZL2002 using primers p1f and p1r; and lane 6, marker II. (C) Er titers in fermentations of HL3168 E3, ZL2001, and ZL2002. (D) HPLC analysis of the production of Er-A, Er-B, and Er-C in HL3168 E3, ZL2001, and ZL2002. mAU, milli-absorbance units.

The pKC1139 (an apramycin-resistant, Escherichia coli-Streptomyces shuttle vector carrying the temperature-sensitive replication origin) derivative pZL2003, containing the attB cassette flanked with the homologous fragments of nrps1-1, was introduced into S. erythraea HL3168 E3 by conjugation. The colonies that were apramycin resistant at 37°C were identified as the integrating mutants in which a single-crossover homologous recombination event took place. These mutants were cultured in liquid tryptic soy broth medium for 11 rounds in the absence of apramycin, leading to identification of the apramycin-sensitive recombinant ZL2001 (Fig. 2A). PCR amplification-coupled sequencing further confirmed the genotype of ZL2001 (Fig. 2B), showing a desired double-crossover exchange for replacing nrps1-1 with the attB cassette. ZL2001 was cultured and then subjected to comparative analysis with S. erythraea HL3168 E3. Without the change in growth feature and morphology, the recombinant ZL2001 had an Er titer at 3,059 ± 783 U/ml and produced 3,050 mg/liter of Er-A along with 530 mg/liter of Er-B and 360 mg/liter of Er-C, showing a ratio of Er-A to a sum of Er-B plus Er-C of 3.4:1 (similar to that for S. erythraea HL3168 E3, which produced Ers with a titer at 3,152 ± 521 U/ml, in which a ratio of Er-A [3,180 mg/liter] to a sum of Er-B [580 mg/liter] plus Er-C [420 mg/liter] was 3.2:1) (Table 2 and Fig. 2C and D). The Er production ability of ZL2001 was slightly lowered but still comparable to that of the original strain, validating the rationality of engineering at this locus in S. erythraea.

Table 2.

Production of Ers and ratios of Er-A to Er-B plus Er-C in S. erythraea HL3168 E3 and its recombinant strains

S. erythraea strain	No. of independent cultures (no. of isolates tested)	Concn (mg/liter)			Avg Er-A/Er-B + Er-C ratio	Improvement of Er-A production (%)	Total Er titer (U/ml)	Improvement of Er titer (%)
S. erythraea strain	No. of independent cultures (no. of isolates tested)	Er-A	Er-B	Er-C	Avg Er-A/Er-B + Er-C ratio	Improvement of Er-A production (%)	Total Er titer (U/ml)	Improvement of Er titer (%)
HL3168 E3	58 (8)	3,180	580	420	3.2		3,152 ± 521
ZL2001	53 (8)	3,050	530	360	3.4	0.0	3,059 ± 783	0.0
ZL2002	29 (4)	3,110	480	200	4.6		3,102 ± 478
ZL2003	33 (5)	3,380	610	530	3.0	10.8	3,410 ± 624	11.5
ZL2004	37 (5)	3,640	760	530	2.8	19.3	3,701 ± 537	21.0
ZL2005	39 (5)	4,170	50	110	26.1	36.7	4,148 ± 591	35.6

Open in a new tab

Effectiveness of artificial attB cassette for site-specific recombination.

We then selected the ΦC31-based integrative vector pST152 to examine the effectiveness of the introduced attB site (Fig. 2A). pSET152 contains the gene encoding the ΦC31 integrase and its associated attP attachment site for site-specific recombination with attB. Using the methylation-deficient donor system E. coli ET12567 (containing the nontransmissible vector pUZ8002), the transfer of pSET152 was carried out by conjugation, showing an exconjugant frequency at 5.0 × 10⁻⁷ when 1.0 × 10⁸ cells of ZL2001 served as the recipients. This frequency was constantly much higher than that for the original strain, S. erythraea HL3168 E3, as two or three exconjugants (assumed to be generated by nonspecific integration of pSET152) were occasionally found in parallel under the same condition.

To probe the integrating location, nine pSET152-based exconjugants of ZL2001 were randomly selected for PCR amplification-coupled sequencing (Fig. 2A). They were identical in genotype (attL linear pSET152 attR), showing that pSET152 exclusively was inserted into the artificial attB cassette (Fig. 2B). Together with the above-described efficient exconjugant frequency, this finding ascertained that the attB integration site significantly facilitates genetic manipulation in S. erythraea upon ΦC31 integrase-mediated site-specific recombination to afford the desired recombinants. The pSET152-based integration at the attB locus did not affect the phenotype, as ZL2002 produced Ers in quantity and quality (with the titer at 3,102 ± 478 U/ml for Ers, Er-A at 3,110 mg/liter, Er-B at 480 mg/liter, and Er-C at 200 mg/liter) similar to those of ZL2001 and the original strain, S. erythraea HL3168 E3 (Table 2 and Fig. 2C and D).

The artificial cassette consists of eight contiguous attB sites; however, careful analysis of all sequenced exconjugants of ZL2002 revealed only attL and attR at the flanking regions of the inserted linear pSET152, where no attB sequence was maintained. How the additional seven attB sites were eliminated remains to be further determined. Considering that all attB sequences can be recognized by the ΦC31 integrase and subsequently cleaved at the recombination site, we proposed that the uninterrupted DNA exchange may occur only when the end sites on both sides of the attB cassette, S_1-1 of attB1 and S_n-2 of attBn, are recombined with the corresponding cleaved sites S2′ and S1′ of attP, respectively (Fig. 3). Other linkages could result in chromosome incompletion potentially fatal to cells and therefore be excluded.

Fig. 3. — Predicted mechanism for ΦC31-based recombination in the presence of multiple *attB* sites. (Left) Uninterrupted DNA exchange via end-site ligation to eliminate additional *attB* sequences; (right) interrupted DNA exchange via internal-site ligation.

Duplication of endogenous SAMS gene SACE_2103 in ZL2001.

SAM plays an important role in many intracellular processes, and recent investigations showed that various biosynthetic machineries can be enhanced by increasing its concentration in cells to improve the yields of the metabolites, including antibiotics (19, 24). SAM synthetase, a key enzyme in the recycling of SAM from S-adenosylhomocysteine (a product in the SAM-dependent methylation reaction), catalyzes the conversion of the substrates l-methionine and ATP into SAM. The chromosome of S. erythraea harbors two genes encoding SAM synthetases (25), among which SACE_2103, located in the core region (total of 4.4 Mbp) extending on either side of the origin of replication (oriC), can be essential and active for SAM supply. Taking advantage of the artificial attB cassette, we therefore duplicated SACE_2103 as an endogenous sams in ZL2001 for production improvement. Accordingly, pZL2005, a pSET152 derivative carrying the SAMS gene under the control of the constitutive promoter PermE* (of the Er resistance gene eryE), was constructed and then efficiently introduced into ZL2001 by conjugation, giving the recombinant strain ZL2003 (Fig. 4A). Analysis of the genotype of ZL2003, attL linear pZL2003 (PermE*-SAMS gene) attR, confirmed the plasmid integration in a site-specific manner at the locus of the attB cassette (Fig. 4B). ZL2003 was cultured and fermented and showed increases in Er titer (11.5% improved) and in Er-A production (10.8% improved), in contrast to those of ZL2001 (Table 2 and Fig. 4C and D). This improvement was less than that in a previous report showing a 132% Er-A increase by adding the SAMS gene into S. erythraea (38) but consistent with the finding that SAM has a positive effect on Er yield.

Fig. 4. — Foreign DNA introduction for improving Er-A production. (A) Genotypes of recombinant *S. erythraea* strains ZL2003, ZL2004, and ZL2005. Primer sets are labeled along with their predicted fragment sizes. (B) PCR amplification with the genomic templates from *S. erythraea* strains. The primer pair p2f and p3r was used to examine a 0.5-kb product for determining the region surrounding *attL* (lanes 1 to 4). The primer pair p3f and p2r was used to examine a 0.6-kb product for determining the region surrounding *attR* (lanes 5 to 8). Lanes 1 and 5, the original strain, *S. erythraea* HL3168 E3; lanes 2 and 6, ZL2003; lanes 3 and 7, ZL2004; lanes 4 and 8, ZL2005; and lane 9, marker II. (C) Er titers in fermentations of ZL2003, ZL2004, and ZL2005. (D) HPLC analysis of the production of Er-A, Er-B, and Er-C, with standards as the control, in ZL2003, ZL2004, and ZL2005.

Introduction of Vitreoscilla hemoglobin vhb gene into ZL2001 along with the SAMS gene.

We next added an exogenous gene, vhb, along with the SAMS gene into ZL2001, aiming at improving Er production by increasing the oxygen supply. Vhb is a potent bacterial hemoglobin for oxygen uptake and transportation. Heterologous overexpression of its encoding gene (vhb) in various cells (e.g., bacteria, fungi, yeasts, and plants) often enhances the oxygen-dependent metabolic processes, leading to improvements in cell growth and in metabolite-producing ability (13, 14, 16, 17, 28). Using a ΦC31-based vector as the carrier, a previous study showed that expression of vhb in S. erythraea positively impacted Er production (5); however, the locus for chromosomal integration has not been precisely determined. By the efficient conjugation method described above, we consequently integrated into the chromosome of ZL2001 a pSET152 derivative (pZL2008) that carries PermE*-vhb-SAMS gene, yielding recombinant strain ZL2004 with the genotype attL linear pZL2004 (PermE*-vhb-SAMS gene) attR only at the designed attB locus (Fig. 4A and B). Compared with ZL2001, ZL2004 produced Er with a titer at 3,701 ± 537 U/ml (21.0% improved), among which the Er-A yield was 3,640 mg/liter (19.3% improved), showing that an accumulated positive effect on Er production resulted from the introduction of vhb and the SAMS gene into ZL2001 (Table 2 and Fig. 4C and 4D).

Incorporation of additional tailoring genes eryK and eryG with vhb and the SAMS gene in ZL2001.

Inspired by the success with ZL2003 (PermE*-SAMS gene) and ZL2004 (PermE*-vhb-SAMS gene), which produced Ers with apparently improved yields, we finally incorporated into ZL2001 two tailoring genes from the Er-A biosynthetic pathway—that is, the P450 hydroxylase gene eryK and the O-methyltransferase gene eryG—along with vhb and the SAMS gene, in order to eliminate the Er-A-associated by-products Er-B and Er-C at the fermentation stage of S. erythraea. We have previously shown that upon homologous recombination for introducing additional eryK and eryG sequences, both Er-B and Er-C can be nearly completely converted into Er-A when the copy number ratio of eryK to eryG is 3:2, given the improved but optimized activities for EryK-catalyzed C-12 hydroxylation of the aglycone and EryG-catalyzed C-3″ O-methylation of the macrose moiety (7). As a result, a pSET152 derivative that carries PermE*-vhb-SAMS gene-PermE*-eryK-eryG-eryK, pZL2010, was constructed and then introduced into ZL2001 by the established conjugation method to give recombinant strain ZL2005 (Fig. 4A). The exconjugants were identified, showing a frequency similar to that when pSET152 was used as the control to generate ZL2002. At least 10 exconjugants were selected for PCR amplification-coupled sequencing, revealing the identical genotype, attL linear pZL2010 (PermE*-vhb-SAMS gene-PermE*-eryK-eryG-eryK) attR (Fig. 4B). Since the introduced DNA harbors the endogenous genes eryK (two copies) and eryG (one copy), there is the potential for homologous recombination to an eryK- and eryG-containing, Er biosynthetic gene cluster. The only genotype for all exconjugants, as described above, supported the finding that in the presence of the artificial attB cassette, the efficiency of ΦC31-based site-specific integration apparently preceded that of homologous recombination in S. erythraea. Using ZL2001 as the control, we subsequently evaluated the Er-producing ability of ZL2005, showing a significant increase in Er titer (4,148 ± 591 U/ml, 35.6% improved) (Fig. 4C). In particular, HPLC analysis revealed that the concentration of Er-B (50 mg/liter, 90.6% lower) plus Er-C (110 mg/liter, 69.4% lower) dramatically decreased in ZL2005 and that Er-A production (4,170 mg/liter, 36.7% improved) and purity (given the ratio of Er-A to a sum of Er-B plus Er-C of 26.1:1) accordingly increased in the fermentation broth (Table 2 and Fig. 4D). These findings indicated that most of the Er-B and Er-C impurities were converted into Er-A by optimizing the enhanced activity of tailoring enzymes EryK and EryG.

DISCUSSION

As the outcomes of countless pioneers working with the traditional methods for over half a century, the industrially used antibiotic-producing strains serve as the starting point to incorporate the recent genetic approaches for further improvement. On the other hand, many of them (including the Er-producing S. erythraea strains), which have suffered multiple rounds of random mutagenesis during the screening process, are experientially more resistant than the original isolates to the available methods of genetic manipulation. To rapidly evaluate the effectiveness of various optimizing strategies, it is extremely necessary to construct genetically amenable testing platforms based on industrial strains.

By replacing the three PKS genes (i.e., eryAI-eryAII-eryAIII within the Er biosynthetic gene cluster) for 6-DEB formation with an attB sequence in an industrial Er-producing S. erythraea strain, Rodriguez and coworkers have previously exploited its overproduction properties via efficient conjugation for delivering large PKS expression vectors by ΦC31-based integration (31). This validated the feasibility of applying ΦC31 integrase-catalyzed site-specific recombination into S. erythraea engineering; however, genetic manipulation had been confined to the biosynthetic gene cluster itself before genome sequencing. In the past 10 years, the explosion of DNA sequencing technologies has greatly benefited investigations of antibiotic-producing strains, and the Er producer S. erythraea is no exception (25). Apparently, the availability of the genome information for S. erythraea extends the range for genetic engineering from the gene cluster to the whole genome. According to this, we constructed an artificial attB cassette at the locus of a cryptic gene, nrps1-1, on the chromosome of an industrial Er-producing strain, S. erythraea HL3168 E3, setting the stage for ΦC31 integrase-mediated precise engineering for introduction of foreign DNA at this locus. The advantage of this method is that it provides a specific site for engineering to systematically evaluate various strategies for improving Er production as well as retaining the intrinsic high-Er-producing ability of the original strain.

Our initial goals of inserting an eight-attB-sequence cassette include (i) the insertion of a cassette of a suitable size of 426 bp that facilitates general cloning and (ii) the offering of multiple attB sequences for tandem insertions of the constructs derived from the vectors that contain the ΦC31 integrase gene and attP site but that differ in resistance (S. erythraea is sensitive to apramycin and thiostrepton) marker genes (aiming at rapidly testing the combined strategies). Though the latter application was excluded, given that an additional seven attB sequences were accordingly eliminated when one integration took place, the engineered Er-producing strain ZL2001 is amenable to rational genetic engineering via ΦC31-based site-specific recombination with a reliable conjugation frequency (about 5.0 × 10⁻⁷ when 1.0 × 10⁸ cells of ZL2001 served as the recipients in all tests in this study, even though the inserted DNA fragments varied in length from 5.5 kb to 12.4 kb) that was constantly much higher than that of the original strain. The previous study showed that more than 30-kb PKS genes can be transferred in a similar way (31); therefore, the potential for integration of a large DNA fragment (e.g., gene cluster) in ZL2001 exists, if needed in future evaluation efforts.

In this study, the utility of the engineered strain ZL2001 broke the technical bottlenecks previously encountered during manipulation mainly from homologous or unpredictable nonspecific recombination. Taking advantage of the useful platform, introductions of either exogenous or endogenous genes that are of importance to Er biosynthesis, including the SAMS gene for enhancing positive regulation, vhb for increasing the oxygen supply, and tailoring genes eryK and eryG for optimizing the biotransformation of the by-products Er-B and Er-C into Er-A, were achieved via the designed artificial attB cassette. The recombinant strains generated in this fashion showed an Er-producing ability improved in quantity and quality, making it practical to continuously evolve the Er biosynthetic system for improving Er-A production and purity in S. erythraea. In general, the strategy developed here can be applicable to other industrial or academic microorganisms to establish an efficient site-specific method of foreign DNA introduction that is challenging for strains lacking the attB site on the chromosome.

ACKNOWLEDGMENTS

This work was supported in part by grants from the National Natural Science Foundation (20832009 and 20921091), the National Basic Research Program (973 program, 2012CB721100 and 2010CB833200), the Chinese Academy of Sciences (KJCX2-YW-201), and the Science and Technology Commission of Shanghai Municipality (09QH1402700) of China.

Footnotes

^▿

Published ahead of print on 12 August 2011.

REFERENCES

1. Adrio J. L., Demain A. L. 2006. Genetic improvement of processes yielding microbial products. FEMS Microbiol. Rev. 30:187–214 [DOI] [PubMed] [Google Scholar]
2. Baltz R. H. 2006. Molecular engineering approaches to peptide, polyketide and other antibiotics. Nat. Biotechnol. 24:1533–1540 [DOI] [PubMed] [Google Scholar]
3. Baltz R. H. 2010. Streptomyces and Saccharopolyspora hosts for heterologous expression of secondary metabolite gene clusters. J. Ind. Microbiol. Biotechnol. 37:759–772 [DOI] [PubMed] [Google Scholar]
4. Bierman M., et al. 1992. Plasmid cloning vectors for the conjugal transfer of DNA from Escherichia coli to Streptomyces spp. Gene 116:43–49 [DOI] [PubMed] [Google Scholar]
5. Brunker P., Minas W., Kallio P. T., Bailey J. E. 1998. Genetic engineering of an industrial strain of Saccharopolyspora erythraea for stable expression of the Vitreoscilla haemoglobin gene (vhb). Microbiology 144(Pt 9):2441–2448 [DOI] [PubMed] [Google Scholar]
6. Butler M. S. 2008. Natural products to drugs: natural product-derived compounds in clinical trials. Nat. Prod. Rep. 25:475–516 [DOI] [PubMed] [Google Scholar]
7. Chen Y., et al. 2008. Genetic modulation of the overexpression of tailoring genes eryK and eryG leading to the improvement of erythromycin A purity and production in Saccharopolyspora erythraea fermentation. Appl. Environ. Microbiol. 74:1820–1828 [DOI] [PMC free article] [PubMed] [Google Scholar]
8. Combes P., Till R., Bee S., Smith M. C. 2002. The Streptomyces genome contains multiple pseudo-attB sites for the (phi)C31-encoded site-specific recombination system. J. Bacteriol. 184:5746–5752 [DOI] [PMC free article] [PubMed] [Google Scholar]
9. Deubel A., Holzgrabe U. 2007. Development of an enhanced separation of erythromycin and its related substances by liquid chromatography. J. Pharm. Biomed. Anal. 43:493–498 [DOI] [PubMed] [Google Scholar]
10. Fischbach M. A., Walsh C. T. 2006. Biochemistry directing biosynthesis. Science 314:603–605 [DOI] [PubMed] [Google Scholar]
11. Gupta M., Till R., Smith M. C. 2007. Sequences in attB that affect the ability of phiC31 integrase to synapse and to activate DNA cleavage. Nucleic Acids Res. 35:3407–3419 [DOI] [PMC free article] [PubMed] [Google Scholar]
12. Haydock S. F., et al. 1991. Cloning and sequence analysis of genes involved in erythromycin biosynthesis in Saccharopolyspora erythraea: sequence similarities between EryG and a family of S-adenosylmethionine-dependent methyltransferases. Mol. Gen. Genet. 230:120–128 [DOI] [PubMed] [Google Scholar]
13. Holmberg N., Lilius G., Bailey J. E., Bulow L. 1997. Transgenic tobacco expressing Vitreoscilla hemoglobin exhibits enhanced growth and altered metabolite production. Nat. Biotechnol. 15:244–247 [DOI] [PubMed] [Google Scholar]
14. Kallio P. T., Bailey J. E. 1996. Intracellular expression of Vitreoscilla hemoglobin (VHb) enhances total protein secretion and improves the production of alpha-amylase and neutral protease in Bacillus subtilis. Biotechnol. Prog. 12:31–39 [DOI] [PubMed] [Google Scholar]
15. Katz L., Ashley G. W. 2005. Translation and protein synthesis: macrolides. Chem. Rev. 105:499–528 [DOI] [PubMed] [Google Scholar]
16. Khosla C., Bailey J. E. 1988. Heterologous expression of a bacterial haemoglobin improves the growth properties of recombinant Escherichia coli. Nature 331:633–635 [DOI] [PubMed] [Google Scholar]
17. Khosla C., Bailey J. E. 1988. The Vitreoscilla hemoglobin gene: molecular cloning, nucleotide sequence and genetic expression in Escherichia coli. Mol. Gen. Genet. 214:158–161 [DOI] [PubMed] [Google Scholar]
18. Kieser T., Bibb M. J., Buttner M. J., Chater K. F., Howood D. A. 2000. Practical Streptomyces genetics. John Innes Foundation, Norwich, United Kingdom [Google Scholar]
19. Kim D. J., et al. 2003. Accumulation of S-adenosyl-l-methionine enhances production of actinorhodin but inhibits sporulation in Streptomyces lividans TK23. J. Bacteriol. 185:592–600 [DOI] [PMC free article] [PubMed] [Google Scholar]
20. Labeda D. P. 1987. Transfer of the type strain of Streptomyces erythraeus (Waksman 1923) Waksman and Henrici 1948 to the genus Saccharopolyspora Lacey and Goodfellow 1975 as Saccharopolyspora erythraea sp. nov., and designation of a neotype strain for Streptomyces erythraeus. Int. J. Syst. Bacteriol. 37:19–22 [Google Scholar]
21. Lambalot R. H., Cane D. E., Aparicio J. J., Katz L. 1995. Overproduction and characterization of the erythromycin C-12 hydroxylase, EryK. Biochemistry 34:1858–1866 [DOI] [PubMed] [Google Scholar]
22. Liu W., Shen B. 2000. Genes for production of the enediyne antitumor antibiotic C-1027 in Streptomyces globisporus are clustered with the cagA gene that encodes the C-1027 apoprotein. Antimicrob. Agents Chemother. 44:382–392 [DOI] [PMC free article] [PubMed] [Google Scholar]
23. Minas W., Brunker P., Kallio P. T., Bailey J. E. 1998. Improved erythromycin production in a genetically engineered industrial strain of Saccharopolyspora erythraea. Biotechnol. Prog. 14:561–566 [DOI] [PubMed] [Google Scholar]
24. Okamoto S., Lezhava A., Hosaka T., Okamoto-Hosoya Y., Ochi K. 2003. Enhanced expression of S-adenosylmethionine synthetase causes overproduction of actinorhodin in Streptomyces coelicolor A3(2). J. Bacteriol. 185:601–609 [DOI] [PMC free article] [PubMed] [Google Scholar]
25. Oliynyk M., et al. 2007. Complete genome sequence of the erythromycin-producing bacterium Saccharopolyspora erythraea NRRL23338. Nat. Biotechnol. 25:447–453 [DOI] [PubMed] [Google Scholar]
26. Parekh S., Vinci V. A., Strobel R. J. 2000. Improvement of microbial strains and fermentation processes. Appl. Microbiol. Biotechnol. 54:287–301 [DOI] [PubMed] [Google Scholar]
27. Paulus T. J., et al. 1990. Mutation and cloning of eryG, the structural gene for erythromycin O-methyltransferase from Saccharopolyspora erythraea, and expression of eryG in Escherichia coli. J. Bacteriol. 172:2541–2546 [DOI] [PMC free article] [PubMed] [Google Scholar]
28. Pendse G. J., Bailey J. E. 1994. Effect of Vitreoscilla hemoglobin expression on growth and specific tissue plasminogen activator productivity in recombinant Chinese hamster ovary cells. Biotechnol. Bioeng. 44:1367–1370 [DOI] [PubMed] [Google Scholar]
29. Reeves A. R., et al. 2006. Effects of methylmalonyl-CoA mutase gene knockouts on erythromycin production in carbohydrate-based and oil-based fermentations of Saccharopolyspora erythraea. J. Ind. Microbiol. Biotechnol. 33:600–609 [DOI] [PubMed] [Google Scholar]
30. Reeves A. R., et al. 2007. Engineering of the methylmalonyl-CoA metabolite node of Saccharopolyspora erythraea for increased erythromycin production. Metab. Eng. 9:293–303 [DOI] [PMC free article] [PubMed] [Google Scholar]
31. Rodriguez E., et al. 2003. Rapid engineering of polyketide overproduction by gene transfer to industrially optimized strains. J. Ind. Microbiol. Biotechnol. 30:480–488 [DOI] [PubMed] [Google Scholar]
32. Sambrook J., Russell D. W. 2001. Molecular cloning: a laboratory manual, 3rd ed Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY [Google Scholar]
33. Stassi D., Donadio S., Staver M. J., Katz L. 1993. Identification of a Saccharopolyspora erythraea gene required for the final hydroxylation step in erythromycin biosynthesis. J. Bacteriol. 175:182–189 [DOI] [PMC free article] [PubMed] [Google Scholar]
34. Staunton J., Weissman K. J. 2001. Polyketide biosynthesis: a millennium review. Nat. Prod. Rep. 18:380–416 [DOI] [PubMed] [Google Scholar]
35. Thorpe H. M., Smith M. C. 1998. In vitro site-specific integration of bacteriophage DNA catalyzed by a recombinase of the resolvase/invertase family. Proc. Natl. Acad. Sci. U. S. A. 95:5505–5510 [DOI] [PMC free article] [PubMed] [Google Scholar]
36. Tsuji K., Goetz J. F. 1978. HPLC as a rapid means of monitoring erythromycin and tetracycline fermentation processes. J. Antibiot. (Tokyo) 31:302–308 [DOI] [PubMed] [Google Scholar]
37. Walsh C. T., Fischbach M. A. 2010. Natural products version 2.0: connecting genes to molecules. J. Am. Chem. Soc. 132:2469–2493 [DOI] [PMC free article] [PubMed] [Google Scholar]
38. Wang Y., Chu J., Zhuang Y., Zhang L., Zhang S. 2007. Improved production of erythromycin A by expression of a heterologous gene encoding S-adenosylmethionine synthetase. Appl. Microbiol. Biotechnol. 75:837–842 [DOI] [PubMed] [Google Scholar]
39. Weissman K. J., Leadlay P. F. 2005. Combinatorial biosynthesis of reduced polyketides. Nat. Rev. Microbiol. 3:925–936 [DOI] [PubMed] [Google Scholar]

[B1] 1. Adrio J. L., Demain A. L. 2006. Genetic improvement of processes yielding microbial products. FEMS Microbiol. Rev. 30:187–214 [DOI] [PubMed] [Google Scholar]

[B2] 2. Baltz R. H. 2006. Molecular engineering approaches to peptide, polyketide and other antibiotics. Nat. Biotechnol. 24:1533–1540 [DOI] [PubMed] [Google Scholar]

[B3] 3. Baltz R. H. 2010. Streptomyces and Saccharopolyspora hosts for heterologous expression of secondary metabolite gene clusters. J. Ind. Microbiol. Biotechnol. 37:759–772 [DOI] [PubMed] [Google Scholar]

[B4] 4. Bierman M., et al. 1992. Plasmid cloning vectors for the conjugal transfer of DNA from Escherichia coli to Streptomyces spp. Gene 116:43–49 [DOI] [PubMed] [Google Scholar]

[B5] 5. Brunker P., Minas W., Kallio P. T., Bailey J. E. 1998. Genetic engineering of an industrial strain of Saccharopolyspora erythraea for stable expression of the Vitreoscilla haemoglobin gene (vhb). Microbiology 144(Pt 9):2441–2448 [DOI] [PubMed] [Google Scholar]

[B6] 6. Butler M. S. 2008. Natural products to drugs: natural product-derived compounds in clinical trials. Nat. Prod. Rep. 25:475–516 [DOI] [PubMed] [Google Scholar]

[B7] 7. Chen Y., et al. 2008. Genetic modulation of the overexpression of tailoring genes eryK and eryG leading to the improvement of erythromycin A purity and production in Saccharopolyspora erythraea fermentation. Appl. Environ. Microbiol. 74:1820–1828 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B8] 8. Combes P., Till R., Bee S., Smith M. C. 2002. The Streptomyces genome contains multiple pseudo-attB sites for the (phi)C31-encoded site-specific recombination system. J. Bacteriol. 184:5746–5752 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B9] 9. Deubel A., Holzgrabe U. 2007. Development of an enhanced separation of erythromycin and its related substances by liquid chromatography. J. Pharm. Biomed. Anal. 43:493–498 [DOI] [PubMed] [Google Scholar]

[B10] 10. Fischbach M. A., Walsh C. T. 2006. Biochemistry directing biosynthesis. Science 314:603–605 [DOI] [PubMed] [Google Scholar]

[B11] 11. Gupta M., Till R., Smith M. C. 2007. Sequences in attB that affect the ability of phiC31 integrase to synapse and to activate DNA cleavage. Nucleic Acids Res. 35:3407–3419 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B12] 12. Haydock S. F., et al. 1991. Cloning and sequence analysis of genes involved in erythromycin biosynthesis in Saccharopolyspora erythraea: sequence similarities between EryG and a family of S-adenosylmethionine-dependent methyltransferases. Mol. Gen. Genet. 230:120–128 [DOI] [PubMed] [Google Scholar]

[B13] 13. Holmberg N., Lilius G., Bailey J. E., Bulow L. 1997. Transgenic tobacco expressing Vitreoscilla hemoglobin exhibits enhanced growth and altered metabolite production. Nat. Biotechnol. 15:244–247 [DOI] [PubMed] [Google Scholar]

[B14] 14. Kallio P. T., Bailey J. E. 1996. Intracellular expression of Vitreoscilla hemoglobin (VHb) enhances total protein secretion and improves the production of alpha-amylase and neutral protease in Bacillus subtilis. Biotechnol. Prog. 12:31–39 [DOI] [PubMed] [Google Scholar]

[B15] 15. Katz L., Ashley G. W. 2005. Translation and protein synthesis: macrolides. Chem. Rev. 105:499–528 [DOI] [PubMed] [Google Scholar]

[B16] 16. Khosla C., Bailey J. E. 1988. Heterologous expression of a bacterial haemoglobin improves the growth properties of recombinant Escherichia coli. Nature 331:633–635 [DOI] [PubMed] [Google Scholar]

[B17] 17. Khosla C., Bailey J. E. 1988. The Vitreoscilla hemoglobin gene: molecular cloning, nucleotide sequence and genetic expression in Escherichia coli. Mol. Gen. Genet. 214:158–161 [DOI] [PubMed] [Google Scholar]

[B18] 18. Kieser T., Bibb M. J., Buttner M. J., Chater K. F., Howood D. A. 2000. Practical Streptomyces genetics. John Innes Foundation, Norwich, United Kingdom [Google Scholar]

[B19] 19. Kim D. J., et al. 2003. Accumulation of S-adenosyl-l-methionine enhances production of actinorhodin but inhibits sporulation in Streptomyces lividans TK23. J. Bacteriol. 185:592–600 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B20] 20. Labeda D. P. 1987. Transfer of the type strain of Streptomyces erythraeus (Waksman 1923) Waksman and Henrici 1948 to the genus Saccharopolyspora Lacey and Goodfellow 1975 as Saccharopolyspora erythraea sp. nov., and designation of a neotype strain for Streptomyces erythraeus. Int. J. Syst. Bacteriol. 37:19–22 [Google Scholar]

[B21] 21. Lambalot R. H., Cane D. E., Aparicio J. J., Katz L. 1995. Overproduction and characterization of the erythromycin C-12 hydroxylase, EryK. Biochemistry 34:1858–1866 [DOI] [PubMed] [Google Scholar]

[B22] 22. Liu W., Shen B. 2000. Genes for production of the enediyne antitumor antibiotic C-1027 in Streptomyces globisporus are clustered with the cagA gene that encodes the C-1027 apoprotein. Antimicrob. Agents Chemother. 44:382–392 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B23] 23. Minas W., Brunker P., Kallio P. T., Bailey J. E. 1998. Improved erythromycin production in a genetically engineered industrial strain of Saccharopolyspora erythraea. Biotechnol. Prog. 14:561–566 [DOI] [PubMed] [Google Scholar]

[B24] 24. Okamoto S., Lezhava A., Hosaka T., Okamoto-Hosoya Y., Ochi K. 2003. Enhanced expression of S-adenosylmethionine synthetase causes overproduction of actinorhodin in Streptomyces coelicolor A3(2). J. Bacteriol. 185:601–609 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B25] 25. Oliynyk M., et al. 2007. Complete genome sequence of the erythromycin-producing bacterium Saccharopolyspora erythraea NRRL23338. Nat. Biotechnol. 25:447–453 [DOI] [PubMed] [Google Scholar]

[B26] 26. Parekh S., Vinci V. A., Strobel R. J. 2000. Improvement of microbial strains and fermentation processes. Appl. Microbiol. Biotechnol. 54:287–301 [DOI] [PubMed] [Google Scholar]

[B27] 27. Paulus T. J., et al. 1990. Mutation and cloning of eryG, the structural gene for erythromycin O-methyltransferase from Saccharopolyspora erythraea, and expression of eryG in Escherichia coli. J. Bacteriol. 172:2541–2546 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B28] 28. Pendse G. J., Bailey J. E. 1994. Effect of Vitreoscilla hemoglobin expression on growth and specific tissue plasminogen activator productivity in recombinant Chinese hamster ovary cells. Biotechnol. Bioeng. 44:1367–1370 [DOI] [PubMed] [Google Scholar]

[B29] 29. Reeves A. R., et al. 2006. Effects of methylmalonyl-CoA mutase gene knockouts on erythromycin production in carbohydrate-based and oil-based fermentations of Saccharopolyspora erythraea. J. Ind. Microbiol. Biotechnol. 33:600–609 [DOI] [PubMed] [Google Scholar]

[B30] 30. Reeves A. R., et al. 2007. Engineering of the methylmalonyl-CoA metabolite node of Saccharopolyspora erythraea for increased erythromycin production. Metab. Eng. 9:293–303 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B31] 31. Rodriguez E., et al. 2003. Rapid engineering of polyketide overproduction by gene transfer to industrially optimized strains. J. Ind. Microbiol. Biotechnol. 30:480–488 [DOI] [PubMed] [Google Scholar]

[B32] 32. Sambrook J., Russell D. W. 2001. Molecular cloning: a laboratory manual, 3rd ed Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY [Google Scholar]

[B33] 33. Stassi D., Donadio S., Staver M. J., Katz L. 1993. Identification of a Saccharopolyspora erythraea gene required for the final hydroxylation step in erythromycin biosynthesis. J. Bacteriol. 175:182–189 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B34] 34. Staunton J., Weissman K. J. 2001. Polyketide biosynthesis: a millennium review. Nat. Prod. Rep. 18:380–416 [DOI] [PubMed] [Google Scholar]

[B35] 35. Thorpe H. M., Smith M. C. 1998. In vitro site-specific integration of bacteriophage DNA catalyzed by a recombinase of the resolvase/invertase family. Proc. Natl. Acad. Sci. U. S. A. 95:5505–5510 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B36] 36. Tsuji K., Goetz J. F. 1978. HPLC as a rapid means of monitoring erythromycin and tetracycline fermentation processes. J. Antibiot. (Tokyo) 31:302–308 [DOI] [PubMed] [Google Scholar]

[B37] 37. Walsh C. T., Fischbach M. A. 2010. Natural products version 2.0: connecting genes to molecules. J. Am. Chem. Soc. 132:2469–2493 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B38] 38. Wang Y., Chu J., Zhuang Y., Zhang L., Zhang S. 2007. Improved production of erythromycin A by expression of a heterologous gene encoding S-adenosylmethionine synthetase. Appl. Microbiol. Biotechnol. 75:837–842 [DOI] [PubMed] [Google Scholar]

[B39] 39. Weissman K. J., Leadlay P. F. 2005. Combinatorial biosynthesis of reduced polyketides. Nat. Rev. Microbiol. 3:925–936 [DOI] [PubMed] [Google Scholar]

PERMALINK

Toward Improvement of Erythromycin A Production in an Industrial Saccharopolyspora erythraea Strain via Facilitation of Genetic Manipulation with an Artificial attB Site for Specific Recombination^{^▿}

Jiequn Wu

Qinglin Zhang

Wei Deng

Jiangchao Qian

Siliang Zhang

Wen Liu

Abstract

INTRODUCTION

Fig. 1.

MATERIALS AND METHODS