Abstract
The nucleotide sequence of 5S rRNA from Porphyra yezoensis has been determined to be: pACGUACGGCCAUAUCCGAGACACGCGUACCGGAACCCAUUCCGAAUUCCGAAGUCAAGCGUCCGCGAGUUGGGUUAGU - AAUCUGGUGAAAGAUCACAGGCGAACCCCCAAUGCUGUACGUC. This 5S rRNA sequence is most similar to that of Euglena gracilis (63% homology).
Full text
PDF



Selected References
These references are in PubMed. This may not be the complete list of references from this article.
- Delihas N., Andersen J., Andresini W., Kaufman L., Lyman H. The 5S ribosomal RNA of Euglena gracilis cytoplasmic ribosomes is closely homologous to the 5S RNA of the trypanosomatid protozoa. Nucleic Acids Res. 1981 Dec 11;9(23):6627–6633. doi: 10.1093/nar/9.23.6627. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Erdmann V. A. Collection of published 5S and 5.8S RNA sequences and their precursors. Nucleic Acids Res. 1982 Jan 22;10(2):r93–115. doi: 10.1093/nar/10.2.762-c. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Hori H., Osawa S. Evolutionary change in 5S RNA secondary structure and a phylogenic tree of 54 5S RNA species. Proc Natl Acad Sci U S A. 1979 Jan;76(1):381–385. doi: 10.1073/pnas.76.1.381. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Hori H., Osawa S., Iwabuchi M. The nucleotide sequence of 5S rRNA from a cellular slime mold Dictyostelium discoideum. Nucleic Acids Res. 1980 Dec 11;8(23):5535–5539. doi: 10.1093/nar/8.23.5535. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kimura M., Ohta T. Eukaryotes-prokaryotes divergence estimated by 5S ribosomal RNA sequences. Nat New Biol. 1973 Jun 13;243(128):199–200. doi: 10.1038/newbio243199a0. [DOI] [PubMed] [Google Scholar]
- Sugiura M., Suzuki M., Ohtsuka E., Nishikawa S., Uemura H., Ikehara M. Purification of T4 RNA ligase by 2', 5'-ADP sepharose chromatography. FEBS Lett. 1979 Jan 1;97(1):73–76. doi: 10.1016/0014-5793(79)80055-1. [DOI] [PubMed] [Google Scholar]
- Sugiura M., Takanami M. Analysis of the 5'-terminal nucleotide sequences of ribonucleic acids. II. Comparison of the 5'-terminal nucleotide sequences of ribosomal RNA's from different organisms. Proc Natl Acad Sci U S A. 1967 Oct;58(4):1595–1602. doi: 10.1073/pnas.58.4.1595. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Takaiwa F., Sugiura M. Cloning and characterization of 4.5S and 5S RNA genes in tobacco chloroplasts. Gene. 1980 Jul;10(2):95–103. doi: 10.1016/0378-1119(80)90127-4. [DOI] [PubMed] [Google Scholar]
