Skip to main content
PLOS One logoLink to PLOS One
. 2011 Nov 10;6(11):e26779. doi: 10.1371/journal.pone.0026779

Integrating Overlapping Structures and Background Information of Words Significantly Improves Biological Sequence Comparison

Qi Dai 1,*, Lihua Li 2, Xiaoqing Liu 3, Yuhua Yao 1, Fukun Zhao 1, Michael Zhang 4
Editor: Dov Joseph Stekel5
PMCID: PMC3213098  PMID: 22102867

Abstract

Word-based models have achieved promising results in sequence comparison. However, as the important statistical properties of words in biological sequence, how to use the overlapping structures and background information of the words to improve sequence comparison is still a problem. This paper proposed a new statistical method that integrates the overlapping structures and the background information of the words in biological sequences. To assess the effectiveness of this integration for sequence comparison, two sets of evaluation experiments were taken to test the proposed model. The first one, performed via receiver operating curve analysis, is the application of proposed method in discrimination between functionally related regulatory sequences and unrelated sequences, intron and exon. The second experiment is to evaluate the performance of the proposed method with f-measure for clustering Hepatitis E virus genotypes. It was demonstrated that the proposed method integrating the overlapping structures and the background information of words significantly improves biological sequence comparison and outperforms the existing models.

Introduction

With the development of high-throughput sequencing technology, the rate of addition of new sequences to the databases increases continuously. However, such a collection of sequences does not by itself increase the scientist's understanding of the biology of organisms. Comparing a new sequence with the sequences of known functions is an effective way of assigning function to the new genes/proteins and understanding the biology of that organism from which the new sequence comes.

Owing to the importance of sequence comparison, numerous researches have been taken in past and obtained some effective tools for similarity search [1][8], evolutionary study [9][19], and classification [20][23]. The methods developed for sequence comparison can be categorized into two classes. One is alignment-based methods, in which a matrix of numbers that represents all possible alignments between two sequences is obtained with dynamic programming, and the highest set of sequential scores in the matrix defines an optimal alignment. Waterman (1995) and Durbin et al. (1998) provided comprehensive reviews about this method [24], [25]. But the search for optimal solutions using alignment-based method has problems in: (i) computational load with regard to large databases [2]; (ii) choice of the scoring schemes [26]. Therefore, the emergence of research into the second class, alignment-free method, is apparent and necessary to overcome critical limitations of alignment-based methods [2], [3], [5], [6], [12], [13].

Up to now, many efficient alignment-free methods have been proposed, but they are still in the early development compared with alignment-based measure [2], [5], [6], [26][36]. One of the most widely used alignment-free approaches is word-based model that meets the need for rapid sequence comparison. In this model, each sequence is first mapped into an Inline graphic-dimensional vector according to its Inline graphic-word frequencies, and sequence similarity can then be measured by distance measures, such as Euclidean distance [27], Mahalanobis distance [28], Kullback-Leibler discrepancy [29], [30] and Cosine distance [31]. When the Inline graphic-words occurring in biological sequence are estimative probabilities rather than the frequencies, they are more readily optimized by more complex models, such as Markov model [2], [33][35], mixed model [5], [6] and Bernoulli model [36]. These complex models could be considered to be the modification of traditional word-based models, in which several critical problems still exist in their development as described below.

First, little attention has been paid to the overlapping structures of the words in biological sequences [2], [5], [27][29], [31], [33], [34]. Overlapping occurrences of a word Inline graphic are the occurrences of the word Inline graphic that overlaps the previous occurrence of the word Inline graphic. For instance, in the sequence ACGAATAATAAATAAGGCAATAAC, there are four occurrences of AATAA (starting at positions 4, 7, 11 and 19). But the occurrence of AATAA starting at the position 4 is different from the one starting at the position 19, because the form is composed of three overlapping occurrences of AATAA whereas the second one is composed of a unique occurrence. Because the overlapping structure of the words usually form conservative patterns in biological sequences that are strongly associated with genes [37], [38], the overlapping structures of the words should be taken into account when comparing two biological sequences.

Second, background information of the words has not been fully utilized in existing biological sequence comparison [27][29], [31], [33], [34], [36]. Mutations take place randomly at molecular level, and natural selections shape the direction of evolution. In order to highlight the contribution of selective evolution, random background from the simple counting result was proposed to build a composition vector (CV) and has been used with minor modification for phylogenetic studies of prokaryotes and viruses [33], [34]. Recently, Lu Inline graphic. found some statistical problems associated with composition vector (CV) and proposed an improved composition vector (ICV) method based on a known word distribution [36]. However, due to the fact that the word distribution is usually unknown in most cases, and each biological sequence has its own word distribution, the ICV method is of limited use.

This paper proposed an efficient statistical method for sequence comparison. It takes into consideration the overlapping occurrences of the words and has the ability to adjust the background information of the words in biological sequences. The contents can be summarized as follows:

  1. An efficient word-based statistical measure based on the statistical model proposed by Schbath [39] was proposed, which utilizes the Markov model to estimate the variance of word frequencies and decomposes the similarity score into a sum of similarities of the normalized word frequencies.

  2. Extensive experiments were taken to evaluate the performance of proposed model in discrimination between (a) functionally related regulatory sequences and unrelated sequences, intron and exon, and (b) different HEV genotypes. A comparison of proposed method with existing alignment-based and alignment-free models was also taken to assess its superiority.

Methods

Word-based Statistical Models (WSM)

Background information of words

A biological sequence can be described as a succession of symbols, and a Inline graphic-word is a series of Inline graphic consecutive letters in the sequence. For a sequence Inline graphic, the count of a Inline graphic-word Inline graphic, denoted by Inline graphic, is the number of occurrence of the word Inline graphic in the sequence Inline graphic. The position of an occurrence of the word Inline graphic is defined by the position of its first letter Inline graphic. We define a random indicator Inline graphic of an occurrence of Inline graphic at position Inline graphic, Inline graphic, in Inline graphic by

graphic file with name pone.0026779.e023.jpg

The occurrence frequency of the word Inline graphic in the sequence Inline graphic can be calculated with the random indicators of occurrence

graphic file with name pone.0026779.e026.jpg (1)

DNA and protein sequences have been realized to be a mixture of local regions that consist of compositional characteristics and pseudo-periodic sequence patterns. To utilize the background information of these local regions, we choose Markov model as a background model. It takes into consideration this ‘periodical’ behavior of the bio-signal by making use of transition probability matrix Inline graphic and initial state distribution Inline graphic.

Because Inline graphic is a random Bernoulli variable, the probability Inline graphic under the Markov model with order Inline graphic (MInline graphic) can be calculated by

graphic file with name pone.0026779.e033.jpg (2)

For convenience, let Inline graphic denote the probability of the word Inline graphic to appear at a given position in the sequence, and expectation of the Inline graphic under the Markov model (MInline graphic) is Inline graphic. With the expectation Inline graphic, we can get the expectation of the word frequency Inline graphic under the Markov model (MInline graphic)

graphic file with name pone.0026779.e042.jpg (3)

Overlapping structures of words

Occurrences of the same word may overlap, and these overlapped words usually form a conservative pattern that is strongly associated with conservative motif [38]. So it is valuable that the overlapping structures of the words are taken into consideration when comparing two biological sequences. Here, we measure the ability of a word to overlap itself with a overlapping indicator, Inline graphic , defined as follows:

graphic file with name pone.0026779.e044.jpg

where Inline graphic. With the Inline graphic, we can calculate the probability of observing two overlapping occurrences with Inline graphic (Inline graphic) letters in common and two non-overlapping occurrences of the word Inline graphic separated by Inline graphic letters (Inline graphic) under the Markov model (MInline graphic) as follows:

graphic file with name pone.0026779.e053.jpg (4)

Since the variables Inline graphic and Inline graphic are not independent under the Markov model [39][41], their effects can be described by their covariance

graphic file with name pone.0026779.e056.jpg (5)

With the above formulas, we can calculate the variance of the Inline graphic-word frequency Inline graphic under the Markov model (MInline graphic)

graphic file with name pone.0026779.e060.jpg (6)

What we have presented above is the 1-order Markov model, generalizations to high order can be deduced similarly.

Word statistical model

By incorporating the overlapping structures and the background information of the words in the existing statistical model, a novel word-based statistical model is proposed and denoted in a compact form

graphic file with name pone.0026779.e061.jpg (7)

in which the sequence information obtained through the statistical properties of the words was integrated with the overlapping structures and the background information of the words.

There are several distinctive features of this model. First, it emphasizes the structures of the words and indicates differences in terms of their contribution to the conservative patterns. Second, the influence of two overlapping occurrences of the word Inline graphic with Inline graphic (Inline graphic) letters in common and two non-overlapping occurrences of the word Inline graphic separated by Inline graphic letters (Inline graphic) is considered. Finally, Markov model is chosen as the background model instead of Bernoulli model because each biological sequence should have its own word distribution.

Parameter estimation

Since the model parameters are priori unknown, they have to be estimated based on the observed sequences. The accuracy of this estimation is an important issue to be considered, and the existing perturbation theory for Markov chains and hidden Markov models can allow us to assess the uncertainty in the Markov chain behavior given the uncertainty [42], [43]. In this paper, rather than assuming a known word distribution like [36], we estimate the model parameters with the maximum likelihood method [25] and replaces Inline graphic by the following estimator

graphic file with name pone.0026779.e069.jpg (8)

As for the variance, there are several approaches to derive the asymptotic variance. According to the methods proposed by Schbath [39], we have

graphic file with name pone.0026779.e070.jpg (9)

However, in an application where Inline graphic, we derive the asymptotic variance under Markov model MInline graphic (Bernoulli model)

graphic file with name pone.0026779.e073.jpg (10)

where Inline graphic is the estimator of Inline graphic, Inline graphic is the estimator of Inline graphic.

Statistical similarity measure

With the assumption of the uniform distribution (U), Lu [36] calculated the word expectation and variance, and defined the normalization function Inline graphic as:

graphic file with name pone.0026779.e079.jpg (11)

where Inline graphic and Inline graphic are the expectation and variance of the word frequency Inline graphic. The normalization function Inline graphic is necessary but not sufficient, because much effort of this method is to find better ways to utilize evolution information. In addition, the function Inline graphic relies heavily on the word distribution. When the expectation based on background model is strongly associated with the Inline graphic-word frequencies, this function can carry more information, otherwise it will increase the noise accompanied by words with exceptional background frequencies.

For the probability distributions Inline graphic and Inline graphic of a discrete random variable, the relative entropy (also called Kullback-Leibler divergence) of Inline graphic from Inline graphic is defined as

graphic file with name pone.0026779.e090.jpg (12)

where Inline graphic is the cross entropy of Inline graphic and Inline graphic, and Inline graphic is the entropy of Inline graphic. The relative entropy is the most important concept in both statistical biology and information theory. It has been deployed as non-distance similarity measures, such as Inline graphic [29], [30] and Inline graphic [2], to compare biological sequences.

A statistical measure between two proposed statistical models was proposed here based on the cross entropy Inline graphic and Euclidean distance. It is denoted by Inline graphic as follows:

graphic file with name pone.0026779.e100.jpg (13)

where Inline graphic and Inline graphic are two statistical models with Markov order Inline graphic for two biological sequences Inline graphic and Inline graphic, and the set Inline graphic consists of all possible sequences of length Inline graphic with symbol from the alphabet Inline graphic. In the context of DNA sequences, Inline graphic is {A,C,G,T}. It is noticed that the similarity measure Inline graphic satisfies the identity and triangle, but it does not satisfies inequality conditions. So it is only a dissimilarity measure. Another point of interest about this similarity measure is its normalization function that can reduce the noise by ignoring the word expectation in its definition.

Receiver operating curve and F-measure

Receiver Operating Curve analysis. Receiver operating curve (ROC) analysis has been widely used in signal detection and classification [44]. It is usually employed in binary classification of continuous data categorized as positive (1) or negative (0) cases. The classification accuracy can be measured by sensitivity and specificity, which are defined as

graphic file with name pone.0026779.e111.jpg (14)

ROC curve is a graphical plot of sensitivity versus (1-specificity) for different threshold values. The area under a ROC curve (AUC) is an important value used to quantify the quality of a classification because it is a threshold independent performance measure and is closely related to the Wilcoxon signed-rank test [45]. A comprehensive discussion on AUC measure can be found in [46].

F-measure. F-measure is a measure of a test's accuracy and often used in the field of information retrieval for measuring search, document classification, and query classification performance [47]. Both the precision Inline graphic and the recall Inline graphic of the test are used to compute it. Here Inline graphic is the number of correct results divided by the number of all returned results while Inline graphic is the number of correct results divided by the number of results that should have been returned. The traditional F-measure is the harmonic mean of precision and recall:

graphic file with name pone.0026779.e116.jpg (15)

The F-measure can be interpreted as a weighted average of the precision and recall. It ranges from 0 for highest dissimilarity to 1 for identical classifications.

Results

Evaluation on functionally related regulatory sequences

Regulatory sequence comparison plays an important role in the Inline graphic discovery of Inline graphic modules (CRMs) with a common function. If a set of co-regulated genes in a single species is given, we wish to find, in their upstream and downstream regions (henceforth called the ‘control regions’), the CRMs that mediate the common aspect of their expression profiles. The control regions may be tens of Kilobase long for each gene (especially for metazoan genomes), while the CRMs to be discovered are often only hundreds of base pair long. One must therefore search in the control regions for subsequences (the candidate CRMs) that share some functional similarity [5], [6].

The proposed Inline graphic model is tested to evaluate if functionally related sequence pairs are scored better than unrelated pairs of sequences randomly chosen from the genome. In order to facilitate comparison, we choose following seven data sets published by Kantorovitz MR et al. [6]: FLY BLASTODERM (82 CRMs with expression in the blastoderm-stage embryo of the fruitfly, Drosophila melanogaster); FLY PNS [23 CRMs (average length 998 bp) driving expression in the peripheral nervous system in the fruitfly]; FLY TRACHEAL [9 CRMs (average length 1220 bp) involved in regulation of the tracheal system in the fruitfly]; FLYEYE [17 CRMs (average length 894 bp) expressing in the Drosophila eye ]; HUMAN MUSCLE [28 human CRMs (average length 450) regulating muscle specific gene expression]; HUMAN LIVER [9 CRMs (average length 201) driving expression specific to the human liver]; HUMAN HBB [17 CRMs (average length 453) regulating the HBB complex]. They are well studied by [5], [6], [48].

Experimental program is designed according to following settings: (1) A set of CRMs, known to regulate expression in the same tissue, is taken as the ‘positive’ set for each sequence in this set is the really Inline graphic module, and a set of equally many randomly chosen noncoding sequences, with lengths matching the CRMs, is taken as the ‘negative’ set for each sequence in this set is the randomly chosen noncoding sequence not the really Inline graphic module. It would be interesting if we choose negative sequences from nearby regions of the known CRMs (positives), which will presumably have similar word distributions. Here, we chose seven noncoding data sets published by Kantorovitz MR et al. [6] to facilitate comparison with their results. (2) Each pair of sequences in the positive set is compared, and so is each pair in the negative set. (3) The evaluation procedure is based on a binary classification of each sequence pair, where 1 corresponds to the pairs from positive set, 0 corresponds to the pairs from negative set. Let Inline graphic be the number of sequences in the positive set, all the pairs both from the positive and negative sets constitute a vector of length 2Inline graphic. In addition, we can get a vector of length 2Inline graphic consisting of 1 and 0 as class labels. A perfect measure would completely separate the negative from the positive set. Of course, this does not happen in practice, and the classes are interspersed. The ROC curves permit to assess the level of accuracy of this separation without choosing any distance threshold for the separation point. In particular, the AUC will give us a unique number of the relative accuracy of each measure.

For comparison purpose, widely-used alignment tools were tested. These alignment tools include Needleman-Wunsch (global alignment) and Smith-Waterman (local alignment) raw scores, with no correction for statistical significance, using linear gap penalties or affine gap penalties, with a gap penalty of 2. We also implemented four word-based measures: Euclidean distance (Inline graphic) [27], Cosine distance (Inline graphic) [31], Pearson's correlation coefficient (Inline graphic) [32] and Kullback-Leibler discrepancy (Inline graphic) [29]. The performance of the proposed model was also compared with Markov models (Inline graphic [2], composition vector (Inline graphic [33], [34]), Inline graphic [35]) and mixed models (Inline graphic [49], Inline graphic [6], Inline graphic [5] and Inline graphic [5]). In addition to the alignment and statistical models, the improved composition vector (Inline graphic) [36] was also tested. All statistical models based on the Inline graphic-word distribution run with Inline graphic from 2 to 8. The Inline graphic, Inline graphic, Inline graphic, Inline graphic, Inline graphic, Inline graphic and Inline graphic run with Markov order Inline graphic from 0 to 6 and the word length Inline graphic from 2 to 7. For each method, separate tests were performed with all combinations of parameter values, and the best combination was chosen to represent that score in the performance.

The AUCs for different methods are presented in Figure 1 and Table S1 in supplementary material. The first observation is that high accuracy of prediction can be achieved by the proposed measure Inline graphic. In the BLASTODERM experiment, the proposed measure Inline graphic performs better than other alignment-based or alignment-free methods, with the area under ROC curve 0.9036. The next best method is the composition vector Inline graphic. In the PNS experiment, the measure Inline graphic is better than all other measures, its area under ROC curve is 0.9456. In the TRACHEAL experiment, Inline graphic outperforms other measures, and its AUC is 0.975. It is followed by the measure Inline graphic. In the EYE experiment, the area under ROC curve of the measure Inline graphic is 0.9216 , significantly better than that of other statistical methods. The next best measures is the measure Inline graphic. In the MUSCLE experiment, the measure Inline graphic significantly outperforms other methods, and its area under ROC curve is 0.9892. It is followed by the Inline graphic. In LIVER experiments, the measure Inline graphic performs significantly better than other measures, with the area under ROC curve 0.9992. The next best measure is the measure Inline graphic. In HBB experiments, the measure Inline graphic achieves the best performance, followed by the Inline graphic. From the seven experiments, we can see that the proposed measure Inline graphic performs significantly better than other measures among six experiments, with AUC from 0.8935 to 0.9992.

Figure 1. Comparison of AUCs of all models for detection of functionally related regulatory sequences.

Figure 1

Comparison of AUCs of all models for detection of functionally related regulatory sequences. NW-linear and NW-affine denote Needleman-Wunsch (global alignment) raw scores, using linear gap penalties and affine gap penalties, respectively; SW-linear and SW-affine denote Smith-Waterman (local alignment) raw scores, using linear gap penalties and affine gap penalties, respectively; Word-based models are eu, cos, pcc, kld; Markov models are SimM M, CV, D; Mixed models are D2, D2z, S1 and S2; Bernoulli model is ICV.

Human exons and introns classification

Numerous statistical algorithms have been proposed for exons and introns classification [50][53]. A basic assumption of these algorithms is that every exon in a genome should has some distinct sequence features or properties that can distinguish it from the surrounding regions, such as introns or intergenic regions. Competitive results have been obtained in the recognition of the exons and introns of prokaryotes gene, but the discrimination of the exons and introns in human is still a difficult problem because of their limited average length.

The secondary test of the proposed model is to discriminate the human exons and introns. These data sets were organized as follows: 1200 human exons and 1200 human introns are extracted from the human exon and intron data (http://bit.uq.edu.au/altExtron/for human exon and intron datasets), and they are randomly divided into four sets separately. The set of the exons is taken as the ‘positive’ set, and the set of the introns, is taken as the ‘negative’ set.

We took the previous evaluation procedure in this experiment, which make it easier to see effectiveness of various methods. The only difference lies in the parameter selection. Here all the models based on the Inline graphic-word frequency run with the word length Inline graphic from 2 to 6, and the Inline graphic, Inline graphic, Inline graphic, Inline graphic, Inline graphic, Inline graphic and Inline graphic run with Markov order Inline graphic from 0 to 5 and the word length Inline graphic from 2 to 6. The AUCs for different methods are presented in Figure 2 and Table S2 in supplementary material.

Figure 2. Comparison of AUCs of all models for classification of human exons and introns.

Figure 2

Comparison of AUCs of all models for classification of human exons and introns. NW-linear and NW-affine denote Needleman-Wunsch (global alignment) raw scores, using linear gap penalties and affine gap penalties, respectively; SW-linear and SW-affine denote Smith-Waterman (local alignment) raw scores, using linear gap penalties and affine gap penalties, respectively; Word-based models are eu, cos, pcc, kld; Markov models are SimM M, CV, D; Mixed models are D2, D2z, S1 and S2; Bernoulli model is ICV.

In terms of the discriminative power, the proposed Inline graphic achieves the best performance compared to the existing methods, with AUC value ranging from 0.9704 to 0.9887 for the four classification tasks. These are excellent values, given that a perfect classification has an AUC score of 1, which indicates that the Inline graphic method is very effective to distinguish exons and introns in humans in despite of their limited average length.

Clustering HEV genotype

Hepatitis E virus (HEV) is a major cause of enterically transmitted acute hepatitis in developing countries. HEV was classified recently as the sole member of the genus Hepevirus in the family Hepeviridae. Its genome consists of a single-stranded, positive-sense RNA of approximately 7.2 kb, with three partially overlapping open reading frames (ORFs: ORF1, ORF2, and ORF3). Although only one serotype has been identified to-date, HEV displays considerable genetic diversity. Based on the extensive full-length genomic variability noted among different strains, HEV has been classified into four major genotypes [54]. Here, a total of 48 full-length HEV genome sequences are retrieved from NCBI (http://www.ncbi.nlm.nih.gov/), which have been clustered into four genotypes [55][58]. Detail information on 48 full-length HEV genome sequences can be found in Table S3 in supplementary material.

This experiment aims at assessing how well the proposed model performs on identifying HEV genotype. In relation to the clustering literature [59], neighbor-joining [60] can be considered as a hierarchical method. It is chosen to clustering HEV genotypes, which is implemented in BioPerl [61]. As HEV genotypes is a 4-classification problem rather than one, F-measure was used to capture overall performance on HEV genotypes. To evaluate a clustering problem using the F-measure, we need to select a gold standard [59]. Here, the traditional classification was used as the gold standard [54].

In addition to the proposed method, four other typical methods were used for comparison. The used alignment-based method is Clustal W rather than Needleman-Wunsch (global alignment) or Smith-Waterman (local alignment) raw scores, because the length of genome of the HEV is approximately 7.2 kb that is difficult to handle by dynamic algorithm. The measures Inline graphic and Inline graphic were not evaluated as they do not satisfy the identity condition. All statistical models based on the Inline graphic-word distribution run with Inline graphic from 2 to 8. The Inline graphic, Inline graphic, Inline graphic, Inline graphic and Inline graphic run Markov order Inline graphic from 0 to 7 and the word length Inline graphic from 2 to 8. Figure 3 reports the F-measure for all methods on the 48 HEV genomes data set, and more details can be found in Table S4 in supplementary material.

Figure 3. Comparison of F-measures of all models for classification of HEV genotypes.

Figure 3

Comparison of F-measures of all models for classification of HEV genotypes. NW-linear and NW-affine denote Needleman-Wunsch (global alignment) raw scores, using linear gap penalties and affine gap penalties, respectively; SW-linear and SW-affine denote Smith-Waterman (local alignment) raw scores, using linear gap penalties and affine gap penalties, respectively.

Figure 3 shows that the proposed Inline graphic performs better than the other alignment-based or alignment-free methods, with the F-measure 0.9791. This result is consistent with the above results, and we attribute this to the combination of both the words' overlapping structures and words' background information.

Influence of the overlapping structures of the words

For a better understanding of the proposed method, an evaluation of the word overlapping structures in biological sequences was performed. A measure, Inline graphic, which is similar to Inline graphic but defined based on the Inline graphic-word frequencies is defined as follows:

graphic file with name pone.0026779.e191.jpg (16)

where Inline graphic and Inline graphic are the frequencies of the Inline graphic-words in the biological sequences Inline graphic and Inline graphic. The only difference between the measures Inline graphic and Inline graphic is that the overlapping word is considered in the former. Therefore the improvement of the measure Inline graphic can be solely attributed to the overlapping words involved. The AUCs for the measures Inline graphic and Inline graphic are presented in Figure 4.

Figure 4. Comparison of AUCs of the measures WSMm and WSMmf.

Figure 4

From top down, comparison of AUCs of the measures WSMm and WSMmf for predicting functionally related regulatory sequences and classifying human exons and introns.

We observe that the measure Inline graphic significantly outperforms the measure Inline graphic among all the experiments. For functionally related regulatory sequences, classification accuracies of the proposed measure Inline graphic are as high as 0.8935Inline graphic0.9992 in comparison to 0.5308Inline graphic0.8426 with the measure Inline graphic. For human exons and introns classification, the accuracies achieved by the proposed measure Inline graphic is 0.9704Inline graphic0.9887, while the measure Inline graphic only reaches 0.7871Inline graphic0.8518. These results strongly demonstrate that incorporation of the overlapping words information consistently improves both efficiency and effectiveness of the sequence comparison.

Influence of the estimated word variance

Another feature of the proposed measure Inline graphic is that the word variance is estimated upon observed biological sequences without assuming the bases occur randomly with equal chance. To show the efficiency of the estimated word variances, we compared the proposed measure Inline graphic with another statistical measure, Inline graphic, defined as follows:

graphic file with name pone.0026779.e215.jpg (17)

where

graphic file with name pone.0026779.e216.jpg

and E denotes a known word distribution in which the four bases A, C, T, and G occur randomly with equal chance [36], Inline graphic is the length of the words in biological sequences, and Inline graphic is an indicator function, equal to 1 if Inline graphic and equal to 0 otherwise, for Inline graphic.

The Inline graphic assumes that the four bases A, C, T, and G occur randomly with equal chance, while the proposed measure Inline graphic estimates the word variances according to the observed biological sequences. The comparison between the measures Inline graphic and Inline graphic should suggest the influence of the estimated word variance. The AUCs for the measures Inline graphic and Inline graphic are listed in Figure 5.

Figure 5. Comparison of AUCs of the measures WSMm and WSMme.

Figure 5

From top down, comparison of AUCs of the measures WSMm and WSMme for predicting functionally related regulatory sequences and classifying human exons and introns.

In all cases, the classification of the proposed measure Inline graphic is more accurate than that of the measure Inline graphic. For example, by using the estimated word variance, the proposed measure Inline graphic detects the functionally related regulatory sequences with accuracies of 0.8935Inline graphic0.9992, while the measure Inline graphic only detects 0.542Inline graphic0.8426; in the case of discrimination of human exons and introns, 0.9704Inline graphic0.9887 for the measure Inline graphic contrasts with 0.8241Inline graphic0.8656 for the measure Inline graphic. These results demonstrate that estimating variances from the observed sequences could be more promising to improve the biological sequence comparison because it helps the measure Inline graphic to adjust the background information according to the word distribution.

Discussion

This paper proposed an efficient statistical method for biological sequence comparison, which integrates both the overlapping structures and background information of the words in biological sequences. It compares biological sequence by taking advantage of the tendency of the Inline graphic-word conservation. In the application, the proposed method treats the word appearing at a given position as a random variable, estimates the word variance according to the observed sequence, and therefore maximizes the impact of the overlapping structures and background information of the words in sequence. A similar idea was proposed in our previous measures Inline graphic and Inline graphic, but as shown in our experiments, the proposed measure Inline graphic performs significantly better which suggests that the overlapping structures and background information of the words should be included in word-based statistical methods to improve biological sequence comparison.

The proposed method originates from the existing methods but different from them in several key aspects. Blaisdell, Wu et al. and Stuart et al. [27], [29], [31] developed popular sequence comparison methods where similarity/dissimilarity score depends on the measure under the frequency vector of the Inline graphic-words in biological sequence. However, they did not use the background information of Inline graphic-words for sequence comparison, and the probability of the Inline graphic-words under these models is estimated by the occurrences of the Inline graphic-words. Pham and Zuegg [2] also proposed ways to improve biological sequence comparison, but their model is different from ours in that the appearance of the Inline graphic-words are modeled by a Markov model, whose parameters are independent of the Inline graphic-word distribution in biological sequence. We developed a Markov plus Inline graphic-word distribution model [5], based on the idea of adding k-word distribution in sequence to Markov model directly. The way of treating sequence comparison is also different from the proposed method: no information about the overlapping structure of a word in biological sequence was considered in our previous mixed model. Lu et al. [36] found some statistical problems associated with composition vector (CV) [33], [34] and proposed an improved composition vector (ICV) method. Their study assumes that the four bases A, C, T, and G occur randomly with equal chance and derives the expected count of a Inline graphic-word and the count variance in a given sequence Inline graphic based upon this simple assumption. In other words, the word distribution is assumed to be known a priori. But, in most cases the word distribution is usually unknown, and therefore the application of ICV method is very limited in practice. Most importantly, this research demonstrated that integration the overlapping structure of a word with the estimated background information of the words according to the observed sequences is essential to improve biological sequence comparison. In addition, among tree kinds of the experiments, the length of biological sequence varies from 201 (HUMAN LIVER [9 CRMs (average length 201) driving expression specific to the human liver]) to 7.2 kb (the genome of HEV consists of a single-stranded, positive-sense RNA of approximately 7.2 kb). The proposed method achieved the best performance among all the experiments, which indicates that its performance is not influenced by the sequence length. As for the computational efficiency, because the Inline graphic-words in biological sequence are considered in the definition of the statistical measure Inline graphic, its computational efficiency is the same as that of existing methods based on the word-based models [2], [5], [27][29], [31], [33], [34], [36].

One major limitation of the proposed method is that different Inline graphic-words are assumed to be independent under Bernoulli and Markov model which is not always met in practice, and their influence should be taken into consideration. One consequence of our simplification is that the correlations between different Inline graphic-words are ignored and only the same k-word variances are accounted for. A better model should reflect the data covariance structure. Despite of this simplification, we found that the proposed statistical measure essentially improves biological sequence comparison.

Supporting Information

Table S1

AUCs obtained from all the models for detection of functionally related regulatory sequences.

(DOC)

Table S2

AUCs obtained from all the models for classification of human exons and introns.

(DOC)

Table S3

Abbreviation for the strains, accession number, nucleotide length, genotype, and country for each of the 48 complete HEV genomes.

(DOC)

Table S4

F-measures obtained from all the models for classification of HEV genotypes.

(PDF)

Acknowledgments

The authors thank all the anonymous referees for their valuable suggestions and support. In particular, the authors thank Prof. Tuan D. Pham for providing all MATLAB code for SimMM and Prof. Saurabh Sinha for provding the software of D2z, datasets and the technical help.

Footnotes

Competing Interests: The authors have declared that no competing interests exist.

Funding: This work is supported by the National Natural Science Foundation of China (61170316, 61001214, 61003191), National Distinguished Young Research Scientist Award (60788101), and a research grant (Y2100930) from Zhejiang Provincial Natural Science Foundation of China. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

References

  • 1.Altschul SF, Madden TL, Schaffer AA, Zhang J, Zhang Z, et al. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 1997;25:3389–3402. doi: 10.1093/nar/25.17.3389. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Pham TD, Zuegg J. A probabilistic measure for alignment-free sequence comparison. Bioinformatics. 2004;20:3455–3461. doi: 10.1093/bioinformatics/bth426. [DOI] [PubMed] [Google Scholar]
  • 3.Pham TD. Spectral distortion measures for biological sequence comparisons and database searching. Pattern Recog. 2007;40:516–529. [Google Scholar]
  • 4.Smith AA, Vollrath A, Bradfield CA, Craven M. Similarity Queries for Temporal Toxicogenomic Expression Profiles. PLoS Comput Biol. 2008;4(7):e1000116. doi: 10.1371/journal.pcbi.1000116. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Dai Q, Yang YC, Wang TM. Markov model plus k-word distributions: a synergy that produces novel statistical measures for sequence comparison. Bioinformatics. 2008;24:2296–2302. doi: 10.1093/bioinformatics/btn436. [DOI] [PubMed] [Google Scholar]
  • 6.Kantorovitz MR, Robinson GE, Sinha S. A statistical method for alignment-free comparison of regulatory sequences. Bioinformatics. 2007;23:i249–i255. doi: 10.1093/bioinformatics/btm211. [DOI] [PubMed] [Google Scholar]
  • 7.Van Helden J. Metrics for comparing regulatory sequences on the basis of pattern counts. Bioinformatics. 2004;20:399–406. doi: 10.1093/bioinformatics/btg425. [DOI] [PubMed] [Google Scholar]
  • 8.Sinha S, He X. MORPH: Probabilistic alignment combined with hidden Markov models of cis-regulatory modules. PLoS Comput Biol. 2007;3(11):e216. doi: 10.1371/journal.pcbi.0030216. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Felsenstein J. Inferring phylogenies from protein sequences by parsimony, distance and like-lihood methods. Meth Enzymol. 1996;266:418–427. doi: 10.1016/s0076-6879(96)66026-1. [DOI] [PubMed] [Google Scholar]
  • 10.Huelsenbeck JP, Ronquist F. MRBAYES: Bayesian inference of phylogenetic trees. Bioinformatics. 2001;17:754–755. doi: 10.1093/bioinformatics/17.8.754. [DOI] [PubMed] [Google Scholar]
  • 11.Kumar S, Tamura K, Nei M. MEGA3: integrated software for molecular evolutionary genetics analysis and sequence alignment. Briefing Bioinform. 2004;5:150–163. doi: 10.1093/bib/5.2.150. [DOI] [PubMed] [Google Scholar]
  • 12.Li M, Badger JH, Chen X, Kwong S, Kearney P, et al. An information-based sequence distance and its application to whole mitochondrial genome phylogeny. Bioinformatics. 2001;17:149–154. doi: 10.1093/bioinformatics/17.2.149. [DOI] [PubMed] [Google Scholar]
  • 13.Otu HH, Sayood K. A new sequence distance measure for phylogenetic tree construction. Bioinformatics. 2003;19:2122–2130. doi: 10.1093/bioinformatics/btg295. [DOI] [PubMed] [Google Scholar]
  • 14.Ronquist F, Huelsenbeck JP. MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics. 2003;19:1572–1574. doi: 10.1093/bioinformatics/btg180. [DOI] [PubMed] [Google Scholar]
  • 15.Cannarozzi G, Schneider A, Gonnet G. A phylogenomic study of human, dog, and mouse. PLoS Comput Biol. 2007;3(1):e2. doi: 10.1371/journal.pcbi.0030002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Abeln S, Teubner C, Deane CM. Using phylogeny to improve genome-wide distant homology recognition. PLoS Comput Biol. 2007;3(1):e3. doi: 10.1371/journal.pcbi.0030003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Rivas E, Eddy SR. Probabilistic Phylogenetic Inference with Insertions and Deletions. PLoS Comput Biol. 2008;4(9):e1000172. doi: 10.1371/journal.pcbi.1000172. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Engelen S, Trojan LA, Sacquin-Mora S, Lavery R, Carbone A. Joint Evolutionary Trees: A Large-Scale Method To Predict Protein Interfaces Based on Sequence Sampling. PLoS Comput Biol. 2009;5(1):e1000267. doi: 10.1371/journal.pcbi.1000267. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Komatsu K, Zhu S, Fushimi H, Qui TK, Cai S, et al. Phylogenetic analysis based on 18S rRNA gene and matK gene sequences of Panax vietnamensis and five related species. Planta Med. 2001;67:461–465. doi: 10.1055/s-2001-15821. [DOI] [PubMed] [Google Scholar]
  • 20.Mohseni-Zadeh S, Brezellec P, Risler JL. Cluster-C: an algorithm for the large-scale clustering of protein sequences based on the extraction of maximal cliques. Comput Biol Chem. 2004;28:211–218. doi: 10.1016/j.compbiolchem.2004.03.002. [DOI] [PubMed] [Google Scholar]
  • 21.Pipenbacher P, Schliep A, Schneckener S, Schonhuth A, Schomburg D, et al. ProClust: improved clustering of protein sequences with an extended graph-based approach. Bioinformatics. 2002;18:S182–S191. doi: 10.1093/bioinformatics/18.suppl_2.s182. [DOI] [PubMed] [Google Scholar]
  • 22.Levy ED, Pereira-Leal JB, Chothia C, Teichmann SA. 3D Complex: A structural classification of protein complexes. PLoS Comput Biol. 2006;2(11):e155. doi: 10.1371/journal.pcbi.0020155. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Chao KM, Zhang LX. 2008. Sequence Comparison: Theory and Methods, Springer.
  • 24.Waterman MS. 1995. Introduction to Computational Biology: Maps, Sequences, and Genomes: Interdisciplinary Statistics, Chapman and Hall/CRC, Boca Raton, FL.
  • 25.Durbin R, Eddy SR, Krogh A, Mitchison G. 1998. Biological Sequence Analysis, Cambridge University Press.
  • 26.Vinga S, Almeida J. Alignment-free sequence comparison-a review. Bioinformatics. 2003;19:513–523. doi: 10.1093/bioinformatics/btg005. [DOI] [PubMed] [Google Scholar]
  • 27.Blaisdell BE. Ameasure of the similarity of sets of sequences not requiring sequence alignment. Proc Natl Acad Sci USA. 1986;83:5155–5159. doi: 10.1073/pnas.83.14.5155. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Wu TJ, Burke JP, Davison DB. A measure of DNA sequence dissimilarity based on Mahalanobis distance between frequencies of words. Biometrics. 1997;53:1431–1439. [PubMed] [Google Scholar]
  • 29.Wu TJ, Hsieh YC, Li LA. Statistical measures of DNA dissimilarity under Markov chain models of base composition. Biometrics. 2001;57:441–448. doi: 10.1111/j.0006-341x.2001.00441.x. [DOI] [PubMed] [Google Scholar]
  • 30.Ulitsky I, Burstein D, Tuller T, Chor B. The average common substring approach to phylogenomic reconstruction. J Comput Biol. 2006;13:336–350. doi: 10.1089/cmb.2006.13.336. [DOI] [PubMed] [Google Scholar]
  • 31.Stuart GW, Moffett K, Baker S. Integrated gene and species phylogenies from unaligned whole genome protein sequences. Bioinformatics. 2002;18:100–108. doi: 10.1093/bioinformatics/18.1.100. [DOI] [PubMed] [Google Scholar]
  • 32.Fichant G, Gautier C. Statistical method for predicting protein coding regions in nucleic acid sequences. Comput Appl Biosci. 1987;3:287–295. doi: 10.1093/bioinformatics/3.4.287. [DOI] [PubMed] [Google Scholar]
  • 33.Hao B, Qi J. Prokaryote phylogeny without sequence alignment: from avoidance signature to composition distance. J Bioinform Comput Biol. 2004;2:1–19. doi: 10.1142/s0219720004000442. [DOI] [PubMed] [Google Scholar]
  • 34.Wu X, Wan X, Wu G, Xu D, Lin G. Phylogenetic analysis using complete signature information of whole genomes and clustered Neighbour-Joining method. Int J Bioinform Res Appl. 2006;2:219–248. doi: 10.1504/IJBRA.2006.010602. [DOI] [PubMed] [Google Scholar]
  • 35.Apostolico A, Denas O. Fast algorithms for computing sequence distances by exhaustive substring composition. Algorithms Mol Biol. 2008;3:13. doi: 10.1186/1748-7188-3-13. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Lu GQ, Zhang SP, Fang X. An improved string composition method for sequence comparison. BMC Bioinformatics. 2008;9(Suppl 6):S15. doi: 10.1186/1471-2105-9-S6-S15. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Livak F. Evolutionarily conserved pattern of gene segment usage within the mammalian TCRbeta locus. Immunogenetics. 2003;55:307–314. doi: 10.1007/s00251-003-0577-6. [DOI] [PubMed] [Google Scholar]
  • 38.Dixon RJ, Eperon IC, Samani NJ. Complementary intron sequence motifs associated with human exon repetition: a role for intragenic, inter-transcript interactions in gene expression. Bioinformatics. 2007;23:150–155. doi: 10.1093/bioinformatics/btl575. [DOI] [PubMed] [Google Scholar]
  • 39.Schbath S. An E±cient Statistic to Detect Over-and Under-Represented Words in DNA Sequences. J Comp Biol. 1997;4(2):189–192. doi: 10.1089/cmb.1997.4.189. [DOI] [PubMed] [Google Scholar]
  • 40.Reinert G, Schbath S, Waterman MS. Probabilistic and statistical properties of words: an overview. J Comput Biol. 2000;7:1–46. doi: 10.1089/10665270050081360. [DOI] [PubMed] [Google Scholar]
  • 41.Robin S, Daudin JJ. Exact distribution of word occurrences in a random sequence of letters. J Appl Prob. 1999;36:179–193. [Google Scholar]
  • 42.Mitrophanov AY. Sensitivity and convergence of uniformly ergodic Markov chains. J Appl Prob. 2005;42:1003–1014. [Google Scholar]
  • 43.Mitrophanov AY, Lomsadze A, Borodovsky M. Sensitivity of hidden Markov models. J Appl Prob. 2005;42:632–642. [Google Scholar]
  • 44.Egan JP. 1975. Signal Detection Theory and ROC-Analysis, Academic Press, New York.
  • 45.Bradley AP. The use of the area under the ROC curve in the evaluation of machine learning algorithms. Pattern Recog. 1997;30:1145–1159. [Google Scholar]
  • 46.Green RE, Brenner SE. Bootstrapping and normalization for enhanced evaluations of pairwise sequence comparison. Proc IEEE. 2002;90:1834–1847. [Google Scholar]
  • 47.Rijsbergen CJ. 1979. Information Retireval, Butterworths, London.
  • 48.Gallo SM, Li L, Hu Z, Halfon MS. REDfly: a Regulatory Element Database for Drosophila. Bioinformatics. 2006;22:381–383. doi: 10.1093/bioinformatics/bti794. [DOI] [PubMed] [Google Scholar]
  • 49.Lippert RA, Huang HY, Waterman MS. Distributional regimes for the number of k-word matches between two random sequences. Proc Natl Acad Sci USA. 2002;99:13980C13989. doi: 10.1073/pnas.202468099. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Guigo R. 1999. In Genetic Databases, Academic Press, New York.
  • 51.Wu YH, Liew AWC, Yan H, Yang MS. Classification of short human exons and introns based on statistical features. PHYSICAL REVIEW E. 2003;67(6):061916. doi: 10.1103/PhysRevE.67.061916. [DOI] [PubMed] [Google Scholar]
  • 52.Jiang R, Yan H. Segmentation of short human exons based on spectral features of double curves. IJDMB. 2008;2(1):15–35. doi: 10.1504/ijdmb.2008.016754. [DOI] [PubMed] [Google Scholar]
  • 53.Jiang R, Yan H. Studies of spectral properties of short genes using the wavelet subspace Hilbert Huang transform(WSHHT)[J]. Physica A. 2008;387:4223–4247. [Google Scholar]
  • 54.Lu L, Li C, Hagedorn CH. Phylogenetic analysis of global hepatitis E virus sequences: genetic diversity, subtypes and zoonosis. Rev Med Virol. 2006;16:5–36. doi: 10.1002/rmv.482. [DOI] [PubMed] [Google Scholar]
  • 55.Xia HY, Liu LH, Linde AM, Belak S, Norder H, et al. Molecular characterization and phylogenetic analysis of the complete genome of a hepatitis E virus from European swine. Virus Genes. 2008;37:39C48. doi: 10.1007/s11262-008-0246-9. [DOI] [PubMed] [Google Scholar]
  • 56.Liu L, Xia H, Wahlberg N, Belok S, Baule C. Phylogeny, classification and evolutionary insights into pestiviruses. Virology. 2009;385:351C357. doi: 10.1016/j.virol.2008.12.004. [DOI] [PubMed] [Google Scholar]
  • 57.Olvera A, Busquets N, Cortey M, de Deus N, Ganges L, et al. Applying phylogenetic analysis to viral livestock diseases: moving beyond molecular typing. Vet J. 2010;184(2):130–137. doi: 10.1016/j.tvjl.2009.02.015. [DOI] [PubMed] [Google Scholar]
  • 58.Liu Z, Meng J, Sun X. A novel feature-based method for whole genome phylogenetic analysis without alignment: application to HEV genotyping and subtyping. Biochem Biophys Res Commun. 2008;368:223–30. doi: 10.1016/j.bbrc.2008.01.070. [DOI] [PubMed] [Google Scholar]
  • 59.Handl J, Knowles J, Kell DB. Computational Cluster Validation in Post-Genomic Data Analysis. Bioinformatics. 2005;21:3201–3212. doi: 10.1093/bioinformatics/bti517. [DOI] [PubMed] [Google Scholar]
  • 60.Felsenstein J. PHYLIP-Phylogeny inference package (version 3.2). Cladistics. 1989;5:164–166. [Google Scholar]
  • 61.Stajich JE, Block D, Boulez K, Brenner SE, Chervitz SA, et al. The BioPerl Toolkit: Perl Modules for the Life Sciences. Genome Res. 2002;12:1611–1618. doi: 10.1101/gr.361602. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Table S1

AUCs obtained from all the models for detection of functionally related regulatory sequences.

(DOC)

Table S2

AUCs obtained from all the models for classification of human exons and introns.

(DOC)

Table S3

Abbreviation for the strains, accession number, nucleotide length, genotype, and country for each of the 48 complete HEV genomes.

(DOC)

Table S4

F-measures obtained from all the models for classification of HEV genotypes.

(PDF)


Articles from PLoS ONE are provided here courtesy of PLOS

RESOURCES