Helicobacter Species in the Intestinal Mucosa of Patients with Ulcerative Colitis

Abstract

In a search for Helicobacter species in the intestinal mucosae of 42 patients with ulcerative colitis (UC) and 74 without UC, only H. pylori was found. Although the bacterium was detected in UC patients by culture (7.1%) and nested PCR (19.0%), its presence was not associated with the disease (P = 0.13).

Ulcerative colitis (UC) is an inflammatory bowel disease (IBD) of unknown etiology that is confined to the large bowel mucosa. It seems to be a multifactorial disorder involving both genetic and environmental components, particularly the bacterial gut microbiota (13). However, no specific pathogenic or commensal bacterium has been convincingly implicated as the etiologic agent (4). Numerous studies have demonstrated that indigenous Helicobacter species of the gut of mice—Helicobacter hepaticus and Helicobacter bilis—are able to induce a persistent inflammation of the colon and cecum in some immunocompromised mouse models (1, 5, 8, 15). Moreover, other Helicobacter species have been isolated from the gut of cotton-top tamarins (14) and rhesus monkeys (7) with IBD-like disease. We hypothesize that species of the genus Helicobacter may also be associated with the pathogenesis of UC in human beings. Therefore, we investigated the presence of Helicobacter species in the intestinal mucosa of patients with UC and controls, by culture and PCR.

We studied prospectively 42 patients with UC and 74 without IBD (controls) who were undergoing colonoscopy. Prior consent of all patients and approval of the institutional ethics committee were obtained. The UC diagnosis was established by standard clinic, radiologic, endoscopic, and histologic criteria. The extent of ulcerative colitis was determined by histology. The gastric H. pylori status was assessed by serology (Cobas-Core EIA; Roche Diagnostic Systems, Basel, Switzerland) (12) and ¹³C urea breath test (¹³C-UBT; NDIRIS; Wagner Analysen Technik, Bremen, Germany) (13). Patients' characteristics, including gastric H. pylori status, are shown in Table 1.

TABLE 1.

Characteristics of patients with UC and controls (without IBD)

Characteristic	Ulcerative colitis patients	Non-IBD controls
No. of patients	42	74
Mean age (yr) ± SD (range)	38.9 ± 14.7 (18-76)	49.4 ± 4.1 (18-79)
No. of males/no. of females	6/36	20/54
No. of H. pylori-positive patientsa	22	38
No. with diarrhea	30	22
Mean duration (yr)	2.7
No. with activity	30
No. with distal disease/no. with extensive disease	31/11
No. using sulfasalazine/no. using corticosteroid	10/15

^aOne patient with UC and one non-IBD control were excluded from H. pylori status analysis because the values of enzyme-linked immunosorbent assay and ¹³C-UBT were questionable.

Colonoscopic biopsy fragments were taken from the rectum, the sigmoid, descending, transverse, and ascending colon, the cecum, and the terminal ileum of each patient for culture and PCR. For culture, one fragment from each region was ground separately in a glass tissue grinder and plated onto Belo Horizonte medium (11) supplemented with polymyxin B plus bacitracin (Sigma Chemical Co., St. Louis, Mo.). The culture conditions and detailed characterization of the isolates were as previously described (10).

DNA from bacteria and mucosal fragments was extracted with a QIAamp DNA minikit (Qiagen GmbH, Hilden, Germany).

Primers C70 and B37 were used to amplify a product of ∼1.5 kb from the 16S rRNA gene of the isolated strains (10). The amplicons were then purified and directly sequenced as described by Queiroz et al. (10). The sequences were aligned and compared with those in the GenBank database.

For the detection of Helicobacter DNA in fragments of the intestinal mucosa, the 16S rRNA gene was amplified by nested PCR using an outer primer pair (C70 and C37) and two inner primer pairs for the genus Helicobacter (C97 and C98) and the species H. pylori (HP1 and HP2) (3, 6, 10). Another nested PCR for ureA specific to H. pylori was also used (16) (Table 2).

TABLE 2.

Oligonucleotide primers used for PCR amplification of 16S rRNA and urease A genes

Primer and sequence (5′-3′)a	Amplicon size (bp)	PCR conditions
16S rRNA
Outer primers
C70: AGAGTTTGATYMTGGC	1,500	94°C (45 s), 50°C (45 s), 72°C (45 s), with 5 s per cycle; 24 cycles
B37: TACGGYTACCTTGTTACGA
Inner primers
C97: GCTATGACGGGTATCC	400	94°C (1 min), 55°C (2 min), 72°C (3 min); 34 cycles
C98: GATTTTACCCCTACACCA
HP1: TGGCAATCAGCGTCAGGTAATG	500	94°C (1 min), 55°C (1 min), 72°C (3 min); 39 cycles
HP2: GCTAAGAGATCAGCCTATGTCC
Urease A
Outer primers
HPU1: GCCAATGGTAAATTAGTT	411	94°C (1 min), 45°C (1 min), 72°C (1 min); 35 cycles
HPU2: CTCCTTAATTGTTTTTAC
Inner primers
AGTTCCTGGTGAGTTGTTCT	361	96°C (30 s), 56°C (15 s), 74°C (30 s); 40 cycles
AGCGCCATGAAAACCACGCT

^aBase designations are standard International Union of Biochemistry designations for bases and ambiguity.

We used the two-tailed chi-square or Fisher exact test for nonparametric values and Student's t test for comparison of mean age and disease duration. The significance level was set at a P value of ≤0.05.

Gastric H. pylori infection was detected in 53.7% of the UC patients and in 52.1% of the controls, with no significant difference between the groups (P = 1.0). This result agrees with those obtained by Duggan et al. (2) and Piodi et al. (9).

Helicobacter strains were isolated from the intestinal mucosa throughout the colon in three (7.1%) patients with and one (1.4%) without UC, with no significant difference (P = 0.13). The isolates were gram negative and motile and had a slightly spiral appearance. All strains showed the same biochemical characteristics and were urease, catalase, oxidase, alkaline phosphatase, and γ-glutamyl transpeptidase positive but did not reduce nitrate or hydrolyze hippurate. They did not produce hydrogen sulfide and were resistant to nalidixic acid and sensitive to cephalothin. More than 96% of the complete 16S rRNA gene sequence was determined for all isolates. Comparison of consensus sequences showed >99% similarity to H. pylori.

Helicobacter DNA was detected by PCR in the intestinal mucosa of eight (19.0%) UC patients and seven (9.5%) controls. Although the sensitivity of the PCR assay was higher than that of the culture, no association was detected between the presence of Helicobacter in the intestine of controls and UC patients (P = 0.23). All DNA detected by specific 16S rRNA/ureA nested PCR belonged to H. pylori species.

All patients from whom Helicobacter strains were isolated or in whom Helicobacter DNA was detected in the intestinal mucosa were H. pylori positive, as assessed by ¹³C-UBT and serology.

Occurrence of diarrhea was not associated with Helicobacter isolation in UC patients (P = 1.0) or in controls (P = 1.0). Also, no association was found between H. pylori detection and activity (P = 0.19), extent (P = 0.32), or duration (P = 0.86) of UC, and treatment with sulfasalazine (P = 0.56) or corticosteroids (P = 0.29).

All Helicobacter strains isolated belonged to H. pylori, although the culture conditions adopted allow the isolation of most Helicobacter species, including those that have been recovered from the intestines of rodents and nonhuman primates with IBD. This result indicates that other cultivable Helicobacter did not colonize the lower gastrointestinal tracts of the patients and controls. Even considering that other Helicobacter species could be missed by culture, because they are fastidious, our hypothesis is reinforced by the concordant data obtained by a more sensitive method, the nested PCR assay, that is able to detect one copy of Helicobacter DNA fragment, equivalent to 10⁻³ fg (16). Again, the only Helicobacter species detected by this method was H. pylori. However, neither the presence of viable H. pylori in the intestine, detected by culture, nor the presence of H. pylori DNA, detected by nested PCR, showed significant association with UC.

In conclusion, although we cultured H. pylori from the intestinal mucosae of a small number of UC patients, its presence was not associated with the disease. Since no other Helicobacter species was detected in the intestinal mucosa of the patients, we may speculate that the Helicobacter genus is not involved in the genesis of UC.

Nucleotide sequence accession number.

The sequences obtained in this study were deposited in GenBank (Table 3).

TABLE 3.

GenBank accession numbers of the H. pylori strains isolated from the intestinal mucosa of patients with ulcerative colitis and controls (without IBD)

Strain	Disease	No. of bp sequenced	Accession no.
LPB 582-99	UC	1,482	AY364437
LPB 473-00	UC	1,472	AY364438
LPB 427-01	Non-IBD control	1,478	AY364439
LPB 10-02	UC	1,471	AY364440