Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2012 Dec 1.
Published in final edited form as: J Immunol. 2011 Oct 24;187(11):5764–5771. doi: 10.4049/jimmunol.1100766

IL-6 Promotes Cardiac Graft Rejection Mediated by CD4+ Cells1

Adam Jared Booth *,§, Svetlana Grabauskiene †,§, Sherri Chan Wood †,§, Guanyi Lu †, Bryna E Burrell ‡, D Keith Bishop †,2
PMCID: PMC3221839  NIHMSID: NIHMS328651  PMID: 22025555

Abstract

IL-6 mediates numerous immunologic effects relevant to transplant rejection; however its specific contributions to these processes are not fully understood. To this end, we neutralized IL-6 in settings of acute cardiac allograft rejection associated with either CD8+ or CD4+ cell dominant responses. In a setting of CD8+ cell dominant graft rejection, IL-6 neutralization delayed the onset of acute rejection while decreasing graft infiltrate and inverting anti-graft Th1/Th2 priming dominance in recipients. IL-6 neutralization markedly prolonged graft survival in the setting of CD4+ cell mediated acute rejection and was associated with decreased graft infiltrate, altered Th1 responses, and reduced serum alloantibody. Further, in CD4+ cell dominated rejection, IL-6 neutralization was effective when anti-IL-6 administration was delayed by as many as six days post-transplant. Finally, IL-6 deficient graft recipients were protected from CD4+ cell dominant responses suggesting that IL-6 production by graft recipients, rather than grafts, is necessary for this type of rejection. Cumulatively, these observations define IL-6 as a critical promoter of graft infiltration and a shaper of T cell lineage development in cardiac graft rejection. In light of these findings, the utility of therapeutics targeting IL-6 should be considered for preventing cardiac allograft rejection.

Keywords: acute rejection, T cells, transplantation, IL-6

Introduction

Immune responses directed against transplanted tissues are the major obstacle to graft acceptance and survival. Numerous cell types can contribute to alloimmune responses that culminate in cardiac graft rejection, though CD4+ T cells in particular play a central role (1-4). T cell responses are influenced by context, including the local cytokine milieu. Recent findings have broadened our understanding of how the pleiotropic cytokine IL-6 can affect T cell responses including the inhibition of Th1 responses and enhancement of Th2 and Th17 lineage development (5-9). Other reports indicate that IL-6 promotes or augments established Th1 responses (10, 11). Further, IL-6 may disrupt mechanisms of immune tolerance by inhibiting suppressive functions of regulatory T cells (Treg) (12-14). Hence, the role of IL-6 in Th subset balance remains controversial and its role in shaping immune responses is complex and likely context-dependent.

Increased intragraft IL-6 expression has been associated with histologic rejection in patients (15, 16) and in experimental models of acute (17) and chronic (18, 19) allograft rejection, though its specific contributions to the evolution of rejection responses are not clearly defined. IL-6 has been reported to function as a graft-produced “danger signal” that promotes acute graft rejection (17). IL-6 may also act in concert with IL-17 to override established graft tolerance in response to Toll like receptor activation (20). Indeed, neutralizing IL-6 prevents development of Th17 responses responsible for costimulation blockade resistant rejection in Tbet−/− allograft recipients (21, 22). In addition, we have recently described a critical role for IL-6 in chronic allograft rejection mediated by CD4+ cells (18, 19, 23).

CD4+ cell help is required for the development of CD8+ Th1 dominated responses associated with unmodified acute rejection (1). In contrast, if CD8+ cells are eliminated by in vivo depletion, the remaining CD4+ cells mount a Th2 dominated rejection response which is characterized by eosinophilic infiltrate (24-26). Because IL-6 has been reported to mediate Th2 responses (6, 7), but may also promote Th1 responses (10, 11), we sought to clarify the effects of IL-6 in the development of transplant rejection in models where alloimmune responses are dominated by CD8+ Th1 responses or CD4+ Th2 responses.

Materials and Methods

Culture media

Cells were cultured in RPMI 1640 supplemented with 2% FCS, 1 mM sodium pyruvate, 100 U/ml penicillin, 100 μg/ml streptomycin, 1.6 mM L-glutamine, 10 mM HEPES buffer (Invitrogen, Carlsbad, CA), 0.27 mM L-asparagine, 1.4 mM L-arginine HCl, 14 μM folic acid, and 50 μM 2-ME (Sigma-Aldrich, St. Louis, MO).

Mice

Female WT C57BL/6 (H-2b) and BALB/c (H-2d) mice were purchased from Charles River Laboratories (Raleigh, NC). IL-6−/− mice were obtained from The Jackson Laboratory (Bar Harbor, ME). All animals were kept under micro-isolator conditions as reviewed and approved by the University of Michigan’s Committee on Use and Care Of Animals.

Vascularized cardiac transplantation

Heterotopic cardiac transplantation was performed as described (27). Briefly, the aorta and pulmonary artery of a BALB/c donor heart were anastomosed end-to-side to a C57BL/6 recipient’s abdominal aorta and inferior vena cava, respectively. Upon perfusion with the recipient’s blood, the transplanted heart resumes contraction. Graft function was monitored by abdominal palpation.

In vivo mAb therapy

Anti-CD8 (hybridoma 2.43), and anti-IL-6 (hybridoma MP5-20F3, with permission of DNAX) were obtained from American Type Culture Collection (Manassas, VA). mAbs were purified and resuspended in PBS by Bio X Cell (West Lebanon, NH). Control rat IgG antibody was purchased from Sigma-Aldrich, St. Louis, MO. Where indicated, cardiac allograft recipients received 1 mg of anti-CD8 mAb i.p. on days −1, 0, and 7 to deplete CD8+ cells. Anti-IL-6 mAb or control rat IgG were administered by i.p. injection of 1 mg on days −1, 1, and 3 except for delayed administration experiments with anti-IL-6, where the same dosing regimen commenced on day 2, 4, or 6 post-transplant.

Histologic analysis

Formalin fixed and paraffin embedded grafts were sectioned and stained with H&E to assess myocyte viability (presence of cross striation and myocyte nuclei) and the nature, intensity, and localization of graft infiltrating cells (GIC).

GIC harvest and analysis

Portions of three transplanted hearts were removed, pooled, minced, and digested with 1 mg/ml collagenase A (Roche Diagnostics, Penzberg, Germany) for 30 min at 37°C. After tissue debris settled, suspended GIC were harvested. RBC were lysed by hypotonic shock and GIC were passed through a 30 μm nylon mesh. Viable cells were counted by Trypan blue exclusion. Cytocentrifuged GIC were Wright stained for differential enumeration.

ELISPOT assay

ELISPOT assays were performed as previously described (28). Capture and detection mAb pairs (BD Biosciences, San Jose, CA) were as follows: IFN-γ (R4-6A2, XMG1.2), IL-4 (11B11, BVD6-24G2), and IL-17 (TC11-18H10, TC11-8H4.1). Polyvinylidene difluoride-backed microtiter plates (Millipore, Billeria, MA) were coated with unlabeled mAb and blocked with 1% BSA in PBS. Irradiated (1000 rad) BALB/c splenocytes (4×105) and 1×106 recipient splenocytes were added to each well for 24 hours. After washing, biotinylated detection mAb were added to the plates. Plates were washed and a 1/1000 dilution of anti-biotin alkaline phosphatase conjugate (Vector Laboratories, Burlingame, CA) was added to IFN-γ and IL-17 plates, and a 1/2000 dilution of HRP conjugated streptavidin (Dako, Carpinteria, CA) was added to IL-4 plates. Plates were washed and spots were visualized by addition of NBT (Bio-Rad, Hercules, CA)/3-bromo-4-chloro indolyl phosphate (Sigma-Aldrich, St. Louis, MO) to IFN-γ and IL-17 plates, or 3-amino-9-ethylcarbazole (Pierce) to IL-4 plates. Color development continued until spots were visible and stopped by adding H2O. Plates were dried and spots were quantified with an Immunospot Series 1 ELISPOT analyzer (Cellular Technology Ltd., Shaker Heights, OH).

Quantitative real time PCR

Graft RNA was isolated by homogenizing tissues in TRIzol reagent (Invitrogen, Carlsbad, CA) as per manufacturer’s protocol. Five μg of total RNA were reverse transcribed using Oligo dT, dNTPs, MMLV-RT (Invitrogen, Carlsbad, CA), RNAsin (Promega, Madison, WI) in PCR Buffer (Roche, Indianapolis, IN). The cDNA was purified by a 1:1 extraction with phenol/chloroform/isoamyl (25:24:1) (Invitrogen, Carlsbad, CA) and precipitated in one tenth volume 3M NaOAc and two volumes absolute ethanol. MCP-1 transcripts were quantified by quantitative real time PCR using SYBR master mix (Bio-Rad Laboratories, Hercules, CA) in a Rotor-Gene 3000 thermocycler (Corbett Life Science, San Francisco, CA). Relative expression levels were normalized to GAPDH expression using the Rotor-Gene Comparative Concentration utility.

Primer sequences were as follows:

  • GAPDH (Gapdh) forward 5′ CTGGTGCTGAGTATGTCGTG 3′

  • GAPDH (Gapdh) reverse 5′ CAGTCTTCTGAGTGGCAGTG 3′

  • MCP-1 (Ccl2) forward 5′ TTAACGCCCCACTCACCTGCTG 3′

  • MCP-1 (Ccl2) reverse 5′ GCTTCTTTGGGACACCTGCTGC 3′

Quantification of graft reactive alloantibodies

Graft reactive alloantibodies were quantified as previously described (24, 29). Briefly, 1×106 P815 (H-2d) cells (American Type Culture Collection, Manassas, VA) were incubated with a 1/50 dilution of sera followed by FITC-conjugated rabbit anti-mouse IgG antibody (Zymed, San Francisco, CA). Unfixed samples were analyzed by flow cytometry. Data are reported as the mean channel fluorescence.

Statistical analysis

Allograft survival curves were analyzed using a log-rank test. Significance of ELISPOT and alloantibody results was determined by an unpaired t test with Welch’s correction. All data were analyzed using GraphPad Prism v. 4.0 (GraphPad Software, Inc. San Diego, CA). p values ≤0.05 were considered statistically different.

Results

IL-6 neutralization delays CD8+ cell dominant acute graft rejection and alters alloimmune responses

In mice replete with both CD4+ and CD8+ cells, rejection is dominated by CD8+ cells which mount a Th1 response (24). Allografts in recipients treated with neutralizing anti-IL-6 mAb survived significantly longer than those treated with control rat IgG (Figure 1a). The increased survival time of grafts in recipients receiving anti-IL-6 mAb was associated with a significant reduction in the number of GIC (Figure 1b). Further evaluation of GIC revealed a significant increase in the percentage of eosinophils in grafts whose recipients received IL-6 neutralizing therapy (Figure 1c), suggesting increased Th2 responses (24). We further observed an increase in graft reactive Th2 responses by ELISPOT assay, evidenced by increased IL-4 production by recipient splenocytes (Figure 1d). Increased Th2 responses associated with anti-IL-6 mAb treatment were also correlated with decreased donor reactive Th1 responses (Figure 1d), similar to a previous report linking IL-6 deficient grafts to decreased IFN-γ responses when recipient splenocytes were stimulated with anti-CD3 mAb (17). Though IL-6 has been linked with Th17 responses (8, 9, 20, 22), splenocyte production of IL-17 was negligible in both groups (Figure 1d), suggesting that IL-6 contributes to acute allograft rejection though Th17-independent pathways.

Figure 1. Neutralizing IL-6 delays CD8+ cell dominated allograft rejection and inverts the Th1/Th2 balance in CD4+ and CD8+ replete recipients.

Figure 1

C57BL/6 recipients of BALB/c cardiac grafts received neutralizing anti-IL-6 mAb or control rat IgG perioperatively and were euthanized at the time of graft rejection. a) Cardiac allograft survival in recipients treated with anti-IL-6 mAb (open squares) or control rat IgG antibodies (closed circles). Each curve represents the survival of six cardiac allografts. b) Mean GIC number from cardiac allografts harvested at the time of rejection whose recipients received rat IgG or anti-IL-6. Bars represent mean + SEM. c) GIC composition expressed as percent lymphocytes, macrophages, eosinophils, and neutrophils. Bars represent the mean percent of 5 counts of 100 cells from Wright stained cytospins representing GIC pooled from at least 6 individual grafts. * p=0.0142. d) Donor reactive cytokine responses at time of allograft harvest by splenocytes harvested from allograft recipients treated with neutralizing anti-IL-6 mAb or control rat IgG antibodies as quantified by ELISPOT. Individual points represent the mean of triplicate cultures performed with splenocytes from individual allograft recipients. Lines represent the mean of points shown and naïve (untransplanted) controls are shown for reference.

Allograft rejection dominated by CD4+ cell responses requires IL-6

It is well established that CD4+ cells mediate acute rejection independent of CD8+ cells (24, 30). The heightened Th2 responses in recipients receiving IL-6 neutralizing therapy (Figure 1d) were reminiscent of previous observations with allograft recipients depleted of CD8+ cells or lacking IFN-γ, both of which reject grafts with associated Th2 immune responses (24, 31). We therefore asked whether IL-6 was necessary for acute rejection of cardiac grafts mediated by CD4+ T cells. To this end, we treated allograft recipients that were depleted of CD8+ cells with anti-IL-6 or control rat IgG. Inductive treatment with anti-IL-6 mAb prolonged survival of most grafts for at least 50 days post-transplant (Figure 2a) in recipients depleted of CD8+ cells. Long term graft survival was associated with a significant decrease in GIC number (Figure 2b, c).

Figure 2. Neutralizing IL-6 abrogates CD4+ cell mediated rejection.

Figure 2

C57BL/6 recipients of BALB/c cardiac grafts were depleted of CD8+ cells and received perioperative anti-IL-6 mAb or control rat IgG. a) Allograft survival in CD8+ cell depleted recipients receiving anti-IL-6 (open squares) or control rat IgG (closed circles). b) Representative views of H&E stained sections from allografts in (a). Note the intense perivascular infiltrate and parenchymal cell death in grafts from recipients treated with control rat IgG whereas grafts from recipients receiving anti-IL-6 mAb exhibit markedly less infiltrate and parenchymal cell death. c) Mean GIC number from rat IgG or anti-IL-6 treated recipients. d) Donor reactive cytokine responses quantified by ELISPOT assays performed on splenocytes harvested from graft recipients at time of allograft rejection (rat IgG control group) or day 50 for allografts surviving long term (anti-IL-6 treated group). Points represent the mean of triplicate cultures performed with splenocytes from individual transplant recipients. Lines represent the mean of points and naïve (untransplanted) controls are shown for reference.

We next asked if decreased graft infiltration in recipients receiving anti-IL-6 was associated with changes in Th1, Th2, or Th17 priming. While Th2 and Th17 priming remained unchanged, IL-6 neutralization caused a small but significant decrease in Th1 responses compared to rat IgG treated controls (Figure 2d). The striking difference in GIC number compared to the more modest reduction in Th1 cytokine production led us to consider that the primary effect of anti-IL-6 delaying CD4+ mediated graft rejection might be preventing graft infiltration rather than preventing T cell priming.

Post-transplant administration of anti-IL-6 mAb prevents CD4+ cell mediated graft rejection

IL-6 neutralization markedly inhibited graft infiltration in both CD8+ and CD4+ cell dominated rejection (Figures 1b and 2c). In the setting of CD4+ cell mediated rejection, anti-IL-6 not only reduced graft infiltration but also promoted long term graft survival (Figure 2a). Therefore, we hypothesized that the essential contribution of IL-6 in this setting might be promoting lymphocyte homing to the graft rather than affecting alloimmune response priming. To better understand these roles of IL-6, we delayed the administration of anti-IL-6 by as many as six days in order to assess the function of IL-6 after early events of Th priming (1).

When anti-IL-6 was administered two days post-transplant grafts survived for at least 50 days in recipients depleted of CD8+ cells (Figure 3a). Interestingly, delay of anti-IL-6 administration to four or six days post-transplant resulted in most grafts surviving for 50 days (Figure 3a). Hence, delayed neutralization of IL-6 also markedly prolonged graft survival. As with perioperative administration, delayed administration of anti-IL-6 significantly reduced infiltrating lymphocytes in grafts harvested at day 50 post-transplant (Figure 3b), demonstrating that delayed IL-6 neutralization effectively inhibited graft infiltration. Delayed IL-6 neutralization also resulted in reduced Th1 responses at day 50 post-transplant (Figure 3c), similar to perioperative neutralization of IL-6 in CD8+ cell depleted recipients.

Figure 3. Delayed administration of anti-IL-6 mAb abrogates CD4+ cell mediated rejection.

Figure 3

C57BL/6 recipients of BALB/c cardiac grafts were depleted of CD8+ cells and treated with neutralizing anti-IL-6 mAb administered perioperatively or beginning on day 2, 4, or 6 post-transplant and compared to those receiving control rat IgG. Experimental samples were harvested at the time of allograft rejection (rat IgG control group) or day 50 for allografts surviving long term (delayed anti-IL-6 treated groups). a) Allograft survival in recipients depleted of CD8+ cells and given anti-IL-6 mAb either perioperatively (squares), or commencing on day 2 post-transplant (cross bars), day 4 post-transplant (triangles), or day 6 post-transplant (diamonds) compared to control rat IgG (circles). b) Mean GIC number from groups described in (a). * p=0.0228 day 2 anti-IL-6 versus rat IgG; p=0.0240 day 6 anti-IL-6 versus rat IgG. Bars represent the mean + SEM. c) ELISPOT quantification of donor reactive cytokine production by recipient splenocytes at time of graft harvest. Points represent the mean of triplicate cultures performed with splenocytes from individual mice. Lines represent the mean of points. * p=0.0060 day 2 anti-IL-6 versus rat IgG; p=0.0063 day 6 anti-IL-6 versus rat IgG.

Early effects of IL-6 neutralization in preventing CD4+ cell dominant rejection

In the context of CD4+ cell dominant graft rejection, IL-6 neutralization significantly prolonged graft survival, with most grafts surviving for at least 50 days. In contrast, control rat IgG treated recipients rejected their grafts by day 14 (Figures 2a and 3a). Because of the broad difference in survival times of these groups we sought a more direct comparison by evaluating both groups at day 14 post-transplant. We further compared these time points to recipients harvested at day 6 post transplant, in order to allow initial T cell priming to occur and to better assess the influence of anti-IL-6 therapy between day 6 and day 14 (Figure 4). Graft reactive Th1 responses at day 14 post-transplant were decreased in recipients receiving delayed anti-IL-6 mAb (beginning on day 6 post-transplant) in comparison to both day 14 rat IgG treated controls and CD8 depleted recipients harvested at day 6 post-transplant (Figure 4a). Consistent with enumeration of GIC at later time points (Figure 3b), anti-IL-6 treatment reduced graft infiltration by day 14 post-transplant in comparison to both day 14 rat IgG controls and CD8 depleted recipients harvested at day 6 post-transplant (Figure 4b). This suggests that IL-6 neutralization was able to decrease the number of GIC between day 6 and day 14 post-transplant. Together these observations suggest that delayed IL-6 neutralization recapitulates the effects of perioperative neutralization.

Figure 4. Effects of delayed anti-IL-6 mAb administration are apparent at early times post-transplant.

Figure 4

C57BL/6 recipients of BALB/c cardiac grafts were depleted of CD8+ cells and received neutralizing anti-IL-6 mAb beginning at day 6 post-transplant and compared to rat IgG perioperatively treated controls. Tissues from both groups were harvested on day 14 post-transplant for time-matched comparison. In addition, tissues were harvested from CD8+ cell depleted allograft recipients on day 6 post-transplant to determine the level of T cell priming prior to delayed anti-IL-6 treatment. a) Donor reactive Th1, Th2, and Th17 responses by splenocytes harvested at day 14 post-transplant. Lines represent the mean of points shown. * p=0.0005 for IFN-γ values for day 6 post-transplant versus naïve mice; p=0.0081 for IFN-γ values for anti-IL-6 versus rat IgG. b) Mean GIC numbers and GIC differential counts from groups described in (a). Bars represent the mean + SEM. * p=0.0430. c) Intragraft MCP-1 transcript levels as assessed by real time PCR from day 14 post-transplant delayed anti-IL-6 and rat IgG treated hearts. Intragraft MCP-1 levels on day 6 post transplant from CD8 depleted controls are shown for reference. Bars represent the mean + SEM. * day 6 versus day 14 rat IgG, p=0.0193; day 14 rat IgG versus day 14 delayed anti-IL-6, p=0.0106. d) Quantification of levels of donor reactive IgG in serum of graft recipients described in (a). * p=0.0116 anti-IL-6 versus rat IgG.

IL-6 neutralization decreases intragraft expression of MCP-1 and production of graft reactive alloantibody in CD4+ cell dominant rejection

Because IL-6 neutralization was associated with reduced graft infiltration (Figures 1b, 2c, 3b, 4b), we asked whether IL-6 neutralization might be affecting MCP-1 expression as IL-6 has been previously described to promote MCP-1 production (32-34). Indeed, intragraft expression of MCP-1 was significantly reduced in grafts of recipients receiving delayed anti-IL-6 mAb compared to controls (Figure 4c). In addition to its ability to modulate chemokine expression, IL-6 has long been known to augment antibody responses (35). Allograft rejection in recipients depleted of CD8+ cells is associated with Th2 responses (24). Though Th2-associated eosinophils may directly participate in transplant rejection (24, 36, 37), Th2 responses are also associated with antibodies that may play a role in cardiac rejection (38-40). We therefore considered that one effect of IL-6 neutralization in CD4+ cell mediated rejection may be decreased graft reactive antibody responses. Quantification of graft reactive alloantibody in recipient sera revealed that delayed IL-6 neutralization was associated with decreased levels of circulating graft reactive IgG when compared to recipients treated with control antibodies (Figure 4d). Hence, IL-6 may further contribute to graft rejection by augmenting the production of anti-donor antibody.

Graft protective effects of IL-6 neutralization are recapitulated in IL-6 deficient recipients

IL-6 neutralization is expected to affect both graft and recipient sources of IL-6 in allograft recipients depleted of CD8+ cells. Hence, we asked if IL-6−/− graft recipients would reject their grafts similarly to WT recipients in CD4+ cell dominant rejection. In this setting, grafts in IL-6−/− recipients survived comparably to grafts in recipients receiving anti-IL-6 mAb, with most grafts surviving more than 50 days (Figure 5a). As with IL-6 neutralization in WT mice, increased graft survival in IL-6−/− allograft recipients was associated with significantly reduced GIC numbers (Figure 5b) and Th1 responses (Figure 5c). Further, while WT recipients receiving IL-6 neutralization exhibited unchanged Th2 responses associated with IL-6 neutralization in WT recipients (Figure 2d), Th2 responses in IL-6−/− recipients were decreased (Figure 5c). In summary, these results indicate that recipient IL-6 production is of critical importance for graft infiltration and the shaping of T helper responses associated with CD4+ cell dominant graft rejection.

Figure 5. Enhanced graft survival in IL-6−/− recipients depleted of CD8+ cells.

Figure 5

WT or IL-6−/− C57BL/6 recipients of WT BALB/c cardiac grafts depleted of CD8+ cells were harvested at time of rejection (WT) or day 50 post-transplant (IL-6−/−). a) Allograft survival in IL-6−/− recipients (open squares) or WT controls (closed circles). p=0.0014 for WT versus IL-6−/−. b) GIC numbers from groups shown in (a). Bars represent the mean + SEM. p=0.0281 for WT versus IL-6−/−. c) Donor reactive Th1, Th2, and Th17 responses by splenocytes from groups in (a). Data are shown against perioperative rat IgG controls for reference. Lines represent the mean of points shown. * p=0.0058 for IFN-γ values for IL-6−/− versus WT control; p=0.0391 for IL-4 values for IL-6−/− versus WT control.

Discussion

IL-6 has been implicated in acute and chronic cardiac rejection (17-19), as well as the disruption of established allograft tolerance (20). Broader immunologic impacts of IL-6 may also affect transplant outcome including its effects on T cell survival (41), chemotaxis of CD4+ cells (42), priming of CD8+ cell responses (43-45), and direction of T cell responses (5, 7-9, 13, 14). To better understand the role of IL-6 in the evolution of T cell responses against cardiac grafts, we investigated the therapeutic potential of IL-6 neutralization in models of acute rejection dominated by either CD8+ or CD4+ cell responses.

IL-6 neutralization prolongs allograft survival in otherwise unmodified rejection (17), which is dominated by CD8+ Th1 responses (24, 26). Our investigation of CD8+ cell dominated acute rejection indicates that prolonged allograft survival associated with IL-6 neutralization coincided with decreased GIC number. Further, anti-IL-6 decreased IFN-γ (Th1) responses and concomitantly increased IL-4 (Th2) production by recipient splenocytes. This reversal of the Th1/Th2 response balance was consistent with increased eosinophilic GIC content, a characteristic of Th2 mediated graft rejection (24, 37). Thus, while IL-6 is not required for unmodified allograft rejection by CD8+ cells, IL-6 mediated effects are integral in shaping anti-graft Th responses and graft infiltration.

To further investigate the role of IL-6 in shaping the Th1/Th2 balance in immune responses against cardiac allografts, we neutralized IL-6 in an acute rejection setting characterized by Th2 mediated rejection dominated by CD4+ cells (24). In this context, IL-6 neutralization promoted long term allograft acceptance. Extended graft survival was associated with reduced graft infiltrate and a small but significant decrease in Th1 responses, similar to our observations in CD8+ cell dominated graft rejection. It is unclear whether reduced Th1 responses associated with anti-IL-6 treatment significantly contribute to differences in graft survival, since control grafts reject in a manner consistent with Th2 responses (24). However, as Th2 responses were not significantly reduced following IL-6 neutralization, a contributing role for Th1 cannot be precluded. Further, it is conceivable that long term survival associated with IL-6 neutralization may be due to effects other than Th1/Th2/Th17 priming.

To better assess the effects of IL-6 in CD4+ cell dominated graft rejection, we delayed administration of anti-IL-6 in order to allow greater time for Th priming to occur unimpeded. Delayed IL-6 neutralization remained effective at prolonging graft survival and Th1 priming was decreased as with perioperative administration. These findings suggest that IL-6 has an ongoing role in promoting Th1 responses, perhaps by enhancing survival of newly activated T cells as previously described (46-48). The ongoing effects of IL-6 extend to graft infiltration as well, with decreased GIC numbers observed in recipients treated with anti-IL-6. Decreased GIC could be due to decreased intragraft expression of MCP-1. MCP-1 is a chemoattractant for multiple cell types that is upregulated by IL-6 (32, 33) and expressed persistently in cardiac allografts (49). The importance of MCP-1 in allograft rejection has been further demonstrated as cardiac allograft survival can be prolonged by viral transduction of a vector encoding a MCP-1 inhibitor (50).

In addition to directing lymphocyte homing, IL-6 is also a potent modulator of B cell biology (35). Indeed, acute antibody mediated rejection is a significant obstacle for the survival of human allograft recipients (38, 51). Graft reactive IgG in recipient serum was significantly decreased in response to IL-6 neutralization. Recent in vitro findings suggest that IL-6 induces antibody production indirectly by promoting the production of IL-21 by CD4+ cells (52). It should be noted that the ability of IL-6 to promote IL-21 in CD4+ cells may have implications beyond providing help for antibody production (53), as IL-21 also promotes CD4+ cell differentiation, CD8+ cell proliferation and activity, and NK cell cytotoxicity (54). Our findings solidify the pleiotropic identity of IL-6, as neutralization prolongs graft survival by opposing Th1 priming, graft infiltration, and humoral responses against the graft. These effects likely synergize to promote graft survival.

A previous investigation has implicated graft production of IL-6 in unmodified acute cardiac rejection (17), which is dominated by CD8+ cells (24, 26). However, the multifaceted effects of IL-6 on CD4+ cell dominant graft rejection include processes that likely occur in the periphery of allograft recipients. This led us to assess the responses of IL-6−/− recipients in CD4+ cell dominated graft rejection. Effects of IL-6 neutralization were recapitulated in IL-6−/− recipients, indicating that recipient origin IL-6 is required for CD4+ cell mediated graft rejection. Curiously, splenocytes from IL-6−/− graft recipients exhibited reduced Th1 and Th2 responses whereas splenocytes from anti-IL-6 treated recipients had decreases in Th1 alone. A possible explanation for these differences could be that cells removed from recipients receiving anti-IL-6 are able to produce IL-6 in ELISPOT culture whereas IL-6−/− splenocytes cannot. This would further support a context dependent role for IL-6 in both Th1 and Th2 immune responses. Nonetheless, these data are consistent with the requirement for recipient, rather than donor derived, IL-6 in CD4+ cell mediated allograft rejection. While recipient production of IL-6 reportedly does not promote unmodified graft rejection (17) dominated by CD8+ cells (24, 26) recipient origin IL-6 is necessary for CD4+ cell dominated graft rejection, suggesting that CD4+ and CD8+ cells have differential requirements for IL-6 in generating responses to cardiac allografts.

Though IL-6 neutralization prolonged graft survival with different efficacies in models of CD4+ and CD8+ cell dominant acute rejection, several effects of anti-IL-6 were consistent in both models. First, IL-6 neutralization reduced graft infiltration in all instances, consistent with previous reports of IL-6 promoting leukocyte migration (34, 55-57). Previous investigations have highlighted the specific importance of IL-6 trans signaling (IL-6 and soluble IL-6 receptor) in lymphocyte recruitment by promoting the production of ICAM-1 by endothelial cells (56, 57). A feature of IL-6 neutralization is the ability to inhibit both cis and trans IL-6 signaling. We were unable to find differences in intragraft ICAM-1 transcript expression between anti-IL-6 and rat IgG treated controls (data not shown). Thus, IL-6 induction of MCP-1 may be more important in driving lymphocyte accumulation in the setting of transplant infiltration.

A second consistent feature of IL-6 neutralization was reduced levels of Th1 priming in recipient splenocytes in both models of acute rejection, suggesting that IL-6 promotes Th1 responses in vivo. These observations are consistent with previous in vivo observations of IL-6 promoting Th1 responses associated with immune responses in experimental models of tuberculosis or leishmaniasis (58-61) and Th1 cell mediated colitis (10). However, these findings are inconsistent with previous in vitro (5-7) and in vivo studies (62) implicating IL-6 as a promoter of Th2 differentiation. Such differences might be attributable to unique immune responses examined in contrasting settings, supporting the notion that the role of IL-6 in Th cell differentiation is contextually dependent. Though the causative effects of Th1/Th2 dominance in transplantation have been questioned (25, 63, 64), these findings correlate a shift toward less Th1 priming relative to Th2 with increased graft survival. It should be noted that some graft reactive Th2 clones reportedly have a regulatory effect (65). Recent evidence also indicates that Th2 associated cytokines, including IL-4, have protective effects on vascular endothelial cells by decreasing their sensitivity to complement mediated killing (66, 67). Thus, skewing anti-graft responses toward Th2 cytokines may be graft protective, but as Th2 responses adeptly destroy grafts (24, 26, 31, 37) this protective effect is likely context dependent.

In summary, our in vivo observations demonstrate the importance of IL-6 in mediating graft rejection by both CD8+ and CD4+ cells and that these two cell types have differential requirements for IL-6 in the process. Neutralization of IL-6 reduced chemokine expression, graft infiltration, and alloantibody production while skewing Th development from Th1 toward Th2. IL-6 has received much attention as a deciding factor in the reciprocal Th17 and regulatory T cell lineages (8) and as a suppressor of Treg function (68-70); however our findings highlight a function of IL-6 in promoting in vivo Th1 immune responses. Collectively, these and our previous findings (18, 19) suggest that IL-6 signaling pathways may be a promising targets for augmenting currently available immunosuppressant therapies as IL-6 neutralization pleiotropically ameliorates both chronic and acute cardiac allograft rejection.

Footnotes

1

Supported by NIH grants R01 HL070613 (DKB), R01 AI061469 (DKB), and R56 AI061469 (DKB). AJB is supported by NIH T32 HL00749 (Galen B. Toews) and R01 HL085083 (Eric S. White).

3

Abbreviations

GIC: Graft infiltrating cells; IL-6−/−: IL-6 deficient; WT: wild type

References

  • 1.Bishop DK, Shelby J, Eichwald EJ. Mobilization of T lymphocytes following cardiac transplantation. Evidence that CD4-positive cells are required for cytotoxic T lymphocyte activation, inflammatory endothelial development, graft infiltration, and acute allograft rejection. Transplantation. 1992;53:849–857. [PubMed] [Google Scholar]
  • 2.Shizuru JA, Seydel KB, Flavin TF, Wu AP, Kong CC, Hoyt EG, Fujimoto N, Billingham ME, Starnes VA, Fathman CG. Induction of donor-specific unresponsiveness to cardiac allografts in rats by pretransplant anti-CD4 monoclonal antibody therapy. Transplantation. 1990;50:366–373. doi: 10.1097/00007890-199009000-00002. [DOI] [PubMed] [Google Scholar]
  • 3.Krieger NR, Yin DP, Fathman CG. CD4+ but not CD8+ cells are essential for allorejection. J Exp Med. 1996;184:2013–2018. doi: 10.1084/jem.184.5.2013. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Faust SM, Lu G, Marini BL, Zou W, Gordon D, Iwakura Y, Laouar Y, Bishop DK. Role of T cell TGFbeta signaling and IL-17 in allograft acceptance and fibrosis associated with chronic rejection. J Immunol. 2009;183:7297–7306. doi: 10.4049/jimmunol.0902446. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Dodge IL, Carr MW, Cernadas M, Brenner MB. IL-6 production by pulmonary dendritic cells impedes Th1 immune responses. J Immunol. 2003;170:4457–4464. doi: 10.4049/jimmunol.170.9.4457. [DOI] [PubMed] [Google Scholar]
  • 6.Diehl S, Anguita J, Hoffmeyer A, Zapton T, Ihle JN, Fikrig E, Rincon M. Inhibition of Th1 differentiation by IL-6 is mediated by SOCS1. Immunity. 2000;13:805–815. doi: 10.1016/s1074-7613(00)00078-9. [DOI] [PubMed] [Google Scholar]
  • 7.Rincon M, Anguita J, Nakamura T, Fikrig E, Flavell RA. Interleukin (IL)-6 directs the differentiation of IL-4-producing CD4+ T cells. J Exp Med. 1997;185:461–469. doi: 10.1084/jem.185.3.461. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Bettelli E, Carrier Y, Gao W, Korn T, Strom TB, Oukka M, Weiner HL, Kuchroo VK. Reciprocal developmental pathways for the generation of pathogenic effector TH17 and regulatory T cells. Nature. 2006;441:235–238. doi: 10.1038/nature04753. [DOI] [PubMed] [Google Scholar]
  • 9.Kimura A, Naka T, Kishimoto T. IL-6-dependent and -independent pathways in the development of interleukin 17-producing T helper cells. Proc Natl Acad Sci U S A. 2007;104:12099–12104. doi: 10.1073/pnas.0705268104. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Yamamoto M, Yoshizaki K, Kishimoto T, Ito H. IL-6 is required for the development of Th1 cell-mediated murine colitis. J Immunol. 2000;164:4878–4882. doi: 10.4049/jimmunol.164.9.4878. [DOI] [PubMed] [Google Scholar]
  • 11.Joseph SB, Miner KT, Croft M. Augmentation of naive, Th1 and Th2 effector CD4 responses by IL-6, IL-1 and TNF. Eur J Immunol. 1998;28:277–289. doi: 10.1002/(SICI)1521-4141(199801)28:01<277::AID-IMMU277>3.0.CO;2-8. [DOI] [PubMed] [Google Scholar]
  • 12.Dominitzki S, Fantini MC, Neufert C, Nikolaev A, Galle PR, Scheller J, Monteleone G, Rose-John S, Neurath MF, Becker C. Cutting edge: trans-signaling via the soluble IL-6R abrogates the induction of FoxP3 in naive CD4+CD25 T cells. J Immunol. 2007;179:2041–2045. doi: 10.4049/jimmunol.179.4.2041. [DOI] [PubMed] [Google Scholar]
  • 13.Samanta A, Li B, Song X, Bembas K, Zhang G, Katsumata M, Saouaf SJ, Wang Q, Hancock WW, Shen Y, Greene MI. TGF-beta and IL-6 signals modulate chromatin binding and promoter occupancy by acetylated FOXP3. Proc Natl Acad Sci U S A. 2008;105:14023–14027. doi: 10.1073/pnas.0806726105. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Wan S, Xia C, Morel L. IL-6 produced by dendritic cells from lupus-prone mice inhibits CD4+CD25+ T cell regulatory functions. J Immunol. 2007;178:271–279. doi: 10.4049/jimmunol.178.1.271. [DOI] [PubMed] [Google Scholar]
  • 15.Zhao XM, Yeoh TK, Hiebert M, Frist WH, Miller GG. The expression of acidic fibroblast growth factor (heparin-binding growth factor-1) and cytokine genes in human cardiac allografts and T cells. Transplantation. 1993;56:1177–1182. doi: 10.1097/00007890-199311000-00025. [DOI] [PubMed] [Google Scholar]
  • 16.Zhao XM, Frist WH, Yeoh TK, Miller GG. Expression of cytokine genes in human cardiac allografts: correlation of IL-6 and transforming growth factor-beta (TGF-beta) with histological rejection. Clin Exp Immunol. 1993;93:448–451. doi: 10.1111/j.1365-2249.1993.tb08199.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Liang Y, Christopher K, Finn PW, Colson YL, Perkins DL. Graft produced interleukin-6 functions as a danger signal and promotes rejection after transplantation. Transplantation. 2007;84:771–777. doi: 10.1097/01.tp.0000281384.24333.0b. [DOI] [PubMed] [Google Scholar]
  • 18.Booth AJ, Csencsits-Smith K, Wood SC, Lu G, Lipson KE, Bishop DK. Connective tissue growth factor promotes fibrosis downstream of TGFbeta and IL-6 in chronic cardiac allograft rejection. Am J Transplant. 2010;10:220–230. doi: 10.1111/j.1600-6143.2009.02826.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Diaz JA, Booth AJ, Lu G, Wood SC, Pinsky DJ, Bishop DK. Critical role for IL-6 in hypertrophy and fibrosis in chronic cardiac allograft rejection. Am J Transplant. 2009;9:1773–1783. doi: 10.1111/j.1600-6143.2009.02706.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Chen L, Ahmed E, Wang T, Wang Y, Ochando J, Chong AS, Alegre ML. TLR signals promote IL-6/IL-17-dependent transplant rejection. J Immunol. 2009;182:6217–6225. doi: 10.4049/jimmunol.0803842. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Burrell BE, Bishop DK. Th17 cells and transplant acceptance. Transplantation. 2010;90:945–948. doi: 10.1097/TP.0b013e3181f5c3de. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Burrell BE, Csencsits K, Lu G, Grabauskiene S, Bishop DK. CD8+ Th17 mediate costimulation blockade-resistant allograft rejection in T-bet-deficient mice. J Immunol. 2008;181:3906–3914. doi: 10.4049/jimmunol.181.6.3906. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Booth AJ, Bishop DK. TGF-beta, IL-6, IL-17 and CTGF direct multiple pathologies of chronic cardiac allograft rejection. Immunotherapy. 2010;2:511–520. doi: 10.2217/imt.10.33. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Chan SY, DeBruyne LA, Goodman RE, Eichwald EJ, Bishop DK. In vivo depletion of CD8+ T cells results in Th2 cytokine production and alternate mechanisms of allograft rejection. Transplantation. 1995;59:1155–1161. [PubMed] [Google Scholar]
  • 25.Piccotti JR, Chan SY, VanBuskirk AM, Eichwald EJ, Bishop DK. Are Th2 helper T lymphocytes beneficial, deleterious, or irrelevant in promoting allograft survival? Transplantation. 1997;63:619–624. doi: 10.1097/00007890-199703150-00001. [DOI] [PubMed] [Google Scholar]
  • 26.Piccotti JR, Chan SY, Goodman RE, Magram J, Eichwald EJ, Bishop DK. IL-12 antagonism induces T helper 2 responses, yet exacerbates cardiac allograft rejection. Evidence against a dominant protective role for T helper 2 cytokines in alloimmunity. J Immunol. 1996;157:1951–1957. [PubMed] [Google Scholar]
  • 27.Corry RJ, Winn HJ, Russell PS. Primarily vascularized allografts of hearts in mice. The role of H-2D, H-2K, and non-H-2 antigens in rejection. Transplantation. 1973;16:343–350. doi: 10.1097/00007890-197310000-00010. [DOI] [PubMed] [Google Scholar]
  • 28.Matesic D, Lehmann PV, Heeger PS. High-resolution characterization of cytokine-producing alloreactivity in naive and allograft-primed mice. Transplantation. 1998;65:906–914. doi: 10.1097/00007890-199804150-00008. [DOI] [PubMed] [Google Scholar]
  • 29.Bishop DK, Li W, Chan SY, Ensley RD, Shelby J, Eichwald EJ. Helper T lymphocyte unresponsiveness to cardiac allografts following transient depletion of CD4-positive cells. Implications for cellular and humoral responses. Transplantation. 1994;58:576–584. doi: 10.1097/00007890-199409150-00009. [DOI] [PubMed] [Google Scholar]
  • 30.Bishop DK, Chan S, Li W, Ensley RD, Xu S, Eichwald EJ. CD4-positive helper T lymphocytes mediate mouse cardiac allograft rejection independent of donor alloantigen specific cytotoxic T lymphocytes. Transplantation. 1993;56:892–897. doi: 10.1097/00007890-199310000-00023. [DOI] [PubMed] [Google Scholar]
  • 31.Bishop DK, Chan Wood S, Eichwald EJ, Orosz CG. Immunobiology of allograft rejection in the absence of IFN-gamma: CD8+ effector cells develop independently of CD4+ cells and CD40-CD40 ligand interactions. J Immunol. 2001;166:3248–3255. doi: 10.4049/jimmunol.166.5.3248. [DOI] [PubMed] [Google Scholar]
  • 32.Sporri B, Muller KM, Wiesmann U, Bickel M. Soluble IL-6 receptor induces calcium flux and selectively modulates chemokine expression in human dermal fibroblasts. Int Immunol. 1999;11:1053–1058. doi: 10.1093/intimm/11.7.1053. [DOI] [PubMed] [Google Scholar]
  • 33.Tieu BC, Lee C, Sun H, Lejeune W, Recinos A, 3rd, Ju X, Spratt H, Guo DC, Milewicz D, Tilton RG, Brasier AR. An adventitial IL-6/MCP1 amplification loop accelerates macrophage-mediated vascular inflammation leading to aortic dissection in mice. J Clin Invest. 2009;119:3637–3651. doi: 10.1172/JCI38308. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Hurst SM, Wilkinson TS, McLoughlin RM, Jones S, Horiuchi S, Yamamoto N, Rose-John S, Fuller GM, Topley N, Jones SA. Il-6 and its soluble receptor orchestrate a temporal switch in the pattern of leukocyte recruitment seen during acute inflammation. Immunity. 2001;14:705–714. doi: 10.1016/s1074-7613(01)00151-0. [DOI] [PubMed] [Google Scholar]
  • 35.Takatsuki F, Okano A, Suzuki C, Chieda R, Takahara Y, Hirano T, Kishimoto T, Hamuro J, Akiyama Y. Human recombinant IL-6/B cell stimulatory factor 2 augments murine antigen-specific antibody responses in vitro and in vivo. J Immunol. 1988;141:3072–3077. [PubMed] [Google Scholar]
  • 36.Goldman M, Le Moine A, Braun M, Flamand V, Abramowicz D. A role for eosinophils in transplant rejection. Trends Immunol. 2001;22:247–251. doi: 10.1016/s1471-4906(01)01893-2. [DOI] [PubMed] [Google Scholar]
  • 37.Martinez OM, Ascher NL, Ferrell L, Villanueva J, Lake J, Roberts JP, Krams SM. Evidence for a nonclassical pathway of graft rejection involving interleukin 5 and eosinophils. Transplantation. 1993;55:909–918. doi: 10.1097/00007890-199304000-00041. [DOI] [PubMed] [Google Scholar]
  • 38.Reed EF, Demetris AJ, Hammond E, Itescu S, Kobashigawa JA, Reinsmoen NL, Rodriguez ER, Rose M, Stewart S, Suciu-Foca N, Zeevi A, Fishbein MC. Acute antibody-mediated rejection of cardiac transplants. J Heart Lung Transplant. 2006;25:153–159. doi: 10.1016/j.healun.2005.09.003. [DOI] [PubMed] [Google Scholar]
  • 39.Colvin RB, Smith RN. Antibody-mediated organ-allograft rejection. Nat Rev Immunol. 2005;5:807–817. doi: 10.1038/nri1702. [DOI] [PubMed] [Google Scholar]
  • 40.Burrell BE, Lu G, Li XC, Bishop DK. OX40 costimulation prevents allograft acceptance induced by CD40-CD40L blockade. J Immunol. 2009;182:379–390. doi: 10.4049/jimmunol.182.1.379. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Atreya R, Mudter J, Finotto S, Mullberg J, Jostock T, Wirtz S, Schutz M, Bartsch B, Holtmann M, Becker C, Strand D, Czaja J, Schlaak JF, Lehr HA, Autschbach F, Schurmann G, Nishimoto N, Yoshizaki K, Ito H, Kishimoto T, Galle PR, Rose-John S, Neurath MF. Blockade of interleukin 6 trans signaling suppresses T-cell resistance against apoptosis in chronic intestinal inflammation: evidence in crohn disease and experimental colitis in vivo. Nat Med. 2000;6:583–588. doi: 10.1038/75068. [DOI] [PubMed] [Google Scholar]
  • 42.DiCosmo BF, Geba GP, Picarella D, Elias JA, Rankin JA, Stripp BR, Whitsett JA, Flavell RA. Airway epithelial cell expression of interleukin-6 in transgenic mice. Uncoupling of airway inflammation and bronchial hyperreactivity. J Clin Invest. 1994;94:2028–2035. doi: 10.1172/JCI117556. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Vanden Bush TJ, Buchta CM, Claudio J, Bishop GA. Cutting Edge: Importance of IL-6 and cooperation between innate and adaptive immune receptors in cellular vaccination with B lymphocytes. J Immunol. 2009;183:4833–4837. doi: 10.4049/jimmunol.0900968. [DOI] [PubMed] [Google Scholar]
  • 44.Ming JE, Steinman RM, Granelli-Piperno A. IL-6 enhances the generation of cytolytic T lymphocytes in the allogeneic mixed leucocyte reaction. Clin Exp Immunol. 1992;89:148–153. doi: 10.1111/j.1365-2249.1992.tb06894.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Renauld JC, Vink A, Van Snick J. Accessory signals in murine cytolytic T cell responses. Dual requirement for IL-1 and IL-6. J Immunol. 1989;143:1894–1898. [PubMed] [Google Scholar]
  • 46.Kishimoto H, Sprent J. Strong TCR ligation without costimulation causes rapid onset of Fas-dependent apoptosis of naive murine CD4+ T cells. J Immunol. 1999;163:1817–1826. [PubMed] [Google Scholar]
  • 47.Teague TK, Schaefer BC, Hildeman D, Bender J, Mitchell T, Kappler JW, Marrack P. Activation-induced inhibition of interleukin 6-mediated T cell survival and signal transducer and activator of transcription 1 signaling. J Exp Med. 2000;191:915–926. doi: 10.1084/jem.191.6.915. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Teague TK, Marrack P, Kappler JW, Vella AT. IL-6 rescues resting mouse T cells from apoptosis. J Immunol. 1997;158:5791–5796. [PubMed] [Google Scholar]
  • 49.Russell ME, Adams DH, Wyner LR, Yamashita Y, Halnon NJ, Karnovsky MJ. Early and persistent induction of monocyte chemoattractant protein 1 in rat cardiac allografts. Proc Natl Acad Sci U S A. 1993;90:6086–6090. doi: 10.1073/pnas.90.13.6086. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Fleury S, Li J, Simeoni E, Fiorini E, von Segesser LK, Kappenberger L, Vassalli G. Gene transfer of RANTES and MCP-1 chemokine antagonists prolongs cardiac allograft survival. Gene Ther. 2006;13:1104–1109. doi: 10.1038/sj.gt.3302765. [DOI] [PubMed] [Google Scholar]
  • 51.Wehner JR, Morrell CN, Rodriguez ER, Fairchild RL, Baldwin WM., 3rd Immunological challenges of cardiac transplantation: the need for better animal models to answer current clinical questions. J Clin Immunol. 2009;29:722–729. doi: 10.1007/s10875-009-9334-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Dienz O, Eaton SM, Bond JP, Neveu W, Moquin D, Noubade R, Briso EM, Charland C, Leonard WJ, Ciliberto G, Teuscher C, Haynes L, Rincon M. The induction of antibody production by IL-6 is indirectly mediated by IL-21 produced by CD4+ T cells. J Exp Med. 2009;206:69–78. doi: 10.1084/jem.20081571. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Nurieva RI, Dong C. (IL-)12 and 21: a new kind of help in the follicles. Immunol Cell Biol. 2009;87:577–578. doi: 10.1038/icb.2009.79. [DOI] [PubMed] [Google Scholar]
  • 54.Leonard WJ, Spolski R. Interleukin-21: a modulator of lymphoid proliferation, apoptosis and differentiation. Nat Rev Immunol. 2005;5:688–698. doi: 10.1038/nri1688. [DOI] [PubMed] [Google Scholar]
  • 55.Nadeau WJ, Pistole TG, McCormick BA. Polymorphonuclear leukocyte migration across model intestinal epithelia enhances Salmonella typhimurium killing via the epithelial derived cytokine, IL-6. Microbes Infect. 2002;4:1379–1387. doi: 10.1016/s1286-4579(02)00020-5. [DOI] [PubMed] [Google Scholar]
  • 56.Romano M, Sironi M, Toniatti C, Polentarutti N, Fruscella P, Ghezzi P, Faggioni R, Luini W, van Hinsbergh V, Sozzani S, Bussolino F, Poli V, Ciliberto G, Mantovani A. Role of IL-6 and its soluble receptor in induction of chemokines and leukocyte recruitment. Immunity. 1997;6:315–325. doi: 10.1016/s1074-7613(00)80334-9. [DOI] [PubMed] [Google Scholar]
  • 57.McLoughlin RM, Jenkins BJ, Grail D, Williams AS, Fielding CA, Parker CR, Ernst M, Topley N, Jones SA. IL-6 trans-signaling via STAT3 directs T cell infiltration in acute inflammation. Proc Natl Acad Sci U S A. 2005;102:9589–9594. doi: 10.1073/pnas.0501794102. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58.Leal IS, Smedegard B, Andersen P, Appelberg R. Interleukin-6 and interleukin-12 participate in induction of a type 1 protective T-cell response during vaccination with a tuberculosis subunit vaccine. Infect Immun. 1999;67:5747–5754. doi: 10.1128/iai.67.11.5747-5754.1999. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59.Wu W, Weigand L, Mendez S. The IL-6-deficient mouse exhibits impaired lymphocytic responses to a vaccine combining live Leishmania major and CpG oligodeoxynucleotides. Can J Microbiol. 2009;55:705–713. doi: 10.1139/W09-017. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 60.Ladel CH, Blum C, Dreher A, Reifenberg K, Kopf M, Kaufmann SH. Lethal tuberculosis in interleukin-6-deficient mutant mice. Infect Immun. 1997;65:4843–4849. doi: 10.1128/iai.65.11.4843-4849.1997. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 61.Ehrchen JM, Roebrock K, Foell D, Nippe N, von Stebut E, Weiss JM, Munck NA, Viemann D, Varga G, Muller-Tidow C, Schuberth HJ, Roth J, Sunderkotter C. Keratinocytes determine Th1 immunity during early experimental leishmaniasis. PLoS Pathog. 6:e1000871. doi: 10.1371/journal.ppat.1000871. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 62.La Flamme AC, Pearce EJ. The absence of IL-6 does not affect Th2 cell development in vivo, but does lead to impaired proliferation, IL-2 receptor expression, and B cell responses. J Immunol. 1999;162:5829–5837. [PubMed] [Google Scholar]
  • 63.Nickerson P, Steurer W, Steiger J, Zheng X, Steele AW, Strom TB. Cytokines and the Th1/Th2 paradigm in transplantation. Curr Opin Immunol. 1994;6:757–764. doi: 10.1016/0952-7915(94)90081-7. [DOI] [PubMed] [Google Scholar]
  • 64.Dallman MJ. Cytokines and transplantation: Th1/Th2 regulation of the immune response to solid organ transplants in the adult. Curr Opin Immunol. 1995;7:632–638. doi: 10.1016/0952-7915(95)80069-7. [DOI] [PubMed] [Google Scholar]
  • 65.Waaga AM, Gasser M, Kist-van Holthe JE, Najafian N, Muller A, Vella JP, Womer KL, Chandraker A, Khoury SJ, Sayegh MH. Regulatory functions of self-restricted MHC class II allopeptide-specific Th2 clones in vivo. J Clin Invest. 2001;107:909–916. doi: 10.1172/JCI11427. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 66.Black SM, Schott ME, Batdorf BH, Benson BA, Rutherford MS, Levay-Young BK, Dalmasso AP. IL-4 induces protection of vascular endothelial cells against killing by complement and melittin through lipid biosynthesis. Eur J Immunol. 2010;40:803–812. doi: 10.1002/eji.200939488. [DOI] [PubMed] [Google Scholar]
  • 67.Grehan JF, Levay-Young BK, Fogelson JL, Francois-Bongarcon V, Benson BA, Dalmasso AP. IL-4 and IL-13 induce protection of porcine endothelial cells from killing by human complement and from apoptosis through activation of a phosphatidylinositide 3-kinase/Akt pathway. J Immunol. 2005;175:1903–1910. doi: 10.4049/jimmunol.175.3.1903. [DOI] [PubMed] [Google Scholar]
  • 68.Pasare C, Medzhitov R. Toll pathway-dependent blockade of CD4+CD25+ T cell-mediated suppression by dendritic cells. Science. 2003;299:1033–1036. doi: 10.1126/science.1078231. [DOI] [PubMed] [Google Scholar]
  • 69.Pasare C, Medzhitov R. Toll-dependent control mechanisms of CD4 T cell activation. Immunity. 2004;21:733–741. doi: 10.1016/j.immuni.2004.10.006. [DOI] [PubMed] [Google Scholar]
  • 70.Yang Y, Huang CT, Huang X, Pardoll DM. Persistent Toll-like receptor signals are required for reversal of regulatory T cell-mediated CD8 tolerance. Nat Immunol. 2004;5:508–515. doi: 10.1038/ni1059. [DOI] [PubMed] [Google Scholar]

RESOURCES