Abstract
Homeostasis of mature tissue-resident mast cells is dependent on the relative activation of pro- and anti-apoptotic regulators. In this study we investigated the role of Glycogen Synthase Kinase-3β (GSK3β) in the survival of neoplastic and non-neoplastic human mast cells. GSK3β was observed to be phosphorylated at the Y216 activating residue under resting conditions in both the neoplastic HMC1.2 cell line and in peripheral blood-derived primary human mast cells (HuMCs), suggesting constitutive activation of GSK3β in these cells. Lentiviral-transduced short hairpin RNA (shRNA) knockdown of GSK3β in both the HMC1.2 cells and HuMCs resulted in a significant reduction in cell survival as determined with the MTT assay. The decrease in SCF-mediated survival in the GSK3β knockdown HuMCs was reflected by enhancement of SCF-withdrawal-induced apoptosis, as determined by Annexin V staining and caspase cleavage; and this was associated with a pronounced reduction in SCF-mediated phosphorylation of Src homology 2 domain-containing phosphatase 2 (SHP2) and ERK1/2 and reduced expression of the anti-apoptotic proteins Bcl-xl and Bcl-2. These data show that GSK3β is an essential anti-apoptotic factor in both neopastic and non-transformed primary human mast cells through the regulation of SCF-mediated SHP2 and ERK activation. Our data suggest that targeting of GSK3β with small molecular weight inhibitors such as CHIR 99021 may thus provide a mechanism for limiting mast cell survival and thus subsequently decreasing the intensity of the allergic inflammatory response.
Keywords: GSK3β, Human mast cells, KIT, apoptosis
Introduction
Chronic allergic inflammation is characterized by increased mast cell infiltration and population in the affected tissues. Mast cell burden in these tissues is dependent not only on migration of mast cells/mast cell precursors into these sites but also on pro-survival and anti-apoptotic signaling pathways. Processes, including the migration and survival of tissue mast cells, are tightly regulated by stem cell factor (SCF), the ligand for the growth-factor receptor KIT (1–3). KIT, which is a member of the growth factor receptors with inherent tyrosine kinase activity family (4, 5) undergoes dimerization and autophosphorylation following SCF-induced ligation. Constitutive activation of KIT activity, through a point mutation (D816V) in the KIT catalytic domain is considered a hallmark of the myeloproliferative disorder, mastocytosis (6–8). This disease is characterized by dysregulated growth of mast cells and elevated mast cell numbers in associated skin lesions and in tissues such as bone marrow (7). In addition to the documentation of an increased number of mast cells harboring the D816V mutation within tissues of mastocytosis patients, the rapidly dividing HMC1.2 human mast cell line also expresses this mutation (9).
Autophosphorylation of KIT at specific tyrosine residues within the cytosolic domain induces recruitment of Src Homology-2 (SH2) domain-containing signaling proteins which leads to activation of these and other molecules required for transducing KIT-mediated responses including mast cell growth and survival (10, 11). We have recently provided evidence to support a role for PI3K-regulated mammalian target of rapamycin (mTOR) in cell survival in both human and mouse mast cells (12). Furthermore, the transcription factor FOXO3a has been shown to regulate SCF-mediated survival in mouse mast cells by repressing the expression of pro-apoptotic proteins via a PI3K-dependent pathway (13). It is clear, however, that other anti-apoptotic pathways exist that may contribute to mast cell homeostasis. For example, in the LAD2 human mast cell line, cell survival can be maintained in the absence of SCF despite the lack of an activating mutation in KIT (14). Furthermore, mouse mast cells can proliferate and survive in the presence of IL-3 but in the absence of SCF.
We have previously determined that Glycogen Synthase Kinase 3β (GSK3β), a ubiquitously expressed, conserved serine/threonine protein kinase, contributes to various FcεRI/KIT-mediated mast cell functions including cytokine production and KIT-mediated chemotaxis (15). As GSK3β has also been implicated in tumor growth (16), we thus investigated whether, as for PI3K and mTOR, GSK3β also contributes to the homeostasis of normal and neoplastic mast cells. Here we report that gene knock down of GSK3β by shRNA, and blocking of its activity by the small molecule GSK3β inhibitor, CHIR 99021, substantially reduces the ability of the HMC1.2 cell line to expand and survive in culture. Furthermore, we show that the ability of SCF to maintain the survival of terminally differentiated primary cultures of human mast cells (HuMCs) is markedly reduced as a consequence of induction of apoptosis following GSK3β knock down. Thus, GSK3β appears to represent an important mast cell pro-survival signal. Targeting GSK3β accordingly may provide a mechanism for modulating mast cell survival and apoptotic pathways in neoplastic mast cells and potentially mast cells participating in the allergic inflammatory response.
Materials and Methods
Mast cell culture
HuMCs were developed from CD34+ peripheral blood progenitor cells in StemPro-34 culture medium containing StemPro supplement (Invitrogen Life Technologies), L-glutamine (2 mM), penicillin (100 U/ml), streptomycin (100 µg/ml), recombinant human IL-3 (30 ng/ml, first week only,) recombinant human IL-6 (100 ng/ml), and recombinant human SCF (100 ng/ml) (PeproTech, Rocky Hill, NJ). Experiments were conducted 7–9 weeks after the initiation of HuMC cultures. The CD34+ cells were obtained from normal volunteers under a protocol (98-I-0027; PI: Dr. A. Kirshenbaum) approved by the NIAID IRB and appropriate informed consents. The growth-factor independent human mast cell line, HMC-1.2 was cultured in IMDM medium supplemented with FBS (10%), L-glutamine (2 mM) penicillin (100 U/ml) and streptomycin (100 µg/ml).
Lentivirus short hairpin RNA transfection of cell lines and transduction of HuMCs
The following GSK3β-targeted short hairpin RNAs were purchased from Sigma-Aldrich (St. Louis, MO): CCGGGTGTGGATCAGTTGGTAGAAACTCGAGTTTCTACCAACTGATCCACACTTTTT (TRCN0000010552) (construct A), CCGGGACACTAAAGTGATTGGAAATCTCGAGATTTCCAATCACTTTAGTGTCTTTTTG (TRCN0000040002) (construct B) and CCGGCAACAAGATGAAGAGC-ACCAACTCGAGTTGGTGCTCTTCATCTTGTTGTTTTT (SHC002) (control non-target control vector). Packaging vector (Mission™Lentiviral packaging mix, Sigma), pLKO1 transfer vectors with GSK3β shRNA (Sigma) or scrambled control shRNA were co-transfected into 293T packaging cells with FuGENE6 transfection reagent (Roche, Indianapolis,IN) as described (15). The transfected 293T cells were grown in DMEM containing FBS (10%), L-glutamine (4 mM), penicillin (100 U/ml) and streptomycin (100 µg/ml). Following 16–19 h of transfection, medium was removed and replaced with fresh DMEM. After 62–65 h of transfection, virus was collected by centrifugation and the virus pellet was resuspended in 3 ml pre-warmed StemPro medium. Transduction of HuMCs was conducted by transferring the 3 ml resuspended virus to a T75 culture flask containing 3–4 × 106 HuMCs in 15 ml of supplemented StemPro cell culture medium or 2–3 × 106 HMC1.2 cells in 10 ml IMDM medium. Two days after infection, the medium was changed to virus-free medium and antibiotic selection was initiated (0.2 µg/ml puromycin (Sigma-Aldrich) for HuMCs and 2 µg/ml puromycin for HMC1.2 cells). Experiments were conducted on day 7–8 post transduction. We have previously demonstrated that this construct does not affect the expression of other signaling proteins including PLCγ1, Lyn, and NFkB in HuMCs (15).
Cell activation
HuMCs were starved in cytokine-free media overnight following rinsing with HEPES buffer containing 0.04% BSA and activated by addition of SCF (30 ng/ml) for the times noted in the figure legends. Where indicated, cells were pretreated with the Src family tyrosine kinase inhibitor, PP2, (3µM), the PLCγ inhibitor, U73122, (1 µM, EMD Biosciences) or the PI3K inhibitor, wortmannin, (100nM, Calbiochem) 20 min prior the activation with SCF.
Immunoblotting
Cell lysates were prepared as described (17, 18). Aliquots of lysates were loaded onto a 4–12% NuPage BisTris gel (Invitrogen Life Technologies). Proteins were separated by electrophoresis, then transferred onto nitrocellulose membranes. The proteins were probed with the following phospho (p)-specific antibodies from Cell Signaling Technology (Beverly, MA); anti-phospho-Akt ((p)-S473), anti-phospho-GSK3β ((p)-S 9), anti-phospho-glycogen synthase ((p)-S641), anti-phospho-SHP-2 ((p)-Y580) and anti-phospho-ERK ((p)-T202/Y204). The anti-phospho-GSK3α/β ((p)-Y279/Y216) antibody was from Invitrogen. Total Syk and KIT antibodies were from Santa Cruz Biotechnology (Santa Cruz, CA). The antibodies specific for Mcl-1, Bcl-xL, Bcl-2, Bim, BID, or Bad were from Cell Signaling Technology. Immunoreactive proteins were visualized by probing with a secondary HRP-conjugated antibody. To normalize protein loading, identically loaded samples were probed for Syk or total KIT. To quantify changes in protein phosphorylation, the ECL films were scanned using a Quantity One scanner (Bio-Rad, Hercules, CA).
Cell survival assay - Trypan blue method
An aliquot of suspended cells (20 µl) was mixed with 20 µl of trypan blue solution. Cells were counted and viability was assayed by exclusion of trypan blue dye using a hemocytometer. In some experiments, HMC-1.2 cells (2 ×105 cells in 1 ml media) were cultured with or without the GSK3β inhibitor (CHIR 99021 (3 – 30µM), AH diagnostics ab, Aarhus, DK) for 24, 48 or 72 h. Cell viability was then assessed by trypan blue exclusion.
Cell survival assay – MTT colorimetric assay
To assess mast cell survival, HuMCs, transduced with scrambled shRNA (shContr) or shRNAs for GSK3β (shGSK3β), were starved in cytokine-depleted medium for 20 h. Cells (1 × 105/well) were then seeded in 96-well plates and stimulated with SCF for 24 h. The percentage of viable cells was assessed with an MTT-based colorimetric assay (Sigma-Aldrich) according to the manufacturer’s protocol. Briefly, after 24 h in culture, MTT solution was added and cells were incubated for an additional 3.5 h at 37 °C. The MTT was solubilized and the absorbance was measured at 570 nm.
Apoptosis assay
Apoptosis was evaluated by flow cytometry using cellular annexin V binding (annexin V, FITC apoptosis detection kit I; BD Biosciences, San Jose, CA). In brief, cells were stained with Annexin V and propidium iodide (PI) according to the manufacturer’s instructions, and then analyzed using a FACScan flow cytometry (BD Biosciences). All PI-positive cells were considered dead. PI-negative and Annexin V-positive cells were considered early apoptotic cells, and the remaining double negative cells were considered viable.
Proliferation assay – BrdU incorporation
Cell proliferation was determined by the BrdU (a thymidine analogue) assay that measures its incorporation into DNA. HMC-1.2 cells, transduced with scrambled shContr or with shGSK3β, were cultured overnight in IMEM without FBS and resuspended in IMEM containing 10% FBS. Cells were then incubated for 24 h at 1.5 × 105 cells/100 µl in 96-well plates. Incorporation of BrdU into the shContr- or the shGSK3β-transduced HMC-1.2 cells was assessed using a BrdU cell proliferation assay kit (Calbiochem, San Diego, CA) as described (19).
Statistical analysis
Data are presented as the mean ± SEM. Significant difference between two groups was analyzed by unpaired Student’s t test. A p-value of <0.05 was considered statistically significant.
Results
Knockdown of GSK3β decreases survival of the HMC1.2 human leukemia mast cell line
To explore the potential role of GSK3β as a mast cell survival/anti-apoptotic signal, we adopted a lentivirus-mediated knockdown approach (15), as GSK3β deficiency in mice results in an embryonic lethal phenotype (20). We initially examined the consequences of GSK3β knockdown in the SCF-independent HMC1.2 mast cell line. As shown in Figure 1A, GSK3β–targeted shRNA substantially decreased the expression of GSK3β in the HMC1.2 cells without reducing the expression of the internal controls, KIT and Syk. GSK3β activity is regulated by the phosphorylation status of tyrosine (Y)216 and serine (S)9. The Y216 residue is reported to be constitutively phosphorylated in resting cells, thus maintaining GSK3β in an active state, whereas the phosphorylation of the S9 site usually follows growth factor stimulation and activation of the PI3K-AKT signaling pathway (21–23). As shown in Figure 1A, Y216 and S9 are constitutively phosphorylated in the HMC 1.2 cells and, as expected, the phosphorylation of these residues is substantially reduced in cells treated with the GSK3β -targeted shRNA.
Figure 1. Anti-proliferative effect of GSK3β knockdown in HuMC-1.2 cell line.
(A) The HMC-1.2 cell line was transduced with scrambled shRNA (shContr) or shRNA for GSK3β (shGSK3β). Whole-cell extracts were prepared and immunoblotted with anti-GSK3β, anti-phospho-GSK3α/β ((p)-Y279/Y216), anti-p- GSK3β (S9), anti-Syk or anti-KIT-antibodies. (B) Cell viability was assessed by trypan blue dye exclusion. (C) Cell survival was assessed my means of an MTT assay where the starting cell number was 1 × 105 cells/well, and (D) proliferation was assessed by BrdU incorporation. In all cases, n=3–5, p < 0.05*, p < 0.001** for comparison with shContr transduced HMC-1.2.
Having successfully knocked down GSK3β in the HMC1.2 cells, we next determined the consequences of GSK3β knockdown on the proliferation and/or survival of HMC1.2 cells. As shown in Figure 1B, GSK3β knockdown significantly decreased the number of viable HMC1.2 cells as assessed by trypan blue exclusion 9 days post transduction. In addition, when cell survival was determined by the MTT assay during a 24 h period, GSK3β knockdown significantly decreased HMC1.2 cells survival (Figure 1C). To determine whether this reduction may, in part, reflect a decrease in proliferation rate, HMC-1.2 cells, transduced with shRNA targeting GSK3β or with scrambled control shRNA, were cultured overnight in the absence of FBS, re-suspended in media containing FBS for 24 h, then cell proliferation monitored by BrdU incorporation. As shown in Figure 1D, BrdU incorporation was significantly reduced in the GSK3β knockdown in HMC-1.2 cells compared to the scrambled control shRNA-treated cells. Taken together, these data suggest that GSK3β is required for HMC1.2 cell survival but this, in part, may reflect a requirement for GSK3β in cell proliferation. To further investigate this potential role for GSK3β in mast cell homeostasis, we next determined the manifestations of GSK3β knock down in mature HuMCs which represent a terminally differentiated non-dividing cell population that, unlike HMC1.2 cells, requires SCF for survival.
Expression and phosphorylation of GSK3β in primary human mast cells
We first confirmed the ability of GSK3β-targeted shRNA to down-regulate GSK3β expression and phosphorylation in SCF-challenged and quiescent HuMCs. Cells, starved of cytokines overnight and treated with control or GSK3β -targeted shRNA, were either unchallenged or challenged with SCF for 2 min and cell lysates assessed for expression and phosphorylation of GSK3β. Despite overnight starvation of SCF, and as was observed in the HMC1.2 cells, GSK3β was found to be constitutively phosphorylated at position Y216 in resting HuMCs and no consistent increase in the phosphorylation of this residue was observed in cells re-challenged with SCF (Figure 2A). Regardless, the expression of GSK3β and, as a consequence, GSK3β phosphorylated at Y216, was markedly reduced in HuMCs treated with GSK3β-targeted shRNA. In contrast to the HMC1.2 cells, there was minimal constitutive phosphorylation of the S9 residue of GSK3β in resting primary HuMCS. However, this phosphorylation was enhanced in SCF-challenged cells (Figure 2A). As expected, this phosphorylation was markedly reduced in cells treated with GSK3β-targeted shRNA. Nevertheless, the inability of SCF alone to further enhance the observed constitutive phosphorylation of GSK3β at Y216, again suggests that GSK3β may be constitutively active in the resting state in HuMCs and that this activity cannot be further enhanced through KIT activation. Furthermore, the lack of reduction of the phosphorylation of GS by SCF (Figure 2B), a response which could be reduced by GSK3β-targeted shRNA (15), suggests that the phosphorylation of GSK3β at S9 in the HuMCs minimally impacted GSK3β activity, at least over the time frame examined.
Figure 2. Expression and activity of GSK3β inhibition in primary HuMCs.
(A) HuMCs, transduced with scrambled control shRNA (shContr) or shRNA for GSK3β (shGSK3β), were starved overnight in SCF-depleted media and then stimulated with SCF for 2 min as described in Material and Methods. Whole-cell extracts were prepared and immunoblotted with anti-p-GSK3β (Y216), anti-p-GSK3β (S9) or anti-GSK3β antibodies. The level of Syk demonstrates equivalent protein loading of samples. (B) Kinetics of SCF-mediated phosphorylation of GSK3β in HuMCs. Whole-cell extracts were prepared and immunoblotted with anti-p-GSK3α/β ((p)-Y279/Y216), anti-p-Glycogen Synthase (p-GS) (S641) or anti-p- GSK3β (S9) antibodies. The level of total Syk demonstrates equivalent protein loading of the samples. (C) HuMCs were preincubated with a Src inhibitor (PP2), a PLCγ inhibitor (U73122) or a PI3K inhibitor (Wortmannin (Wortm)) for 20 min prior to stimulation with SCF for 2 min, as described in Material and Methods. Whole-cell extracts were prepared and immunoblotted with anti-p-AKT (S473), anti-p-GSK3β (Y216), anti-p-GSK3β (S9) or anti-p-Glycogen Synthase (p-GS (S641)) antibodies. The level of Syk demonstrates equivalent protein loading of samples.
We have previous determined that phosphorylation of the downstream substrate for GSK3β, GS, is moderately enhanced in HuMCs following a combination of KIT and FcεRI-mediated activation (15). Hence, we examined the phosphorylation status of pGSK3β (Y216) and GS (S641) in HuMC over a 10 min time period during which maximal SCF-induced KIT phosphorylation is observed (24). As can be seen from Figure 2B, there was no consistent increase in phosphorylation of either of these respective GSK3β and GS residues. These data overall are thus consistent with the conclusion that the constitutive phosphorylation and activity of GSK3β observed in the HMC1.2 and HuMC cells is regulated at least in part independently of KIT activity.
To provide further support for this conclusion, we investigated whether inhibitors of known signaling processes downstream of KIT block the constitutive phosphorylation of GS and GSK3β, including PP2, a Src family tyrosine kinase inhibitor also capable of inhibiting KIT phosphorylation (24); U71322, a PLCγ1 inhibitor {Kuehn, 2008 #44}; and wortmannin, a selective PI3K inhibitor (25). As expected, and to serve as a positive control, PP2 inhibited SCF-mediated PI3K activation, as indicated by the attenuation of the phosphorylation of AKT. Wortmannin primarily inhibited AKT phosphorylation, while U73122 partially blocked AKT phosphorylation (Figure 2C). Although all three agents variably inhibited the increase in phosphorylation of GSK3β at S9, and the observed increase in phopshorylation in GS at S641 in these experiments, they had minimal effect on the constitutive phosphorylation of GSK3β at Y216 and GS at S641. These data suggest that although KIT activates PLCγ1 (23), tyrosine kinase activation and PI3K, the constitutive activation pathway is independent of these signaling processes. These data further support the conclusion that the constitutive activation of GSK3β observed in mast cells is independent of KIT activation.
GSK3β is required for SCF-mediated HuMCs survival
To next determine the outcome of GSK3β knock down on HuMC survival, two different shRNA constructs were selected based on their relative abilities to decrease GSK3β expression in HuMCs as described (15) and as shown in Figure 3A. Knockdown of GSK3β with these constructs resulted in a significant reduction in viable cells as determined by trypan blue viability count (68.9 ± 8.6% (construct A) and 31.2 ± 10.3% (construct B) vs. 91.3 ± 2.7% (control construct) remaining viable cells; n=3, p<0.01) (Figure 3B), and with the MTT assay (54.4 ± 10.4% and 25.7 ± 7.1% vs. 95.8 ± 3.3% survival of cell input; n=3, p<0.05 and p<0.001 respectively) (Figure 3C). Based on these parameters, the decrease in survival of the cells treated with the two different GSK3β constructs thus correlated to the degree of GSK3β knock down observed in Figure 3A. Taken together, these data indicate that, although the requirements for GSK3β in the maintenance of neoplastic mast cells may be partly dependent on effects on cell division, at least in mature primary cultured HuMCs, it principally functions as an anti-apoptotic signal for the maintenance of mast cell survival.
Figure 3. GSK3β is required for HuMC survival.
(A) HuMCs transduced with scrambled shRNA (shContr) or shRNA for two different constructs of GSK3β (shGSK3β A and shGSK3β B) and probed with anti-GSK3β and Syk protein. (B) Transduced cells were then starved overnight and cell viability was measured by trypan blue test; or (C) cells (1 ×105/well) starved overnight were treated with SCF (100 ng/ml) for 24 h and the number of cells surviving assessed with the MTT assay and expressed as % survival of input as described in materials and methods. In all cases, n=3–4, p < 0.05*, p < 0.001** and p < 0.0001*** for comparison with shContr transduced HuMCs.
GSK3β knockdown increases SCF withdrawal-induced apoptosis in HuMCs
To provide further evidence to support the role of GSK3β as an anti-apoptotic factor, we next determined whether the degree of knock down of GSK3β similarly correlated to the respective markers of apoptosis and cell death, annexin V and propidium iodide (PI) staining. The GSK3β-targeted shRNA-treated cells were grown in SCF-depleted medium for 20 h to increase the sensitivity of the assay. Under these conditions, the shGSK3β-treated HuMCs displayed a significant increase in apoptosis compared to the scrambled control-treated cells (construct A: 39.9 ± 2.7% and construct B: 54.5 ± 3.9% vs. 25.6 ± 3.1% apoptotic cells; n=4–5, p<0.001) (Figure 4A). Figure 4B shows representative scatter plots of HuMCs transduced with scrambled shRNA (shContr) or shRNA for two different constructs of GSK3β starved in SCF depleted media for 20 h and stained for annexin V and propidium iodide. Caspase 3, which is activated upon cleavage, plays a dominant role in the extrinsic apoptotic pathway. To further establish the role of GSK3β in the extrinsic apoptotic pathway, we therefore next examined cleaved caspase 3 by western blotting. As can be seen in figure 4C and D, the increase in apoptotic cells was associated with an increase in cleaved caspase 3 in the GSK3β knockdown cells compared to control treated cells. Taken together, these data support a role for GSK3β as a key regulator of an anti-apoptotic signaling pathway required for mast cell homeostasis. These data further support the conclusion that the anti-apoptotic signals provided by GSK3β act in conjunction with those initiated by SCF, rather than being directly regulated by SCF-mediated signaling.
Figure 4. GSK3β knockdown induces apoptosis in HuMC.
(A) HuMCs transduced with scrambled shRNA (shContr) or shRNA for GSK3β (shGSK3β A and B), were starved for 20 h and apoptosis was measured by annexin V staining. (B) Representative scatter plots of HuMCs transduced with scrambled shRNA (shContr) or shRNA for two different constructs of GSK3β starved in SCF depleted media for 20 h and stained for annexin V (x axis) and propidium iodide (PI) (y axis). The number in % represents total annexin V + cells (% annexin V+ cells in upper and lower right quadrants). shControl and shGSK3β transduced cells (construct B) were starved 15–20 h in SCF-depleted medium and then stimulated with SCF for 2 min. (C) Whole-cell extracts were prepared and immunoblotted with anti-GSK3β, anti-Cleaved Caspase 3 antibodies. The level of Syk demonstrates equivalent protein loading of samples. Data in D were generated by scanning blots from 3–4 independent experiments for cleaved caspase 3 and normalized to responses obtained at 2 min with SCF stimulation in shContr cells, n=3–5, p < 0.05* for comparison with shContr transduced HuMCs.
Downregulation of GSK3β inhibits SHP2 and ERK1/2 but not PI3K activation
As discussed (26, 27), an intact PI3K signaling axis is required for mast cell homeostasis. We therefore next examined whether the similar requirement for GSK3β for the maintenance of mast cell homeostasis could be explained by potential positive feedback regulation of PI3K activity. We thus examined if the SCF-dependent phosphorylation of AKT, was inhibited in the GSK3β-knocked down HuMCs compared to the scrambled control treated cells. As expected, and by means of a control, both the phosphorylation of Y216 of GSK3β and the phosphorylation of S9 of GSK3β were significant reduced in the knockdown cells compared to control shRNA-treated cells (Figure 5A–C). In contrast, there was no significant difference in the phosphorylation of AKT (S473) (Figure 5A,D) following SCF stimulation in the GSK3β knockdown cells compared to control cells. These observations indicate that the decrease in survival of HuMCs following knockdown of GSK3β was not due to positive feedback regulation of PI3K by GSK3β, but requires the regulation of other critical signaling elements required for mast cell homeostasis.
Figure 5. Effect of GSK3β knockdown on SCF-mediated PI3K activation in primary HuMCs.
(A) HuMCs, transduced with scrambled shRNA or shRNA for GSK3β (shGSK3β), were stimulated with SCF for 2 min as described in Material and Methods. Whole-cell extracts were prepared and immunoblotted with anti-p-AKT (S473), anti-phospho-GSK3α/β ((p)-Y279/Y216) or anti-p-GSK3β (S9) antibodies. The level of Syk demonstrates equivalent protein loading of samples. A representative blot is shown in figure. (B–D) Data were generated by scanning multiple blots as shown in A, and normalizing to the response obtained at 2 min with SCF stimulation. In all cases, n=3–4, p < 0.0001*** for comparison with SCF response in shContr transduced HuMCs.
In addition to PI3K, studies conducted in mouse bone marrow derived mast cells (BMMCs) suggest that SHP2 is also required for SCF-mediated mast cell proliferation and survival through the regulation of Rac/JNK (28). Furthermore, SHP2/Ras activation has also been shown to be critical for growth factor-induced ERK activation, through an undefined mechanism (29). We thus investigated whether the impact of GSK3β deficiency on HuMC survival may be explained by a downregulation of SHP2 and/or ERK activity. As can be seen in figure 6A–C, SCF-mediated activation of both SHP2 and ERK was significantly reduced in the GSK3β knockdown cells compared to the control cells. It is also of note that the constitutive phosphorylation of SHP2, but not ERK tended too also be lower in GSK3β knockdown cells. Taken together, these data indicate that the constitutive activation of GSK3β maintains mast cell homeostasis by providing a permissive signal allowing phosphorylated KIT to recruit SHP2 and ERK.
Figure 6. GSK3β knockdown reduces SCF-mediated SHP2 and ERK activation in primary HuMCs.
(A) HuMCs, transduced with scrambled shRNA or shRNA for GSK3β (shGSK3β), were stimulated with SCF for 2 min as described in Material and Methods. Whole-cell extracts were prepared and immunoblotted with anti-GSK3β, anti-p-SHP2 (Y580) or anti-p-ERK (T202/Y204) antibodies. The level of Syk demonstrates equivalent protein loading of samples. A representative blot is shown in. (B–D) Data were generated by scanning the multiple blots as in A, and normalizing to the response obtained at 2 min with SCF stimulation in shControl transduced HuMCs cells. In all cases, n=3–4, p < 0.001** p < 0.0001*** for comparison with SCF response.
Knock down of GSK3β downregulates expression of Bcl-2 family member anti-apoptotic proteins
Growth-factor induced apoptosis is regulated by the interplay of pro-survival and pro-apoptotic members of the Bcl-2 family proteins (30, 31). Studies have demonstrated that hyperactivation of phospho-ERK enhances cell survival by inducing expression of the pro-survival molecules Bcl-2 and Bcl-xL and suppression of the pro-apoptotic BH3-only protein Bim (32, 33). Similarly, gain-of-function SHP2 mutant expressing cells have elevated levels of both Bcl-2 and Bcl-xL, and reduced levels of Bim (32) which has previously been shown to be critical for growth factor deprivation-induced mast cell apoptosis (34). As we observed that GSK3β contributed to the regulation of ERK and SHP2 activity, we examined the expression of both anti-apoptotic (Mcl-1, Bcl-xL, and Bcl-2) and pro-apoptotic (Bim, Bid, and Bad) proteins in the SCF-starved and non-starved HuMCs following treatment with the GSK3β-targeted and control shRNA. As shown in Figure 7A, GSK3β knock down, if anything, increased the expression of Mcl-1, whereas SCF starvation reduced the expression of this anti-apoptotic protein. However, the expression of Bcl-xL and Bcl-2 were reduced by both SCF starvation and GSK3β knockdown, with further reduction observed with the combination of these approaches. In contrast, whereas SCF-enhanced the expression of Bim (Figure 7B) but partially reduced the expression of Bid and Bad, GSK3β knockdown reduced the expression of all three proteins. Nevertheless, the data as a whole suggested that GSK3β acts as a pro-survival signal for human mast cells by regulating the expression of the anti-apoptotic proteins Bcl-xL and Bcl-2 through the activation of ERK and SHP2. The reduced expression of the pro-apoptotic proteins following GSK3β knockdown (Bim, Bid, and Bad) and, to a certain extent, by SCF starvation (Bid and Bad) was somewhat counter-intuitive but may be a consequence of caspase cleavage (35, 36).
Figure 7. Effect of GSK3β knockdown, and SCF-starvation on pro-and anti-apoptotic proteins in primary HuMCs.
HuMCs transduced with scrambled shRNA (shContr) or shRNA for GSK3β (shGSK3β A), were (SCF−), or not (SCF+), starved for 20 h. Whole-cell extracts were prepared and immunoblotted with GSK, Mcl-1, Bcl-xL, Bcl-2 (A), or Bim, BID, or Bad (B) specific antibodies. Immunoblotting with Syk-specific antibody was used as sample protein loading control. The relative intensities of the immunoreactive proteins (left) were normalized to Syk and evaluated (right). In all cases, n=3–4, p < 0.001** p < 0.0001*** for comparison with SCF response.
A small molecule GSK3β inhibitor decreases survival of the HMC1.2 human leukemia mast cell line
Finally, based on our conclusion that GSK3β was an important mast cell pro-survival signal, we investigated whether a small molecule inhibitor of GSK3β could be employed to reduce HMC1.2 survival. To date, CHIR 99021 is the most selective inhibitor of GSK3β reported (37, 38). As can be seen in figure 8, this compound dose-dependently reduced the number of viable HMC1.2 cells after 24 h, 48 h and 72 h in culture, thus providing evidence for the potential of reducing mast cell burden by small molecule targeting of GSK3β.
Figure 8. Effects of CHIR 99021 on HuMC-1.2 cell line viability.
HMC-1.2 cells were cultured in the absence or presence of GSK3β inhibitor (CHIR 99021, 3–30 µM) and viability cell count was assessed by trypan blue dye exclusion after 24 h, 48 h or 72 h. All data are presented as the mean ± SEM of three independent experiments conducted in triplicate. p < 0.05*, p < 0.001** p < 0.0001*** vs vehicle treated control cells.
Discussion
In this paper, we describe studies that support the conclusion that GSK3β represents an essential pro-survival and/or anti-apoptotic signalling element in human mast cells and that this may be a consequence of the dependency of SCF-mediated SHP2 and ERK activation, known mast cell survival signals, on GSK3β activity.
Mast cell homeostasis represents a balance between mast cell proliferation/ survival signals, and mast cell pro-apoptotic signals (13, 39). In mature terminally differentiated human mast cells, SCF-mediated KIT activation skews this balance to pro-survival. Similarly, the ability of recognized KIT inhibitors to downregulate the expansion and survival of HMC1.1 and 1.2 cells (40) indicates that the myeloproliferative/survival potential of these cells is, at least in part, a consequence of the presence of activating mutations in KIT in these cell lines. As would be expected for a putative pro-survival/anti-apoptotic signal, we observed that GSK3β is constitutively active in the HMC1.2 cells (Figure 1) and in HuMCs (Figure 2), as reported (15). This was evidenced by the phosphorylation of the activating Y216 residue in GSK3β and GS at S641 under resting conditions in both the HMC1.2 cells and HuMCs. It is tempting to speculate that the constitutive activation of GSK3β that we observed in the HMC1.2 cell line and the HuMCs may be a consequence of KIT activity. We have observed, for example, that there is a slight enhancement of GS phosphorylation at positon S641 in HuMCs co-activated via KIT and the FcεRI. However, the inconsistency of this response in HuMCs challenged with SCF alone (Figure 2), and the lack of an increase in phosphorylation of GSK3β at the activating Y216 residue in response to SCF, would suggest that GSK3β activity in these cells is largely regulated independently of SCF. This conclusion is further supported by the limited ability of inhibitors of SCF-mediated signaling events to attenuate the constitutive GSK3β activity.
The kinase(s) responsible for the phosphorylation of GSK3β at Y216 in the human mast cells remain(s) unclear. However the studies conducted with PP2 would suggest that Src kinase family members are not responsible. It is evident, however, that the regulation of GSK3β activity at any point in time represents a balance between negative and positive regulatory pathways (21). Although it is apparent that SCF can induce the phosphorylation of GSK3β at the inhibitory site (S9), this was not associated with a decrease in the phosphorylation of GS at S641 which we have demonstrated requires the presence of GSK3β for optimal phosphorylation in mast cells (15). From these data, we conclude that there is net constitutive activation of GSK3β and, based on the shRNA knock down studies, it is evident that the constitutive GSK3β activity present in both HMC1.2 cells (Figure 1) and the HuMCs (Figure 3) is essential for their survival.
The requirement for GSK3β in mast cell homeostasis may be dependent on both its regulation of cell division and of anti-apoptotic pathways. Although the BrdU assay conducted in the HMC1.2 cells indicates that the dependency of the survival of these cells on GSK3β could be partly explained by prevention of cell division, the studies conducted on the non-proliferating HuMCs, would indicate that GSK3β also plays a major role in the prevention of mast cell apoptosis. This conclusion is supported by the close correlation between GSK3β expression and HuMC survival as determined by trypan blue exclusion and with the MTT assay (Figure 3); and by the close correlation between the degree of GSK3β knock down and the indices of apoptosis, Annexin V staining and caspase cleavage, in the SCF-starved HuMCs (Figure 4).
GSK3β has been described to regulate multiple cellular events including cell growth, cell survival, metabolism, gene expression and apoptosis (21, 41–43). However, in certain cases, including the regulation of growth factor-, and mitogen-mediated responses, the described roles appear paradoxical in that GSK3β may both positively and negatively regulate cellular processes through tightly coupled activation and/or inactivation. For example, in a variety of cell types including eosinophils (41), GSK3β has been suggested to support cell survival downstream of the PI3K/AKT pathway. However, in studies conducted in both hematopoietic cells and in neuronal cells, it has been proposed that apoptosis induced by growth factor withdrawal or PI3K inhibition is mediated by GSK3β (44–46). Furthermore, GSK3β inhibition has been suggested to modulate radiation resistance in certain cancers as well as promoting tumor growth, through stabilization of B-catenin (16, 47). Thus, as with the regulation of GSK3β activity, GSK3β -regulated responses may also represent a fine balance between negatively regulated-and positively-regulated signaling responses.
Our previous studies in which we explored the regulation of mast cell chemotaxis and cytokine production by GSK3β (15) also indicate that the role(s) of GSK3β in mast cell function are complex. Our results suggested, for example, that constitutively activated GSK3β must be considered in the context of regulation of signaling events in addition to the potential roles of receptor-mediated up-regulation and/or down-regulation of GSK3β activity (15). Certainly, in the current study, the constitutive activity of GSK3β we observed, the inability of SCF to enhance this response, and the requirement for ongoing GSK3β activity for cell survival, would suggest that GSK3β is also a pre-requisite signal, rather than an inducible signal, for mast cell homeostasis.
Although PI3K, and PI3K-regulated pro-survival pathways are recognized to be critical for mast cell homeostasis, our observation that the phosphorylation of AKT is unaffected by GSK3β knock down (Figure 5) suggests that GSK3β does not regulate cell proliferation/ survival through the feedback regulation of PI3K activity. However, based on our previous results (15), it is possible that PI3K may, in part, contribute to the regulation of GSK3β activity. It thus appears more likely that the ability of GSK3β to function as a pro-survival factor is related to its requirement for the ability of SCF to induce SHP2 and ERK phosphorylation (Figure 6), and potentially JNK phosphorylation (15). In mouse BMMCs, SHP2, through the regulation of Rac/JNK, has been shown to be required for SCF-mediated mast cell proliferation and survival (28) and to be critical for growth factor-induced ERK activation (48). SHP2 is a ubiquitously expressed non-receptor protein tyrosine phosphatase that participates in signaling events downstream of receptors for growth factors, cytokines, hormones and control cell growth, differentiation, migration and death (48). Thus, activation of SHP2 and its association with Gab1 is critical for sustained ERK activation downstream of several growth factor receptors and cytokines (48). The necessity for GSK3β in regulation of the MAP kinases ERK and JNK in the manner described above may be due to priming of regulatory components the MAPK pathways by GSK3β (15). Consequently, a deficiency in GSK3β would result in an inability of SCF, or indeed other stimuli to regulate cellular responses via the MAP kinases. However, it is also possible that SHP2 acts as a GSK3β substrate, since GSK3β knockdown cells showed an impaired SCF-mediated activation of SHP2. As both SHP2 and ERK have been demonstrated to regulate the expression of anti-apoptotic Bcl-2 family proteins (32, 33), our observation that GSK3β knockdown resulted in the down-regulation of these proteins (Figure 7) provided evidence for the mechanism by which GSK3β may function as a pro-survival signal in human mast cells. Such a mechanism would involve the requirement of SHP2 and ERK for constiutively active GSK3β to promote cell survival through expression of the Bcl-2 family members Bcl-2 and Bcl-xL.
In summary, the data presented in this study provide evidence that GSK3β is a key regulator of mast cell homeostasis in both neoplastic and primary cultured human mast cells through prevention of apoptosis. The data also indicate that the myeloproliferative capacity of the neoplastic HMC1.2 cells at least in part requires GSK3β activity and that a small molecule inhibitor (CHIR 99021) of GSK3β activity effectively reduces HMC1.2 cell survival (Figure 8). Thus, targeting GSK3β may provide a mechanism for modulating mast cell survival and apoptotic pathways in myeloproliferative disorders as well as in the allergic inflammatory response.
Acknowledgments
The authors wish to acknowledge the clinical staff within the Laboratory of Allergic Diseases of NIAID/NIH for providing us with CD34+ cells for culture of HuMCs.
Financial support for this work was provided by the Division of Intramural Research of NIAID within the National Institutes of Health. MR was in part funded by VBG-GROUP Centre for Asthma and Allergy Research, Herman Krefting Foundation against Asthma and Allergy.
Abbreviations
- BMMC
bone marrow derived mast cells
- FcεRI
high affinity IgE receptor
- GSK3β
Glycogen Synthase Kinase 3 beta
- GS
Glycogen Synthase
- HuMCs
human mast cells
- p
phospho
- shRNA
short hairpin RNA
- SHP-2
Src homology 2 domain-containing phosphatase 2
References
- 1.Nilsson G, Butterfield JH, Nilsson K, Siegbahn A. Stem cell factor is a chemotactic factor for human mast cells. J Immunol. 1994;153:3717–3723. [PubMed] [Google Scholar]
- 2.Okayama Y, Kawakami T. Development, migration, and survival of mast cells. Immunol Res. 2006;34:97–115. doi: 10.1385/IR:34:2:97. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Nilsson G, Miettinen U, Ishizaka T, Ashman LK, Irani AM, Schwartz LB. Interleukin-4 inhibits the expression of Kit and tryptase during stem cell factor-dependent development of human mast cells from fetal liver cells. Blood. 1994;84:1519–1527. [PubMed] [Google Scholar]
- 4.Roskoski R., Jr Structure and regulation of Kit protein-tyrosine kinase–the stem cell factor receptor. Biochem Biophys Res Commun. 2005;338:1307–1315. doi: 10.1016/j.bbrc.2005.09.150. [DOI] [PubMed] [Google Scholar]
- 5.Roskoski R., Jr Signaling by Kit protein-tyrosine kinase–the stem cell factor receptor. Biochem Biophys Res Commun. 2005;337:1–13. doi: 10.1016/j.bbrc.2005.08.055. [DOI] [PubMed] [Google Scholar]
- 6.Garcia-Montero AC, Jara-Acevedo M, Teodosio C, Sanchez ML, Nunez R, Prados A, et al. KIT mutation in mast cells and other bone marrow hematopoietic cell lineages in systemic mast cell disorders: a prospective study of the Spanish Network on Mastocytosis (REMA) in a series of 113 patients. Blood. 2006;108:2366–2372. doi: 10.1182/blood-2006-04-015545. [DOI] [PubMed] [Google Scholar]
- 7.Metcalfe DD. Mast cells and mastocytosis. Blood. 2008;112:946–956. doi: 10.1182/blood-2007-11-078097. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Nagata H, Worobec AS, Oh CK, Chowdhury BA, Tannenbaum S, Suzuki Y, et al. Identification of a point mutation in the catalytic domain of the protooncogene c-kit in peripheral blood mononuclear cells of patients who have mastocytosis with an associated hematologic disorder. Proc Natl Acad Sci U S A. 1995;92:10560–10564. doi: 10.1073/pnas.92.23.10560. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Nilsson G, Blom T, Kusche-Gullberg M, Kjellén L, Butterfield JH, Sundström C, et al. Phenotypic characterization of the human mast-cell line HMC-1. Scand J Immunol. 1994;9:489–498. doi: 10.1111/j.1365-3083.1994.tb03404.x. [DOI] [PubMed] [Google Scholar]
- 10.Roskoski R., Jr Src kinase regulation by phosphorylation and dephosphorylation. Biochem Biophys Res Commun. 2005;331:1–14. doi: 10.1016/j.bbrc.2005.03.012. [DOI] [PubMed] [Google Scholar]
- 11.Linnekin D. Early signaling pathways activated by c-Kit in hematopoietic cells. Int J Biochem Cell Biol. 1999;31:1053–1074. doi: 10.1016/s1357-2725(99)00078-3. [DOI] [PubMed] [Google Scholar]
- 12.Kim MS, Kuehn HS, Metcalfe DD, Gilfillan AM. Activation and function of the mTORC1 pathway in mast cells. J Immunol. 2008;180:4586–4595. doi: 10.4049/jimmunol.180.7.4586. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Möller C, Alfredsson J, Engström M, Wootz H, Xiang Z, Lennartsson J, et al. Stem cell factor promotes mast cell survival via inactivation of FOXO3a-mediated transcriptional induction and MEK-regulated phosphorylation of the proapoptotic protein Bim. Blood. 2005;106:1330–1336. doi: 10.1182/blood-2004-12-4792. [DOI] [PubMed] [Google Scholar]
- 14.Kirshenbaum AS, Akin C, Wu Y, Rottem M, Goff JP, Beaven MA, et al. Characterization of novel stem cell factor responsive human mast cell lines LAD 1 and 2 established from a patient with mast cell sarcoma/leukemia; activation following aggregation of FcεRI or FcγRI. Leuk Res. 2003;27:677–682. doi: 10.1016/s0145-2126(02)00343-0. [DOI] [PubMed] [Google Scholar]
- 15.Rådinger M, Kuehn HS, Kim MS, Metcalfe DD, Gilfillan AM. Glycogen synthase kinase 3β activation is a prerequisite signal for cytokine production and chemotaxis in human mast cells. J Immunol. 2010;184:564–572. doi: 10.4049/jimmunol.0902931. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Greenspan EJ, Madigan JP, Boardman LA, Rosenberg DW. Ibuprofen inhibits activation of nuclear β-catenin in human colon adenomas and induces the phosphorylation of GSK-3β. Cancer Prev Res (Phila) 2011;4:161–171. doi: 10.1158/1940-6207.CAPR-10-0021. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Tkaczyk C, Metcalfe DD, Gilfillan AM. Determination of protein phosphorylation in FcεRI-activated human mast cells by immunoblot analysis requires protein extraction under denaturing conditions. J Immunol Methods. 2002;268:239–243. doi: 10.1016/s0022-1759(02)00210-7. [DOI] [PubMed] [Google Scholar]
- 18.Smrž D, Iwaki S, McVicar DW, Metcalfe DD, Gilfillan AM. TLR-mediated signaling pathways circumvent the requirement for DAP12 in mast cells for the induction of inflammatory mediator release. Eur J Immunol. 2010;40:3557–3569. doi: 10.1002/eji.201040573. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Kataoka TR, Kumanogoh A, Bandara G, Metcalfe DD, Gilfillan AM. CD72 negatively regulates KIT-mediated responses in human mast cells. J Immunol. 2010;184:2468–2475. doi: 10.4049/jimmunol.0902450. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Hoeflich KP, Luo J, Rubie EA, Tsao MS, Jin O, Woodgett JR. Requirement for glycogen synthase kinase-3β in cell survival and NF-κB activation. Nature. 2000;406:86–90. doi: 10.1038/35017574. [DOI] [PubMed] [Google Scholar]
- 21.Doble BW, Woodgett JR. GSK-3: tricks of the trade for a multi-tasking kinase. J Cell Sci. 2003;116:1175–1186. doi: 10.1242/jcs.00384. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Hughes K, Nikolakaki E, Plyte SE, Totty NF, Woodgett JR. Modulation of the glycogen synthase kinase-3 family by tyrosine phosphorylation. EMBO J. 1993;12:803–808. doi: 10.1002/j.1460-2075.1993.tb05715.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Harwood AJ. Regulation of GSK-3: a cellular multiprocessor. Cell. 2001;105:821–824. doi: 10.1016/s0092-8674(01)00412-3. [DOI] [PubMed] [Google Scholar]
- 24.Tkaczyk C, Horejsi V, Iwaki S, Draber P, Samelson LE, Satterthwaite AB, et al. NTAL phosphorylation is a pivotal link between the signaling cascades leading to human mast cell degranulation following Kit activation and FcεRI aggregation. Blood. 2004;104:207–214. doi: 10.1182/blood-2003-08-2769. [DOI] [PubMed] [Google Scholar]
- 25.Kuehn HS, Beaven MA, Ma HT, Kim MS, Metcalfe DD, Gilfillan AM. Synergistic activation of phospholipases Cγ and Cβ: a novel mechanism for PI3K-independent enhancement of FcεRI-induced mast cell mediator release. Cell Signal. 2008;20:625–636. doi: 10.1016/j.cellsig.2007.11.016. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Ali K, Bilancio A, Thomas M, Pearce W, Gilfillan AM, Tkaczyk C, et al. Essential role for the p110δ phosphoinositide 3-kinase in the allergic response. Nature. 2004;431:1007–1011. doi: 10.1038/nature02991. [DOI] [PubMed] [Google Scholar]
- 27.Kim MS, Rådinger M, Gilfillan AM. The multiple roles of phosphoinositide 3-kinase in mast cell biology. Trends Immunol. 2008;29:493–501. doi: 10.1016/j.it.2008.07.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Yu M, Luo J, Yang W, Wang Y, Mizuki M, Kanakura Y, et al. The scaffolding adapter Gab2, via Shp-2, regulates kit-evoked mast cell proliferation by activating the Rac/JNK pathway. J Biol Chem. 2006;281:28615–28626. doi: 10.1074/jbc.M603742200. [DOI] [PubMed] [Google Scholar]
- 29.Rönnstrand L, Arvidsson AK, Kallin A, Rorsman C, Hellman U, Engström U, et al. SHP-2 binds to Tyr763 and Tyr1009 in the PDGF β-receptor and mediates PDGF-induced activation of the Ras/MAP kinase pathway and chemotaxis. Oncogene. 1999;18:3696–3702. doi: 10.1038/sj.onc.1202705. [DOI] [PubMed] [Google Scholar]
- 30.Cory S, Huang DC, Adams JM. The Bcl-2 family: roles in cell survival and oncogenesis. Oncogene. 2003;22:8590–8607. doi: 10.1038/sj.onc.1207102. [DOI] [PubMed] [Google Scholar]
- 31.Mekori YA, Gilfillan AM, Akin C, Hartmann K, Metcalfe DD. Human mast cell apoptosis is regulated through Bcl-2 and Bcl-XL. J Clin Immunol. 2001;21:171–174. doi: 10.1023/a:1011083031272. [DOI] [PubMed] [Google Scholar]
- 32.Ren Y, Chen Z, Chen L, Woods NT, Reuther GW, Cheng JQ, et al. Shp2E76K mutant confers cytokine-independent survival of TF-1 myeloid cells by up-regulating Bcl-XL. J Biol Chem. 2007;282:36463–36473. doi: 10.1074/jbc.M705789200. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Jazirehi AR, Vega MI, Chatterjee D, Goodglick L, Bonavida B. Inhibition of the Raf-MEK1/2-ERK1/2 signaling pathway, Bcl-xL down-regulation, and chemosensitization of non-Hodgkin's lymphoma B cells by Rituximab. Cancer Res. 2004;64:7117–7126. doi: 10.1158/0008-5472.CAN-03-3500. [DOI] [PubMed] [Google Scholar]
- 34.Alfredsson J, Puthalakath H, Martin H, Strasser A, Nilsson G. Proapoptotic Bcl-2 family member Bim is involved in the control of mast cell survival and is induced together with Bcl-XL upon IgE-receptor activation. Cell Death Differ. 2005;12:136–144. doi: 10.1038/sj.cdd.4401537. [DOI] [PubMed] [Google Scholar]
- 35.Yan Y, Su X, Liang Y, Zhang J, Shi C, Lu Y, et al. Emodin azide methyl anthraquinone derivative triggers mitochondrial-dependent cell apoptosis involving in caspase-8-mediated Bid cleavage. Mol Cancer Ther. 2008;7:1688–1697. doi: 10.1158/1535-7163.MCT-07-2362. [DOI] [PubMed] [Google Scholar]
- 36.Wikström K, Juhas M, Sjölander A. The anti-apoptotic effect of leukotriene D4 involves the prevention of caspase 8 activation and Bid cleavage. Biochem J. 2003;371:115–124. doi: 10.1042/BJ20021669. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Finlay D, Patel S, Dickson LM, Shpiro N, Marquez R, Rhodes CJ, et al. Glycogen synthase kinase-3 regulates IGFBP-1 gene transcription through the thymine-rich insulin response element. BMC Mol Biol. 2004;5:15. doi: 10.1186/1471-2199-5-15. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Tighe A, Ray-Sinha A, Staples OD, Taylor SS. GSK-3 inhibitors induce chromosome instability. BMC Cell Biol. 2007;8:34. doi: 10.1186/1471-2121-8-34. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Möller C, Karlberg M, Åbrink M, Nakayama KI, Motoyama N, Nilsson G. Bcl-2 and Bcl-XL are indispensable for the late phase of mast cell development from mouse embryonic stem cells. Exp Hematol. 2007;35:385–393. doi: 10.1016/j.exphem.2006.11.008. [DOI] [PubMed] [Google Scholar]
- 40.Jensen BM, Akin C, Gilfillan AM. Pharmacological targeting of the KIT growth factor receptor: a therapeutic consideration for mast cell disorders. Br J Pharmacol. 2008;154:1572–1582. doi: 10.1038/bjp.2008.204. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.Rosas M, Dijkers PF, Lindemans CL, Lammers JW, Koenderman L, Coffer PJ. IL-5-mediated eosinophil survival requires inhibition of GSK-3 and correlates with beta-catenin relocalization. J Leukoc Biol. 2006;80:186–195. doi: 10.1189/jlb.1105636. [DOI] [PubMed] [Google Scholar]
- 42.Beurel E, Jope RS. The paradoxical pro- and anti-apoptotic actions of GSK3 in the intrinsic and extrinsic apoptosis signaling pathways. Prog Neurobiol. 2006;79:173–189. doi: 10.1016/j.pneurobio.2006.07.006. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43.Martin M, Rehani K, Jope RS, Michalek SM. Toll-like receptor-mediated cytokine production is differentially regulated by glycogen synthase kinase 3. Nat Immunol. 2005;6:777–784. doi: 10.1038/ni1221. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 44.Sanchez JF, Sniderhan LF, Williamson AL, Fan S, Chakraborty-Sett S, Maggirwar SB. Glycogen synthase kinase 3β-mediated apoptosis of primary cortical astrocytes involves inhibition of nuclear factor κB signaling. Mol Cell Biol. 2003;23:4649–4662. doi: 10.1128/MCB.23.13.4649-4662.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 45.Somervaille TC, Linch DC, Khwaja A. Growth factor withdrawal from primary human erythroid progenitors induces apoptosis through a pathway involving glycogen synthase kinase-3 and Bax. Blood. 2001;98:1374–1381. doi: 10.1182/blood.v98.5.1374. [DOI] [PubMed] [Google Scholar]
- 46.Sinha D, Wang Z, Ruchalski KL, Levine JS, Krishnan S, Lieberthal W, et al. Lithium activates the Wnt and phosphatidylinositol 3-kinase Akt signaling pathways to promote cell survival in the absence of soluble survival factors. Am J Physiol Renal Physiol. 2005;288:F703–F713. doi: 10.1152/ajprenal.00189.2004. [DOI] [PubMed] [Google Scholar]
- 47.Watson RL, Spalding AC, Zielske SP, Morgan M, Kim AC, Bommer GT, et al. GSK3β and β-catenin modulate radiation cytotoxicity in pancreatic cancer. Neoplasia. 2010;12:357–365. doi: 10.1593/neo.92112. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 48.Dance M, Montagner A, Salles JP, Yart A, Raynal P. The molecular functions of Shp2 in the Ras/Mitogen-activated protein kinase (ERK1/2) pathway. Cell Signal. 2008;20:453–459. doi: 10.1016/j.cellsig.2007.10.002. [DOI] [PubMed] [Google Scholar]








