Skip to main content
PLOS Neglected Tropical Diseases logoLink to PLOS Neglected Tropical Diseases
. 2011 Nov 29;5(11):e1411. doi: 10.1371/journal.pntd.0001411

Targeting the Wolbachia Cell Division Protein FtsZ as a New Approach for Antifilarial Therapy

Zhiru Li 1, Amanda L Garner 2, Christian Gloeckner 2, Kim D Janda 2, Clotilde K Carlow 1,*
Editor: Sara Lustigman3
PMCID: PMC3226453  PMID: 22140592

Abstract

The use of antibiotics targeting the obligate bacterial endosymbiont Wolbachia of filarial parasites has been validated as an approach for controlling filarial infection in animals and humans. Availability of genomic sequences for the Wolbachia (wBm) present in the human filarial parasite Brugia malayi has enabled genome-wide searching for new potential drug targets. In the present study, we investigated the cell division machinery of wBm and determined that it possesses the essential cell division gene ftsZ which was expressed in all developmental stages of B. malayi examined. FtsZ is a GTPase thereby making the protein an attractive Wolbachia drug target. We described the molecular characterization and catalytic properties of Wolbachia FtsZ. We also demonstrated that the GTPase activity was inhibited by the natural product, berberine, and small molecule inhibitors identified from a high-throughput screen. Furthermore, berberine was also effective in reducing motility and reproduction in B. malayi parasites in vitro. Our results should facilitate the discovery of selective inhibitors of FtsZ as a novel anti-symbiotic approach for controlling filarial infection.

Note

The nucleotide sequences reported in this paper are available in GenBank™ Data Bank under the accession number wAlB-FtsZ (JN616286).

Author Summary

Filarial nematode parasites are responsible for a number of devastating diseases in humans and animals. These include lymphatic filariasis and onchocerciasis that afflict 150 million people in the tropics and threaten the health of over one billion. The parasites possess intracellular bacteria, Wolbachia, which are needed for worm survival. Clearance of these bacteria with certain antibiotics leads to parasite death. These findings have pioneered the approach of using antibiotics to treat and control filarial infections. In the present study, we have investigated the cell division process in Wolbachia for new drug target discovery. We have identified the essential cell division protein FtsZ, which has a GTPase activity, as an attractive Wolbachia drug target. We describe the molecular characterization and catalytic properties of the enzyme and demonstrate that the GTPase activity is inhibited by the natural product, berberine, and small molecule inhibitors identified from a high-throughput screen. We also found that berberine was effective in reducing motility and reproduction in B. malayi parasites in vitro. Our results should facilitate the discovery of selective inhibitors of FtsZ as a novel antibiotic approach for controlling filarial infection.

Introduction

Filarial nematode parasites are responsible for a number of devastating diseases in humans and animals. These include lymphatic filariasis and onchocerciasis that afflict 150 million people in the tropics and threaten the health of over one billion. Unlike other nematodes, the majority of filarial species are infected with an intracellular bacterium, Wolbachia [1]. In the human filarial nematode Brugia malayi, these obligate α-proteobacterial endosymbionts have been detected in all developmental stages [2][4]. Moreover, their presence is essential for the worm, as tetracycline-mediated clearance of bacteria from Brugia spp. leads to developmental arrest in immature stages and reduction in adult worm fertility and viability [5][10]. These findings have pioneered the approach of using antibiotics to treat and control filarial infections. However, in humans, tetracycline therapy is not ideally suited for widespread use because several weeks of treatment are required and the drug has contra-indications for certain individuals. Therefore, there is considerable interest in identifying new endosymbiont drug targets and other classes of compounds with anti-Wolbachia activity. Importantly, the completed genome sequence of the Wolbachia endosymbiont of B. malayi (wBm) [11] now enables genome-wide mining for new drug targets [11][14] and a foundation for rational drug design. These approaches should lead to the discovery of new classes of compounds with potent anti-Wolbachia/antifilarial activities targeting essential processes that are absent or substantially different in the mammalian host.

Bacterial cytokinesis has emerged as a major target for the design of novel antibacterial drugs [15][17] since several of the components that are essential for multiplication and viability are absent from mammals. The bacteria-specific “filamenting temperature sensitive” protein, FtsZ, plays a central role during bacterial cytokinesis. In Escherichia coli, temperature sensitive mutations in the ftsZ gene cause blockage in cell division with limited cell growth and the generation of long filaments. FtsZ assembles into the contractile Z-ring and coordinates more than a dozen other cell division proteins at the midcell site of the closing septum [18][21]. Formation of the septal Z-ring requires two important functional properties of FtsZ, namely, polymerization of the FtsZ monomers into protofilaments and GTPase activity. Since inhibition of either function is lethal to bacteria, both GTP-dependent polymerization [22][27] and enzymatic [27][28] activities of FtsZ have been targeted for the identification of new antibacterial agents. Several inhibitors have been discovered including synthetic compounds [17], [29] and natural products [17], [30][33].

In the present study, we identify the cell division machinery present in wBm and characterize the FtsZ protein (wBm-FtsZ). Using quantitative real time RT-PCR, Wolbachia ftsZ was found to be expressed throughout the life cycle, but up-regulated in fourth stage larvae and adult female worms. Recombinant wBm-FtsZ was shown to possess a robust GTPase activity, which was inhibited by the natural plant product berberine. Berberine was also effective in reducing motility and reproduction in B. malayi parasites in vitro. A library of small molecules was also examined for its inhibitory activity against the wBm and E. coli FtsZ proteins. Several compounds were identified as potent inhibitors, and structure-activity relationship studies revealed a derivative with selectivity for wBm-FtsZ. Thus, our results support the development of wBm-FtsZ as a promising new drug target in an anti-symbiotic approach for controlling filarial infection.

Materials and Methods

Cloning of ftsZ from the Wolbachia endosymbiont of the human filarial parasite B. malayi (wBm-ftsZ)

Living B. malayi adult female worms were purchased from TRS Laboratories, Athens GA. Genomic DNA and RNA were isolated following the protocols developed by Dr. Steven A. Williams (http://www.filariasiscenter.org/molecular-resources/protocols).

To clone full-length wBm-ftsZ for expression studies, forward 5′(GAGAGCTAGCATGTCAATTGACCTTAGTTTGCCAG)3′ (NheI site underlined) and reverse 5′(GAGACTCGAGTTACTTCTTTCTTCTTAAATAAGCTGG) 3′ (XhoI site underlined) primers were designed according to the wBm-ftsZ sequence (accession number: YP_198432) in order to amplify the gene from B. malayi genomic DNA. The PCR product was then cloned into the NheI and XhoI sites of pET28a(+) (Novagen) to generate a fusion protein with a His6 tag at the N terminus. The authenticity of the insert was verified by sequencing.

Wolbachia ftsZ gene expression in various developmental stages of B. malayi

Total RNA supplied by the Filariasis Research Resource Center (FR3) was treated with RNase-free Dnase (New England Biolabs, Cat# M0303S) and purified using the RNeasy Kit from Qiagen. cDNA was obtained using random primers and the ProtoScript® AMV First Strand cDNA Synthesis Kit (New England Biolabs, Cat# E6550S). Forward primer 5′ (AACAAGAGAGGCAAGAGCTGGAGT) and reverse primer 5′(CGCACACCTTCAAAGCCAAATGGT) were utilized to amplify a 102 bp Wolbachia ftsZ amplicon. Wolbachia 16S rRNA amplified with forward primer 5′ (TGAGATGTTGGGTTAAGTCCCGCA) and reverse primer 5′(ATTGTAGCACGTGTGTAGCCCACT) was utilized for bacterial total RNA quantification. B. malayi 18S rRNA amplified with forward primer 5′ (ACTGGAGGAATCAGCGTGCTGTAA) and reverse primer 5′(TGTGTACAAAGGGCAGGGACGTAA) was utilized as a total worm RNA control. Quantitative PCR was performed using the DyNAmo™ HS SYBR® Green qPCR Kit (Thermo Fisher) and a CFX-96 Real Time PCR instrument (Bio-rad, Hercules, CA). Relative levels of ftsZ expression (ratio of ftsZ to 16S rRNA), and abundance of Wolbachia in B. malayi (ratio of Wolbachia 16S to B. malayi 18S rRNA) were calculated for each RNA sample. Experiments were performed twice with triplicate samples. Controls consisting of samples processed in the absence of reverse transcriptase were included in qPCR and no DNA contamination was detected.

Identification and cloning of FtsZ from the Wolbachia endosymbiont of Aedes albopictus

To determine the sequence of the ftsZ gene from the Wolbachia endosymbiont wAlB present in the insect cell line Aa23 [34], multilocus sequence typing (MLST) ftsZ forward 5′ (TGTAAAACGACGGCCAGTATYATGGARCATATAAARGATAG) and reverse 5′ (CAGGAAACAGCTATGACCTCRAGYAATGGATTRGATAT) [35] primers were utilized to obtain a PCR fragment. Using BLAST analysis, the sequence of the PCR product was compared to the corresponding region of known full-length ftsZ sequences and their conserved downstream and upstream sequences and 6 additional primers 5′(TCTATTTTTAATTCTTTTAGAGAAGCATT), 5′(CGTTCGGTTTTGAAGGTGTGC), 5′ (ACCGTTGTGGGAGTGGGTGGT), 5′ (TTATTTTTTTCTTCTTAAATAAGCTGGTATATC), 5′ (GGAATGACAATAAGTGTATCTACGTA), and 5′(TGCATTTGCAGTTGCTCATCC) were designed to obtain a complete wAa-ftsZ sequence. Phusion® High-Fidelity DNA Polymerase (New England Biolabs, M0530) was utilized for all PCR reactions according to manufacturer's instructions.

Expression and purification of recombinant Wolbachia FtsZ proteins

wBm-ftsZ and E. coli ftsZ (Ec-ftsZ) were amplified using genomic DNA isolated from B. malayi and E. coli wild-type strain MG1655 respectively, and were then cloned into the pET28a plasmid to generate fusion proteins with a N-terminal His tag. Each protein was expressed in the Escherichia coli strain C2566 (New England Biolabs). Optimum conditions for production of soluble recombinant wBm-FtsZ involved co-transformation with the pRIL plasmid isolated from BL21-CodonPlus (DE3) cells (Stratagene) together with the pET28a-ftsZ plasmid. Cultures were grown at 37°C till the OD600 reached 0.6, before induction with 0.1 mM IPTG overnight at 16°C. Both Ec-FtsZ and wBm-FtsZ were purified using a similar method. The cells expressing the recombinant proteins were suspended in lysis buffer (20 mM NaPO4, 500 mM NaCl, 10 mM imidazole, pH 7.4) plus 1 mg/mL lysozyme and protease inhibitor cocktail (Roche) and incubated on ice for 30 min, followed by sonication. The lysate was then cleared by centrifugation at 12,500 rpm, 4 °C for 30 min. The His-tagged proteins were purified on a 5 mL HiTrap chelating HP column (GE Healthcare) using an AKTA FPLC following manufacturer's instructions. After application of the sample, the column was washed with 5 column volumes of buffer A (20 mM NaPO4, 500 mM NaCl, 10 mM imidazole, pH 7.4) followed by 10 column volumes of 92% buffer A:8% buffer B (20 mM NaPO4, 500 mM NaCl, 400 mM imidazole, pH 7.4). Protein was then eluted using a linear gradient (8–100%) of buffer B equivalent to 40–400 mM imidazole.

Fractions containing wBm-FtsZ or Ec-FtsZ were pooled, dialyzed against dialysis buffer (40 mM Tris-HCl, 200 mM NaCl and 50% glycerol, pH 7.5) and stored at −20°C prior to use. Purity of the proteins was estimated by 4–20% SDS-PAGE and the protein concentration was determined using the Bradford assay.

GTPase enzyme assay

GTPase activity was measured using an enzyme-coupled assay [36]. Activity was determined by measuring the consumption of NADH, which is monitored by absorbance at 340 nm. The amount of NADH oxidized to NAD corresponds to the amount of GDP produced in the reaction. Reactions were optimized for a 96-well format to enable compound screening. The 100 µL reaction mixture containing 50 mM MOPS (4-morpholinepropanesulfonic acid) pH 6.5, 50 mM KCl, 5 mM MgCl2,1 mM PEP, 500 mM NADH, 0.1% Tween-20, 20 units/mL of L-lactate dehydrogenase (Sigma L2518) and pyruvate kinase (Sigma P7768), 1 mM GTP and 5 mM FtsZ was distributed into 96-well plates. The plate was incubated at 30 °C for 45 min with data collected at 20 second intervals using a SpectraMax® Plus 384 (Molecular Devices) spectrophotometer. Control assays without FtsZ were performed to provide a baseline and with GDP to ensure the function of the coupling enzymes.

For inhibitor screening, 100 µL of reaction mixture was added to each well of a 96-well plate and 1 µL of compound dissolved in DMSO, or berberine sulfate (MP Biomedicals) in water, in varying concentrations were added. The reaction was initiated at 30 °C by adding 1 mM GTP. Experiments were performed in triplicate.

Effect of berberine on B. malayi

Living B. malayi adult female and male worms were washed extensively with RPMI1640 medium supplemented with 2 mM glutamine, 10% Fetal Calf Serum (Gibco) and 100 U/mL streptomycin, 100 mg/mL penicillin, 0.25 mg/mL amphotericin B (Sigma). Three worms of either gender were distributed into each well of a 6-well plate and incubated at 37 °C, 5% CO2. After overnight recovery, motility and microfilaria production were recorded. Worms were then transferred to a new well containing varying amounts of berberine sulfate dissolved in water, namely 40 µM, 20 µM, 10 µM and 5 µM. Control wells containing either no drug or 10 µM doxycycline, were also included. Culture media were replaced with fresh medium containing drug daily. Adult worm and microfilaria motility production were recorded daily as described [37]. Motility was scored as described [38] and expressed as % of motility relative to motility scored on day 0 of the experiment. Microfilaria production was counted in 10 µL of either diluted or concentrated culture medium using a hemocytometer. The results were presented as the number of microfilaria released in 1 mL of medium from each well on the indicated day. Each treatment was performed in triplicate and the experiment was repeated several times.

Effect of berberine on E. coli growth

Berberine sulfate (MP Biomedicals) was added at a final concentration of 0–400 µM to growth medium containing E. coli ER1613 (acrA13 Δ(top-cysB)204 gyrB225 IN(rmD-rmE) mcrA) (New England Biolabs) and growth determined during 5 h or 20 h of incubation. For the 5 h evaluation, an overnight culture of E. coli ER1613 (acrA13 Δ(top-cysB)204 gyrB225 IN(rmD-rmE) mcrA) (New England Biolabs) was diluted 100-fold and 1 mL volumes were dispensed into a 48-well deep well plate (Axygen Scientific) containing various concentrations (0–400 µM) of berberine sulfate (10 µL of serial diluted berberine sulfate in water). The plate was then incubated at 30 °C with shaking. After 90 min of initial growth, bacterial growth was determined every 30 min for 5 h by monitoring absorption at 600 nm using a microtiter plate reader (Spectramax M5, Molecular Devices). Alternatively, an overnight culture of E. coli was diluted 1∶1000 fold and incubated with varying amounts of berberine sulfate for 20 h before growth was determined. All experiments were performed at least twice. Viability of berberine sulfate-treated (24 h) cells was evaluated by spotting 3 µL serial dilutions (10−2–10−7) of bacteria on a petri dish and incubation overnight at 30 °C.

Bacterial morphology was visualized using a Zeiss AxioVert 200 microscope and images were obtained using a 20× objective.

General chemistry methods for library synthesis

Reactions were carried out under a nitrogen atmosphere with dry, freshly distilled solvents under anhydrous conditions, unless otherwise noted. Yields refer to chromatographically and spectroscopically homogenous materials, unless otherwise stated. Reactions were monitored by thin-layer chromatography (TLC) carried out on 0.25-mm EMD silica gel plates (60F-254) using UV-light (254 nm). Flash chromatography separations were performed on Silicycle silica gel (40–63 mesh). Purity analyses were performed using HPLC (254 nm).

General synthetic procedure for library compounds

A stirring solution of aldehyde (1.0 equiv) in MeOH at 25°C was treated with carboxylic acid (2.0 equiv), amine (2.0 equiv) and isonitrile (2.0 equiv). The solution was heated to reflux, and stirred for 24 h. The solution was then cooled to 25°C and concentrated in vacuo. The crude residue was purified via flash column chromatography (10–50% EtOAc in hexanes) to afford the purified product. For characterization data, see references [39][40].

Results

Genomic organization of the major cell division genes in wBm

The bacterial cell-division pathway has been extensively studied in E. coli and several essential proteins have been identified [17], [19]. Many of the genes encoding putative orthologs of these proteins are also present in wBm (Table 1). A total of 18 major cell division genes were identified in wBm genome (Table 1), including ftsZ, ftsA, ftsI, ftsK, ftsQ and ftsW, which are known to be essential for cell division [17]. These wBm genes were mapped and found to be more scattered throughout the genome, in comparison with their E. coli homologs. In E. coli the majority of genes were found in one major operon, with the remaining 5 genes distributed randomly. Of these, FtsZ was one of the most highly conserved essential proteins possessing 43% identity to Ec-FtsZ (Table 1). Wolbachia ftsA, ftsI, ftsK, ftsQ and ftsW were less related (13–34%) to the E. coli homologs. Some previously described essential cell division genes in E. coli (including ftsB, ftsL, ftsN and ZipA) were not found in wBm, indicating that there are differences in the cell division machinery present in free living E. coli and intracellular Wolbachia.

Table 1. Comparison of cell division machinery present in Wolbachia and E. coli *.

Gene name Ec number Ec Size (AA) wbm gene number wBm Size (AA) Annotation Identity
ftsW b0089 414 wbm0015 373 integral membrane protein involved in stabilizing FstZ ring during cell division 24.4
zapA b2910 109 wbm0057 105 protein that localizes to the cytokinetic ring 18.1
ftsI b0084 588 wbm0075 521 transpeptidase in septal peptidoglycan synthesis (penicillin-binding protein 3) 18.6
mraW b0082 313 wbm0107 333 16S rRNA m(4)C1402 methyltranserfase, SAM-dependent 34.2
ftsA b0094 420 wbm0113 412 ATP-binding cell division protein involved in recruitment of FtsK to Z ring 23.3
murC b0091 491 wbm0118 556 UDP-N-acetylmuramate:L-alanine ligase 27.7
mreB b3251 347 wbm0154 358 cell wall structural complex MreBCD, actin-like component MreB 53.0
murF b0086 452 wbm0238 455 UDP-N-acetylmuramoyl-tripeptide:D-alanyl-D-alanine ligase 27.9
ftsH b3178 644 wbm0490 609 protease, ATP-dependent zinc-metallo 46.5
murE b0085 495 wbm0492 496 UDP-N-acetylmuramoyl-L-alanyl-D-glutamate:meso-diaminopimelate ligase 25.2
murD b0088 438 wbm0508 498 UDP-N-acetylmuramoyl-L-alanine:D-glutamate ligase 22.8
murG b0090 355 wbm0557 343 N-acetylglucosaminyl transferase 22.4
ddl b0092 306 wbm0570 339 D-alanine:D-alanine ligase 29.4
ftsQ b0093 276 wbm0571 252 Divisome assembly protein, membrane anchored protein at septum 13.1
ftsZ b0095 383 wbm0602 396 GTP-binding tubulin-like cell division protein 42.8
mraY b0087 360 wbm0643 326 phospho-N-acetylmuramoyl-pentapeptide transferase 33.1
ftsK b0890 1329 wbm0644 707 DNA translocase at septal ring sorting daughter chromsomes 33.7
murB b3972 342 wbm0778 295 UDP-N-acetylenolpyruvoylglucosamine reductase, FAD-binding 19.3

*Only major E. coli cell-division proteins are shown.

Sequence analysis of wBm-ftsZ

wBm-ftsZ exists as a single gene on the chromosome and is 1182 bp in length. It encodes a 394-amino acid protein with a predicted molecular mass of 42 kDa containing four distinct domains characteristic of FtsZ proteins. These comprise the variable N-terminal domain, a highly conserved core region, variable spacer, and a C-terminal conserved domain. The core region contains the highly conserved catalytic aspartate residue [41][42] and the GGGTGTGA motif (8 residues see [41], [43]), which are responsible for GTP hydrolysis and required for polymerization of the protein. The C-terminal region is not required for assembly, but is essential for interactions with the cell division proteins FtsA, FtsW and ZipA [17]. A similar organization was also found in the insect Wolbachia, wMel-FtsZ (NP_966481) and wAlB-FtsZ (JN616286). The FtsZ proteins of Wolbachia from different hosts share 89–91% identity and 43% identity to E. coli FtsZ proteins, with a substantially lower level at the carboxyl-terminal region (17.2% identity).

Analysis of wBm-ftsZ expression during the life cycle of B. malayi

Wolbachia have been identified in all developmental stages of B. malayi, from studies on individual worms and isolates from regions endemic for lymphatic filariasis [2][4]. To determine the relative expression of wBm-FtsZ throughout the parasite life cycle and validate its suitability as a drug target, wBm-ftsZ mRNA expression was analyzed by quantitative real-time reverse transcription polymerase chain reaction (qRT-PCR). Relative levels of ftsZ expression (ratio of Wolbachia ftsZ to 16S rRNA) and abundance of Wolbachia in B. malayi (ratio of Wolbachia 16S to B. malayi 18S rRNA) were calculated for each RNA sample.

wBm-ftsZ was found to be expressed throughout all stages examined (adult female and male worms, microfilariae, third- and fourth-stage larvae). Moreover, wBm-ftsZ/16S ratios were found to be increased substantially following infection of the mammalian host since levels were significantly higher (p value<0.001) in fourth-stage larvae and adult female worms compared to the vector-derived infective third-stage larvae. The wBm-ftsZ/16S ratio was also higher in microfilariae compared with the vector-derived third-stage larvae, but was significantly lower than the ratios obtained for fourth-stage and adult female worms. Of the various developmental stages examined, the lowest level of wBm-ftsZ expression was found in male worms (Figure 1A). No DNA contamination was detected in controls consisting of samples processed in the absence of reverse transcriptase. Wolbachia 16S rRNA/B. malayi 18S rRNA ratios were also determined to measure the relative abundance of bacteria in different stages of B. malayi (Figure 1B). Wolbachia was found to be most abundant in fourth stage larvae and adult female worms and least abundant in infective third stage larvae, indicating a massive multiplication of Wolbachia soon after infection of the mammalian host. Taken together, these data indicate that while wBm-ftsZ is expressed in all stages, gene activity and bacterial multiplication is most pronounced in fourth-stage larvae and adult females.

Figure 1. Wolbachia ftsZ gene expression in various developmental stages of B. malayi.

Figure 1

Female adult worm, male adult worm, microfilaria, L3 and L4 were analyzed. The ratio of ftsZ to 16S rRNA (A) represents ftsZ gene expression, while the ratio of Wolbachia 16S to B. malayi 18S rRNA (B) represents the relative abundance of Wolbachia in B. malayi. The data obtained from triplicate samples are expressed as a mean ± standard deviation.

Expression and purification of recombinant wBm-FtsZ

Recombinant wBm-FtsZ was expressed in E. coli with a His-tag at the C-terminus and purified by nickel-affinity chromatography (Figure 2A). Optimum conditions for production of soluble recombinant wBm-FtsZ involved growth of cultures at 37°C until the OD600 reached 0.6, followed by induction with 0.1 mM IPTG overnight at 16°C. Purified protein was eluted with 100 mM imidazole. The apparent molecular weight of 43 kDa (Figure 2A) was consistent with the predicted molecular size of wBm-FtsZ with an N-terminal His-tag. For comparative studies, E. coli FtsZ (41 kDa) was also expressed and purified in a similar manner (Figure 2B).

Figure 2. Expression and purification of recombinant FtsZ proteins.

Figure 2

FtsZ protein from Wolbachia (A) and E. coli (B) were expressed in E. coli with a His-tag at the N-terminus and purified by nickel-affinity chromatography. The apparent molecular weight (indicated) from SDS–PAGE was consistent with the predicted molecular size. Protein marker (M), total protein lysate (T), insoluble proteins (In), soluble (S) and purified FtsZ proteins (P) are shown.

Recombinant wBm-FtsZ has GTPase activity

GTPase activity was measured using an enzyme-coupled assay involving pyruvate kinase and lactate dehydrogenase [36]. GTP hydrolysis was determined by measuring the decrease in fluorescence emission following oxidation of nicotinamide adenine dinucleotide (NADH) to NAD (Figure 3A). As Figure 3B shows, recombinant wBm-FtsZ was found to possess GTPase activity. Moreover, the specific activities for wBm-FtsZ and Ec-FtsZ were comparable (0.18±0.012 µmolµmin−1mg−1 and 0.22±0.015 µmol min−1mg−1, respectively).

Figure 3. GTPase activity of recombinant wBm-FtsZ.

Figure 3

Panel A, activity was determined indirectly by measuring a decrease in NADH concentration by its absorbance at 340 nm. FtsZ hydrolyzes GTP into GDP and inorganic phosphate. The GDP product is used as a substrate by pyruvate kinase (PK) in the presence of phosphoenol pyruvate (PEP) to yield GTP and pyruvic acid as products. Pyruvic acid is used as a substrate in the presence of NADH by lactate dehydrogenase (LDH) to generate lactate and NAD. The consumption of NADH is proportional to GTPase activity. Panel B, comparison of the GTPase activity of wBm-FtsZ and Ec-FtsZ. A control without enzyme was also included. Activity was indicated by a decrease of NADH measured by absorbance at 340 nm.

Inhibition of wBm-FtsZ GTPase activity using the plant alkaloid berberine

Berberine, an alkaloid natural product, is a known inhibitor of the GTPase activity of FtsZ in E. coli [33], [44]. Thus, we were interested in examining the generality of berberine's GTPase inhibitory activity against wBm-FtsZ. As Figure 4 shows, dose-dependent inhibition (25–1000 µM) was found with an IC50 value of 320 µM. E. coli FtsZ [33], [44] was included for comparison, and an IC50 value of 240 µM was observed (Figure 4). Since wBm-FtsZ possesses all but one of the key residues proposed in the binding of E. coli FtsZ to berberine (lysine instead of glycine at position 183 of Ec-FtsZ), this may account for the higher concentration of berberine required to inhibit 50% of wBm-Ftsz's GTPase activity.

Figure 4. Berberine sulfate inhibition of the GTPase activity.

Figure 4

Enzyme activity of wBm-FtsZ (•) and Ec-FtsZ (□) was determined in the presence of 0, 25, 50, 100, 200, 400, 600, 800, and 1000 µM berberine sulfate. The data obtained from triplicate samples are expressed as a mean ± standard deviation.

The effect of berberine on the motility and microfilariae production of B. malayi in vitro

Since filarial Wolbachia remain unculturable, we were unable to evaluate the direct effect of berberine on the endosymbiont. Therefore, we examined the indirect effect of the drug on adult female worm. As Figure 5A shows, berberine (10–40 µM) had adverse effects on the motility of adult female B. malayi worms, as well as microfilariae production (Figure 5B) when compared to untreated controls. Two days after treatment with berberine (40 µM), female worms showed almost no movement and the production of microfilaria had virtually ceased. Berberine at 20 µM was comparable to 10 µM of doxycycline in terms of effect on female worm motility. Reduction in adult female motility coincided with a decrease in microfilariae production. Similarly, motility of the freshly released microfilaria was decreased when berberine was present, with some effect observed at the lowest concentration (5 µM) tested (Figure 5C). On the other hand, male worms were more resistant to the effects of the drug with limited reduction in motility observed following treatment with berberine (5–40 µM) for 6 days (Figure 5D). However, treatment with 100 µM berberine for 24 h did completely paralyze male worms (data not shown). Doxycycline (10 µM) had a comparable affect on the motility of male and female worms.

Figure 5. Effect of berberine sulfate on B. malayi parasites in culture.

Figure 5

Motility of adult female (A) and male (D) worms, and microfilariae (C) was examined following 6 days exposure to varying amounts (5–40 µM) of berberine sulfate. 10 µM doxycycline was included as a control. Motility was scored as described [38] and expressed as % of motility relative to motility scored on day 0 of the experiment. Micofilariae production (B) was determined at each time point by counting the number of microfilaria present in 1 mL spent culture media. The data obtained from triplicate samples are expressed as a mean ± standard deviation.

The effect of berberine on E. coli growth, morphology and viability

To demonstrate that berberine's in vitro GTPase inhibitory activity and anti-parasitic activity correlates with its known antibacterial activity, studies were performed on E. coli strain ER1613. Berberine is known to act as a substrate for the multi-drug resistance efflux pumps and ER1613 contains a mutation in the acrA gene, which inactivates the multidrug efflux pump [45]. Overnight incubation of ER1613 with 0–100 µM berberine showed a dose-dependent effect with complete inhibition of bacterial growth observed at 60 µM (Figure 6A). Similarly, no growth was evident when experiments were initiated with greater bacterial densities and the cells were treated with 50 µM berberine for up to 5 h (Figure 6B). Treatment with berberine resulted in the filamentous phenotype (Figure 5C) typically observed in ftsZ mutant strains [46], indicating that berberine was inhibiting cell division. Moreover, the presence of elongated bacteria also correlated with decreased growth and viability. Viability was also evaluated by ability to form colonies on an agar plate. Berberine sulfate-treated (24 hours) cells produced substantially fewer colonies (Figure 6D), compared to untreated controls. Untreated bacteria had approximately 4×105 - fold growth in 24 h, whereas bacteria treated with 40 µM berberine had 4×102 - fold growth. At concentrations of 80 µM and higher, the treated bacteria failed to produce viable colonies (Figure 6D), demonstrating that without active replication E. coli die.

Figure 6. Berberine sulfate inhibition of E. coli growth.

Figure 6

Panel A, overnight growth of E. coli was determined in the presence of various concentrations of berberine sulfate. Percentage of growth is indicated as 100×(OD600 nm with berberine/OD600 nm without berberine). The data obtained from triplicate samples are expressed as a mean ± standard deviation. Panel B, log-phase (5 h) growth (OD600 nm) of E. coli was determined in the presence of various concentrations (10–70 µM) of berberine sulphate. Panel C, DIC micrographs of E. coli untreated (0 µM) or treated with 40 µM or 80 µM berberine sulfate. Panel D, effect of berberine sulfate on E. coli viability. Viability of berberine sulfate-treated (24 hours) cells was evaluated by plating serial dilutions (10−2–10−7) of bacteria (Output shown in duplicate) on a petri dish and incubation overnight at 30 °C. The number of bacteria present in the inoculum used in the experiment (Input) is also shown.

Identification of new inhibitors of wBm-FtsZ GTPase activity

To initiate a campaign to identify molecularly unique inhibitors of wBm-FtsZ GTPase activity, a library of small molecules based on naphthalene, quinoline and biphenyl core scaffolds were examined [39][40] (Figure 7A). The library was constructed using Ugi multicomponent reaction chemistry, and each compound consists of a flat aromatic scaffold for enhanced π-stacking interactions decorated with varying diversity elements (R1–R4 in Figure 7A). Importantly, these scaffold motifs are also found in berberine (Figure 7B) and known FtsZ inhibitors [17], [29][33]. The ∼500-member library was screened using the wBm-FtsZ GTPase assay, and 13 compounds with greater than 30% inhibition at 100 µM were identified. From these screening efforts, compounds AV-C6 and N938 (Figure 7C) emerged as leading hits, and each showed dose-dependent inhibition of wBm-FtsZ (Figure 8A). AV-C6 and N938 were also examined for inhibition of the E. coli FtsZ enzyme (Figure 8A). As shown in Figure 8A, both compounds inhibited Ec-FtsZ activity although each was slightly less potent compared to the inhibitory activity against wBm-FtsZ.

Figure 7. Structures of FtsZ inhibitors and scaffolds.

Figure 7

General scaffolds for small molecule library compounds (A). Structure of berberine (B). FtsZ inhibitors identified from the initial high-throughput screen (C). FtsZ inhibitors identified from SAR studies (D).

Figure 8. Inhibition of GTPase activity by small molecules.

Figure 8

wBm-FtsZ (▪ and •) and Ec-FtsZ (□ and ○) were compared. Panel A, compounds were tested at the concentration of 30, 40, 50, 60, 70, 80, 90, and 100 µM and the experiment were performed in duplicate, the mean value was plotted. Panel B, compounds were tested at the concentration of 10, 20, 40, 60, 80, and 100 µM and the experiments were performed in triplicate, the mean ± standard deviation was plotted.

Structure-activity relationship (SAR) studies were then performed on N938 as this compound showed the most potential in dose response experiments. In addition to identifying compounds with enhanced potency, we were also interested in exploring the possibility of tuning down any inhibitory activity against Ec-FtsZ in order to obtain a more specific Wolbachia FtsZ inhibitor. A series of analogues were synthesized with varying aromatic side chains (R3 in Figure 7A). As shown in Figure 8B, both goals were met: N982 with an ortho-chloro substituent (Figure 7D) showed enhanced potency in the wBm-FtsZ assay and N983 with a para-cyano substituent (Figure 7D) showed some specificity for wBm-FtsZ over that from E. coli. Future SAR studies should enable the discovery of compounds with both enhanced inhibitory properties and specificity. Finally, as the solubility of these compounds is poor, 100% inhibition of FtsZ with this scaffold was not possible and true IC50 values could not be obtained. Scaffold modification and/or hopping strategies will be investigated in the future to afford enhanced solubility.

Discussion

The use of antibiotics targeting the Wolbachia endosymbionts of filarial parasites has been validated as an approach for controlling filarial infection in animals and humans. As a result, there is considerable interest in identifying new compounds that specifically target the obligate bacterial endosymbiont. In the present study, we investigated the cell division pathway in wBm to identify new drug targets that may be exploited for the development of new antifilarial therapies. Filamenting temperature sensitive (fts) genes produce many of the proteins essential for cell division in E. coli [17]. In wBm, we identified the majority of core genes that are indispensable to cytokinesis including ftsA, ftsI, ftsK, ftsQ, ftsW and ftsZ.

Interestingly, ftsB, ftsL, ftsN and ZipA were not found in wBm. ZipA is a bitopic membrane protein with a large cytoplasmic domain that binds and bundles FtsZ protofilaments in vitro and helps to stabilize the Z ring in vivo. FtsN is a core component of the divisome that accumulates at the septal ring at the initiation of the constriction process. The C-terminal SPOR domain specifically recognizes a transient form of septal murein, which helps trigger and sustain the constriction process. However, in E. coli, it has been found that alterations in FtsA can compensate for the absence of ZipA, FtsK [47] and FtsN [48] and a gain-of-function FtsA variant, FtsA*(R286W), efficiently stimulates cell division in the complete absence of ZipA [47]. Thus, Wolbachia FtsA may function like the mutant FtsA, as an alanine residue is present in the same position.

ftsB, ftsL, ftsN and ZipA are also absent in some important bacterial pathogens including certain Gram-negative (Neisseria spp., Bordetella pertussis, Helicobacter pylori, Chlamydia spp.) and Gram-positive (Mycobacterium tuberculosis) bacteria and cell wall-lacking (Mycoplasma pneumoniae) organisms [17]. It is likely that this reflects the reduced genome size present in these intracellular bacteria.

FtsZ is the most highly conserved essential bacterial cell division protein and is present in all bacteria except Chlamydia spp [17]. We determined that wBm-FtsZ shares substantial similarity (43% identity) to the highly characterized E. coli FtsZ protein and is highly similar (∼90% identity) to insect Wolbachia FtsZ proteins. While the majority of wBm genes are expressed in a stage-specific manner [49], wBm-ftsZ was found to be expressed in both male and female worms as well as in all larval stages examined. It was not surprising to find wBm-ftsZ expressed throughout the entire lifecycle of the parasite since the bacterial Z-ring is known to exist in a state of dynamic equilibrium in order to fulfill its many roles in the cell. Using fluorescence recovery after photo bleaching (FRAP), the E. coli Z-ring was found to continually remodel itself with a halftime of 30 seconds with only 30% of cellular FtsZ present in the ring with continuous and rapid exchange of subunits within a cytoplasmic pool [17]. E. coli ftsZ transcription analysis has revealed that the rate of ftsZ expression is constant with a sudden doubling at a specific cell age, suggesting that ftsZ expression is regulated [50]. Similarly, we observed up-regulation of wBm-ftsZ gene expression in fourth-stage larvae and adult female worms with microfilariae likely contributing to the increased expression in the latter case. While the lowest levels of gene expression were evident in adult males, FtsZ protein was easily detected in proteomic analyses of male worms [49]. In general, the gene expression pattern of ftsZ correlated with bacterial multiplication. The increased bacterial multiplication in the worm during early infection of the mammalian host and embryogenesis is in agreement with an earlier study [4]. These data are consistent with the third- and fourth-stage larval stages, and embryogenesis being particularly sensitive to the effects of antibiotic treatment [4], [51]. This result indicates that ftsZ gene expression could be used as a marker to monitor Wolbachia multiplication in the filarial parasite much like the ftsZ gene in the intracellular bacterium Candidatus Glomeribacter gigasporarum that resides in the mycorrhizal fungus Gigaspora margarita [43].

Molecular studies have established the importance of conserved amino acids in the FtsZ protein that when changed results in ftsZ mutants blocked at different stages of cell division [42], [46], [52][55]. wBm-FtsZ possesses the key residues and conserved GTP-binding pocket required for GTPase activity. Our functional analysis revealed that the GTPase activities of recombinant wBm-FtsZ and Ec-FtsZ are similar, and both proteins are sensitive to the plant alkaloid berberine. Most of the residues in Ec-FtsZ that are thought to bind berberine and inhibit FtsZ GTPase activity are also present in wBm-FtsZ. An earlier detailed study in E. coli determined that the target of this commonly used compound is FtsZ [33]. Plants containing berberine have been used in traditional Chinese and Native American medicine to treat many infectious diseases and the sulfate, hydrochloride and chloride forms are used in Western pharmaceutical medicine as antibacterial agents [56]. It is active against a number of Gram-positive and Gram-negative pathogenic bacteria, including drug resistant Mycobacterium tuberculosis [57] and Staphylococcus aureus [58].

Our experiments in E. coli demonstrate that berberine has both bacteriostatic and bacteriocidal effects. Since filarial Wolbachia remain unculturable, we were unable to evaluate the direct effect of berberine on the endosymbiont. However, following berberine treatment, we did observe reductions in adult female worm and microfilariae motility and microfilariae production. On the other hand, we did not see any effect on male worms, which had the lowest level of wBm-ftsZ gene expression. We examined berberine- and doxycycline-treated worms for Wolbachia load by qPCR analysis and did not observe a significant difference between control and treated parasites. A similar result was also found in a study evaluating the effects of globomycin and doxycycline on filarial Wolbachia, and the authors [59] suggested several possibilities which can also apply to our study, namely: the Wolbachia qPCR assay may not have sufficient sensitivity to detect effects on Wolbachia load over this time frame in nematodes, inhibition of FtsZ is sufficient to affect nematode motility and viability independent of or prior to any effect on Wolbachia load, and/or a direct effect of berberine on nematode motility and viability and alternative mechanisms of action. Nonetheless, our results suggest that FtsZ inhibitors that operate via inhibition of enzyme activity including natural products [28], [30][33], [53] and synthetic molecules [29], [60] may have also activity against wBm-FtsZ.

To complement the berberine studies, a library of naphthalene-, quinoline- and biphenyl-based compounds constructed using Ugi multicomponent reaction chemistry was examined for the discovery of new and ultimately highly specific antagonists of either E. coli or Wolbachia FtsZ. Of interest, compounds based on similar scaffolds have already been demonstrated as potent FtsZ inhibitors [17], [29][33]. From our screening efforts, the (6-{butylcarbamoyl-[(aryl)-(butylcarbonyl)-amino]-methyl})-naphthen-2-ol scaffold (Figure 7A, C) emerged as an antagonist of both E. coli and Wolbachia FtsZ. Interestingly, from basic SAR studies it appears that modification of the aryl substituent on the scaffold may afford selectivity for Wolbachia FtsZ, a key element of our initial goal. Additional compounds are currently being prepared to examine this possibility. Although not discussed here, compounds based on our lead scaffold had no effect on growth or viability in E. coli. Based on these findings and their potency in the in vitro assays, it is plausible that penetrability or metabolism issues are to blame for their attenuated activity. Finally, the solubility of these compounds is also poor precluding measurement of true IC50 values. Further iterations of chemical synthesis will be necessary to address these potential liabilities.

While we have focused on assaying the GTPase activity of wBm-FtsZ using a medium- to high-throughput coupled enzyme assay for the discovery of inhibitors that target cell division in Wolbachia, it is also possible to screen for compounds that would target wBm-FtsZ via other mechanisms of action. FtsZ is considered a distant functional relative of the mammalian cytoskeletal protein β-tubulin [61][63]. Microtubule formation is a major target in cancer chemotherapy and the anticancer drug Taxol binds to β-tubulin and blocks cell division by interfering with microtubule formation. Interestingly, the FtsZ inhibitor PC190723 [60] operates by a similar mechanism and more recently, novel inhibitors of B. subtilis cell division have been identified in an in vitro FtsZ protofilaments polymerization assay [64]. Importantly, significant differences exist in the active sites in tubulin and FtsZ polymers, and several small molecule inhibitors of FtsZ have been identified [65] that do not inhibit tubulin [66][67]. Tubulin is also the target of the broadly anti-parasitic benzimidazole drugs [68][69], which have been used extensively to control soil-transmitted nematodes [70][71].

FtsZ is also responsible for recruiting and coordinating more than a dozen other cell division proteins at the midcell site of the closing septum [18][19], [21], [72]. Many of these interactions are essential and it has been suggested that they might also be useful targets, particularly in light of developments in the discovery of small molecule inhibitors of protein-protein interactions [17], [73][74]. Therefore, it might be feasible to screen for inhibitors of the interactions between wBm-FtsZ and its various binding partners that modulate its polymerization. Another Wolbachia cell division protein worth considering for drug discovery is FtsA, as this protein also possesses enzymatic activity and contains an ATP-binding site that might be targeted with drug-like molecules. Moreover, this protein is essential in E. coli [75] and Streptococcus pneumoniae [76].

In summary, we have investigated the cell division pathway in wBm and determined that it possesses a FtsZ protein with GTPase activity. We demonstrated that the activity is inhibited by berberine and identified small molecule inhibitors in a high-throughput screen. Furthermore, berberine was found to have adverse affects on B. malayi adult worm and microfilariae motility, and reproduction. Our results support the discovery of selective inhibitors of Wolbachia FtsZ as a new therapeutic approach for filariasis.

Acknowledgments

We gratefully acknowledge encouragement and support from New England Biolabs and encouragement from Dr. Donald Comb. We thank Brendan Galvin, William Jack and Catherine Poole for critical reading of the manuscript. Total RNA was obtained through the Filariasis Research Resource Center, Division of Microbiology and Infectious Diseases, NIAID, NIH prepared by Dr. Steven Williams' laboratory.

Footnotes

ALG, CG and KDJ declare no conflict of interests. ZL and CKC are employees of New England Biolabs. The authors' affiliation with the funder does not alter their adherence to all the PLoS Neglected Tropical Diseases policies on sharing data and materials.

This work was supported by New England Biolabs. ZL and CKC are employees of New England Biolabs; this funder is therefore considered by PLoS Neglected Tropical Diseases to have played a role in study design, data collection and analysis; however, the authors confirm that the funder did not play a direct role in the study.

References

  • 1.Taylor MJ, Bandi C, Hoerauf A. Wolbachia bacterial endosymbionts of filarial nematodes. Adv Parasitol. 2005;60:245–284. doi: 10.1016/S0065-308X(05)60004-8. [DOI] [PubMed] [Google Scholar]
  • 2.Kozek WJ. Transovarially-transmitted intracellular microorganisms in adult and larval stages of Brugia malayi. J Parasitol. 1977;63:992–1000. [PubMed] [Google Scholar]
  • 3.Taylor MJ, Bilo K, Cross HF, Archer JP, Underwood AP. 16S rDNA phylogeny and ultrastructural characterization of Wolbachia intracellular bacteria of the filarial nematodes Brugia malayi, B. pahangi, and Wuchereria bancrofti. Exp Parasitol. 1999;91:356–361. doi: 10.1006/expr.1998.4383. [DOI] [PubMed] [Google Scholar]
  • 4.McGarry HF, Egerton GL, Taylor MJ. Population dynamics of Wolbachia bacterial endosymbionts in Brugia malayi. Mol Biochem Parasitol. 2004;135:57–67. doi: 10.1016/j.molbiopara.2004.01.006. [DOI] [PubMed] [Google Scholar]
  • 5.Bandi C, McCall JW, Genchi C, Corona S, Venco L, et al. Effects of tetracycline on the filarial worms Brugia pahangi and Dirofilaria immitis and their bacterial endosymbionts Wolbachia. Int J Parasitol. 1999;29:357–364. doi: 10.1016/s0020-7519(98)00200-8. [DOI] [PubMed] [Google Scholar]
  • 6.Hoerauf A, Specht S, Marfo-Debrekyei Y, Buttner M, Debrah AY, et al. Efficacy of 5-week doxycycline treatment on adult Onchocerca volvulus. Parasitol Res. 2009;104:437–447. doi: 10.1007/s00436-008-1217-8. [DOI] [PubMed] [Google Scholar]
  • 7.Turner JD, Tendongfor N, Esum M, Johnston KL, Langley RS, et al. Macrofilaricidal activity after doxycycline only treatment of Onchocerca volvulus in an area of Loa loa co-endemicity: a randomized controlled trial. PLoS Negl Trop Dis. 2010;4:e660. doi: 10.1371/journal.pntd.0000660. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Mand S, Pfarr K, Sahoo PK, Satapathy AK, Specht S, et al. Macrofilaricidal activity and amelioration of lymphatic pathology in bancroftian filariasis after 3 weeks of doxycycline followed by single-dose diethylcarbamazine. Am J Trop Med Hyg. 2009;81:702–711. doi: 10.4269/ajtmh.2009.09-0155. [DOI] [PubMed] [Google Scholar]
  • 9.Hoerauf A. New strategies to combat filariasis. Expert Rev Anti Infect Ther. 2006;4:211–222. doi: 10.1586/14787210.4.2.211. [DOI] [PubMed] [Google Scholar]
  • 10.Taylor MJ, Makunde WH, McGarry HF, Turner JD, Mand S, et al. Macrofilaricidal activity after doxycycline treatment of Wuchereria bancrofti: a double-blind, randomised placebo-controlled trial. Lancet. 2005;365:2116–2121. doi: 10.1016/S0140-6736(05)66591-9. [DOI] [PubMed] [Google Scholar]
  • 11.Foster J, Ganatra M, Kamal I, Ware J, Makarova K, et al. The Wolbachia genome of Brugia malayi: endosymbiont evolution within a human pathogenic nematode. PLoS Biol. 2005;3:e121. doi: 10.1371/journal.pbio.0030121. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Kumar S, Chaudhary K, Foster JM, Novelli JF, Zhang Y, et al. Mining Predicted Essential Genes of Brugia malayi for Nematode Drug Targets. PLoS ONE. 2007;2:e1189. doi: 10.1371/journal.pone.0001189. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Holman AG, Davis PJ, Foster JM, Carlow CK, Kumar S. Computational prediction of essential genes in an unculturable endosymbiotic bacterium, Wolbachia of Brugia malayi. BMC Microbiol. 2009;9:243. doi: 10.1186/1471-2180-9-243. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Foster JM, Zhang Y, Kumar S, Carlow CK. Mining nematode genome data for novel drug targets. Trends Parasitol. 2005;21:101–104. doi: 10.1016/j.pt.2004.12.002. [DOI] [PubMed] [Google Scholar]
  • 15.Carballido-Lopez R, Errington J. A dynamic bacterial cytoskeleton. Trends Cell Biol. 2003;13:577–583. doi: 10.1016/j.tcb.2003.09.005. [DOI] [PubMed] [Google Scholar]
  • 16.Graumann PL. Cytoskeletal elements in bacteria. Annu Rev Microbiol. 2007;61:589–618. doi: 10.1146/annurev.micro.61.080706.093236. [DOI] [PubMed] [Google Scholar]
  • 17.Lock RL, Harry EJ. Cell-division inhibitors: new insights for future antibiotics. Nat Rev Drug Discov. 2008;7:324–338. doi: 10.1038/nrd2510. [DOI] [PubMed] [Google Scholar]
  • 18.Bi EF, Lutkenhaus J. FtsZ ring structure associated with division in Escherichia coli. Nature. 1991;354:161–164. doi: 10.1038/354161a0. [DOI] [PubMed] [Google Scholar]
  • 19.Margolin W. FtsZ and the division of prokaryotic cells and organelles. Nat Rev Mol Cell Biol. 2005;6:862–871. doi: 10.1038/nrm1745. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Arends SJ, Weiss DS. Inhibiting cell division in Escherichia coli has little if any effect on gene expression. J Bacteriol. 2004;186:880–884. doi: 10.1128/JB.186.3.880-884.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Vollmer W. Targeting the bacterial Z-ring. Chem Biol. 2008;15:93–94. doi: 10.1016/j.chembiol.2008.02.001. [DOI] [PubMed] [Google Scholar]
  • 22.Rastogi N, Domadia P, Shetty S, Dasgupta D. Screening of natural phenolic compounds for potential to inhibit bacterial cell division protein FtsZ. Indian J Exp Biol. 2008;46:783–787. [PubMed] [Google Scholar]
  • 23.Dasgupta D. Novel compound with potential of an antibacterial drug targets FtsZ protein. Biochem J. 2009;423:e1–3. doi: 10.1042/BJ20091226. [DOI] [PubMed] [Google Scholar]
  • 24.Slayden RA, Knudson DL, Belisle JT. Identification of cell cycle regulators in Mycobacterium tuberculosis by inhibition of septum formation and global transcriptional analysis. Microbiology. 2006;152:1789–1797. doi: 10.1099/mic.0.28762-0. [DOI] [PubMed] [Google Scholar]
  • 25.Huang Q, Kirikae F, Kirikae T, Pepe A, Amin A, et al. Targeting FtsZ for antituberculosis drug discovery: noncytotoxic taxanes as novel antituberculosis agents. J Med Chem. 2006;49:463–466. doi: 10.1021/jm050920y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Addinall SG, Small E, Whitaker D, Sturrock S, Donachie WD, et al. New temperature-sensitive alleles of ftsZ in Escherichia coli. J Bacteriol. 2005;187:358–365. doi: 10.1128/JB.187.1.358-365.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Margolin W, Bernander R. How do prokaryotic cells cycle? Curr Biol. 2004;14:R768–770. doi: 10.1016/j.cub.2004.09.017. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Andreu JM, Schaffner-Barbero C, Huecas S, Alonso D, Lopez-Rodriguez ML, et al. The antibacterial cell division inhibitor PC190723 is an FtsZ polymer-stabilizing agent that induces filament assembly and condensation. J Biol Chem. 2010;285:14239–14246. doi: 10.1074/jbc.M109.094722. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Wang J, Galgoci A, Kodali S, Herath KB, Jayasuriya H, et al. Discovery of a small molecule that inhibits cell division by blocking FtsZ, a novel therapeutic target of antibiotics. J Biol Chem. 2003;278:44424–44428. doi: 10.1074/jbc.M307625200. [DOI] [PubMed] [Google Scholar]
  • 30.Beuria TK, Santra MK, Panda D. Sanguinarine blocks cytokinesis in bacteria by inhibiting FtsZ assembly and bundling. Biochemistry. 2005;44:16584–16593. doi: 10.1021/bi050767+. [DOI] [PubMed] [Google Scholar]
  • 31.Domadia P, Swarup S, Bhunia A, Sivaraman J, Dasgupta D. Inhibition of bacterial cell division protein FtsZ by cinnamaldehyde. Biochem Pharmacol. 2007;74:831–840. doi: 10.1016/j.bcp.2007.06.029. [DOI] [PubMed] [Google Scholar]
  • 32.Jaiswal R, Beuria TK, Mohan R, Mahajan SK, Panda D. Totarol inhibits bacterial cytokinesis by perturbing the assembly dynamics of FtsZ. Biochemistry. 2007;46:4211–4220. doi: 10.1021/bi602573e. [DOI] [PubMed] [Google Scholar]
  • 33.Domadia PN, Bhunia A, Sivaraman J, Swarup S, Dasgupta D. Berberine targets assembly of Escherichia coli cell division protein FtsZ. Biochemistry. 2008;47:3225–3234. doi: 10.1021/bi7018546. [DOI] [PubMed] [Google Scholar]
  • 34.O'Neill SL, Pettigrew MM, Sinkins SP, Braig HR, Andreadis TG, et al. In vitro cultivation of Wolbachia pipientis in an Aedes albopictus cell line. Insect Mol Biol. 1997;6:33–39. doi: 10.1046/j.1365-2583.1997.00157.x. [DOI] [PubMed] [Google Scholar]
  • 35.Baldo L, Dunning Hotopp JC, Jolley KA, Bordenstein SR, Biber SA, et al. Multilocus sequence typing system for the endosymbiont Wolbachia pipientis. Appl Environ Microbiol. 2006;72:7098–7110. doi: 10.1128/AEM.00731-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Margalit DN, Romberg L, Mets RB, Hebert AM, Mitchison TJ, et al. Targeting cell division: small-molecule inhibitors of FtsZ GTPase perturb cytokinetic ring assembly and induce bacterial lethality. Proc Natl Acad Sci U S A. 2004;101:11821–11826. doi: 10.1073/pnas.0404439101. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Rao RU, Moussa H, Weil GJ. Brugia malayi: effects of antibacterial agents on larval viability and development in vitro. Exp Parasitol. 2002;101:77–81. doi: 10.1016/s0014-4894(02)00019-x. [DOI] [PubMed] [Google Scholar]
  • 38.Rao R, Well GJ. In vitro effects of antibiotics on Brugia malayi worm survival and reproduction. J Parasitol. 2002;88:605–611. doi: 10.1645/0022-3395(2002)088[0605:IVEOAO]2.0.CO;2. [DOI] [PubMed] [Google Scholar]
  • 39.Xu Y, Shi J, Yamamoto N, Moss JA, Vogt PK, et al. A credit-card library approach for disrupting protein-protein interactions. Bioorg Med Chem. 2006;14:2660–2673. doi: 10.1016/j.bmc.2005.11.052. [DOI] [PubMed] [Google Scholar]
  • 40.Xu Y, Lu H, Kennedy JP, Yan X, McAllister LA, et al. Evaluation of “credit card” libraries for inhibition of HIV-1 gp41 fusogenic core formation. J Comb Chem. 2006;8:531–539. doi: 10.1021/cc0600167. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Scheffers DJ, de Wit JG, den Blaauwen T, Driessen AJ. GTP hydrolysis of cell division protein FtsZ: evidence that the active site is formed by the association of monomers. Biochemistry. 2002;41:521–529. doi: 10.1021/bi011370i. [DOI] [PubMed] [Google Scholar]
  • 42.Lu C, Stricker J, Erickson HP. Site-specific mutations of FtsZ–effects on GTPase and in vitro assembly. BMC Microbiol. 2001;1:7. doi: 10.1186/1471-2180-1-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Anca IA, Lumini E, Ghignone S, Salvioli A, Bianciotto V, et al. The ftsZ gene of the endocellular bacterium ‘Candidatus Glomeribacter gigasporarum’ is preferentially expressed during the symbiotic phases of its host mycorrhizal fungus. Mol Plant Microbe Interact. 2009;22:302–310. doi: 10.1094/MPMI-22-3-0302. [DOI] [PubMed] [Google Scholar]
  • 44.Boberek JM, Stach J, Good L. Genetic evidence for inhibition of bacterial division protein FtsZ by berberine. PLoS One. 2010;5:e13745. doi: 10.1371/journal.pone.0013745. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Tegos G, Stermitz FR, Lomovskaya O, Lewis K. Multidrug pump inhibitors uncover remarkable activity of plant antimicrobials. Antimicrob Agents Chemother. 2002;46:3133–3141. doi: 10.1128/AAC.46.10.3133-3141.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Bi E, Lutkenhaus J. Isolation and characterization of ftsZ alleles that affect septal morphology. J Bacteriol. 1992;174:5414–5423. doi: 10.1128/jb.174.16.5414-5423.1992. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Geissler B, Shiomi D, Margolin W. The ftsA* gain-of-function allele of Escherichia coli and its effects on the stability and dynamics of the Z ring. Microbiology. 2007;153:814–825. doi: 10.1099/mic.0.2006/001834-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Dai K, Xu Y, Lutkenhaus J. Cloning and characterization of ftsN, an essential cell division gene in Escherichia coli isolated as a multicopy suppressor of ftsA12(Ts). J Bacteriol. 1993;175:3790–3797. doi: 10.1128/jb.175.12.3790-3797.1993. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Bennuru S, Meng Z, Ribeiro JM, Semnani RT, Ghedin E, et al. Stage-specific proteomic expression patterns of the human filarial parasite Brugia malayi and its endosymbiont Wolbachia. Proc Natl Acad Sci U S A. 2011;108:9649–9654. doi: 10.1073/pnas.1011481108. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Robin A, Joseleau-Petit D, D'Ari R. Transcription of the ftsZ gene and cell division in Escherichia coli. J Bacteriol. 1990;172:1392–1399. doi: 10.1128/jb.172.3.1392-1399.1990. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Hoerauf A, Nissen-Pahle K, Schmetz C, Henkle-Duhrsen K, Blaxter ML, et al. Tetracycline therapy targets intracellular bacteria in the filarial nematode Litomosoides sigmodontis and results in filarial infertility. J Clin Invest. 1999;103:11–18. doi: 10.1172/JCI4768. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Addinall SG, Bi E, Lutkenhaus J. FtsZ ring formation in fts mutants. J Bacteriol. 1996;178:3877–3884. doi: 10.1128/jb.178.13.3877-3884.1996. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Stricker J, Erickson HP. In vivo characterization of Escherichia coli ftsZ mutants: effects on Z-ring structure and function. J Bacteriol. 2003;185:4796–4805. doi: 10.1128/JB.185.16.4796-4805.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Wang Y, Jones BD, Brun YV. A set of ftsZ mutants blocked at different stages of cell division in Caulobacter. Mol Microbiol. 2001;40:347–360. doi: 10.1046/j.1365-2958.2001.02395.x. [DOI] [PubMed] [Google Scholar]
  • 55.Redick SD, Stricker J, Briscoe G, Erickson HP. Mutants of FtsZ targeting the protofilament interface: effects on cell division and GTPase activity. J Bacteriol. 2005;187:2727–2736. doi: 10.1128/JB.187.8.2727-2736.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.Kong DX, Li XJ, Tang GY, Zhang HY. How many traditional Chinese medicine components have been recognized by modern Western medicine? A chemoinformatic analysis and implications for finding multicomponent drugs. ChemMedChem. 2008;3:233–236. doi: 10.1002/cmdc.200700291. [DOI] [PubMed] [Google Scholar]
  • 57.Gentry EJ, Jampani HB, Keshavarz-Shokri A, Morton MD, Velde DV, et al. Antitubercular natural products: berberine from the roots of commercial Hydrastis canadensis powder. Isolation of inactive 8-oxotetrahydrothalifendine, canadine, beta-hydrastine, and two new quinic acid esters, hycandinic acid esters-1 and -2. J Nat Prod. 1998;61:1187–1193. doi: 10.1021/np9701889. [DOI] [PubMed] [Google Scholar]
  • 58.Yu HH, Kim KJ, Cha JD, Kim HK, Lee YE, et al. Antimicrobial activity of berberine alone and in combination with ampicillin or oxacillin against methicillin-resistant Staphylococcus aureus. J Med Food. 2005;8:454–461. doi: 10.1089/jmf.2005.8.454. [DOI] [PubMed] [Google Scholar]
  • 59.Johnston KL, Wu B, Guimaraes A, Ford L, Slatko BE, et al. Lipoprotein biosynthesis as a target for anti-Wolbachia treatment of filarial nematodes. Parasit Vectors. 2010;3:99. doi: 10.1186/1756-3305-3-99. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 60.Haydon DJ, Stokes NR, Ure R, Galbraith G, Bennett JM, et al. An inhibitor of FtsZ with potent and selective anti-staphylococcal activity. Science. 2008;321:1673–1675. doi: 10.1126/science.1159961. [DOI] [PubMed] [Google Scholar]
  • 61.Lowe J, Amos LA. Crystal structure of the bacterial cell-division protein FtsZ. Nature. 1998;391:203–206. doi: 10.1038/34472. [DOI] [PubMed] [Google Scholar]
  • 62.Nogales E, Wolf SG, Downing KH. Structure of the alpha beta tubulin dimer by electron crystallography. Nature. 1998;391:199–203. doi: 10.1038/34465. [DOI] [PubMed] [Google Scholar]
  • 63.Downing KH. Structural basis for the interaction of tubulin with proteins and drugs that affect microtubule dynamics. Annu Rev Cell Dev Biol. 2000;16:89–111. doi: 10.1146/annurev.cellbio.16.1.89. [DOI] [PubMed] [Google Scholar]
  • 64.Beuria TK, Singh P, Surolia A, Panda D. Promoting assembly and bundling of FtsZ as a strategy to inhibit bacterial cell division: a new approach for developing novel antibacterial drugs. Biochem J. 2009;423:61–69. doi: 10.1042/BJ20090817. [DOI] [PubMed] [Google Scholar]
  • 65.Vollmer W. The prokaryotic cytoskeleton: a putative target for inhibitors and antibiotics? Appl Microbiol Biotechnol. 2006;73:37–47. doi: 10.1007/s00253-006-0586-0. [DOI] [PubMed] [Google Scholar]
  • 66.Lappchen T, Hartog AF, Pinas VA, Koomen GJ, den Blaauwen T. GTP analogue inhibits polymerization and GTPase activity of the bacterial protein FtsZ without affecting its eukaryotic homologue tubulin. Biochemistry. 2005;44:7879–7884. doi: 10.1021/bi047297o. [DOI] [PubMed] [Google Scholar]
  • 67.Lappchen T, Pinas VA, Hartog AF, Koomen GJ, Schaffner-Barbero C, et al. Probing FtsZ and tubulin with C8-substituted GTP analogs reveals differences in their nucleotide binding sites. Chem Biol. 2008;15:189–199. doi: 10.1016/j.chembiol.2007.12.013. [DOI] [PubMed] [Google Scholar]
  • 68.Lubega GW, Prichard RK. Specific interaction of benzimidazole anthelmintics with tubulin from developing stages of thiabendazole-susceptible and -resistant Haemonchus contortus. Biochem Pharmacol. 1991;41:93–101. doi: 10.1016/0006-2952(91)90015-w. [DOI] [PubMed] [Google Scholar]
  • 69.Lacey E. The role of the cytoskeletal protein, tubulin, in the mode of action and mechanism of drug resistance to benzimidazoles. Int J Parasitol. 1988;18:885–936. doi: 10.1016/0020-7519(88)90175-0. [DOI] [PubMed] [Google Scholar]
  • 70.McCracken RO, Lipkowitz KB. Structure-activity relationships of benzothiazole and benzimidazole anthelmintics: a molecular modeling approach to in vivo drug efficacy. J Parasitol. 1990;76:853–864. [PubMed] [Google Scholar]
  • 71.Prichard RK. Markers for benzimidazole resistance in human parasitic nematodes? Parasitology. 2007;134:1087–1092. doi: 10.1017/S003118200700008X. [DOI] [PubMed] [Google Scholar]
  • 72.Weiss DS. Bacterial cell division and the septal ring. Mol Microbiol. 2004;54:588–597. doi: 10.1111/j.1365-2958.2004.04283.x. [DOI] [PubMed] [Google Scholar]
  • 73.Tsao DH, Sutherland AG, Jennings LD, Li Y, Rush TS, 3rd, et al. Discovery of novel inhibitors of the ZipA/FtsZ complex by NMR fragment screening coupled with structure-based design. Bioorg Med Chem. 2006;14:7953–7961. doi: 10.1016/j.bmc.2006.07.050. [DOI] [PubMed] [Google Scholar]
  • 74.Jennings LD, Foreman KW, Rush TS, 3rd, Tsao DH, Mosyak L, et al. Design and synthesis of indolo[2,3-a]quinolizin-7-one inhibitors of the ZipA-FtsZ interaction. Bioorg Med Chem Lett. 2004;14:1427–1431. doi: 10.1016/j.bmcl.2004.01.028. [DOI] [PubMed] [Google Scholar]
  • 75.Donachie WD, Begg KJ, Lutkenhaus JF, Salmond GP, Martinez-Salas E, et al. Role of the ftsA gene product in control of Escherichia coli cell division. J Bacteriol. 1979;140:388–394. doi: 10.1128/jb.140.2.388-394.1979. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 76.Lara B, Rico AI, Petruzzelli S, Santona A, Dumas J, et al. Cell division in cocci: localization and properties of the Streptococcus pneumoniae FtsA protein. Mol Microbiol. 2005;55:699–711. doi: 10.1111/j.1365-2958.2004.04432.x. [DOI] [PubMed] [Google Scholar]

Articles from PLoS Neglected Tropical Diseases are provided here courtesy of PLOS

RESOURCES