Insulin-Like Growth Factor I–Mediated Skeletal Muscle Hypertrophy Is Characterized by Increased mTOR-p70S6K Signaling without Increased Akt Phosphorylation

Abstract

Background

Insulin-like growth factor I (IGF-I) is an anabolic hormone that is known to induce skeletal muscle hypertrophy. However, the signaling pathways mediating IGF-I's hypertrophic effect in vivo are unknown.

Method

The phosphorylation of 46 proteins was investigated by Kinetworks proteomic analysis in the gastrocnemius muscle of transgenic mice overexpressing IGF-I myosin light chain/muscle specific IGF-I (MLC/mIgf-I) and wild-type littermates.

Results

In the hypertrophic muscle of MLC/mIgf-I mice, we observed increased phosphorylation of phosphoinositide-dependent protein kinase 1 (PDK1; 53% increase), the mammalian target of rapamycin (mTOR; 112% increase), and p70 S6 kinase (p70S6K) (254% increase) but no significant change in Akt phosphorylation (4% decrease). Furthermore, we found reduced phosphorylation of MAP kinase kinase 1 and 2 (MEK1/2) (60% decrease) and of mitogen-activated protein kinase kinases 3 and 6 (MKK3/6) (50% decrease) in muscle from transgenic mice, suggesting that the hypertrophic and mitogenic effects of IGF-I are mediated via distinct signaling pathways in skeletal muscle and that inhibition of the mitogen-activated protein (MAP) kinase pathway may be required for the IGF-I–induced hypertrophic effect. Single-fiber analysis revealed a trend toward a higher percentage of the fast twitch fibers (IIb and IIx) in the transgenic mice.

Conclusion

Persistent overexpression of IGF-I in mice skeletal muscle results in hypertrophy, which is likely mediated via the mTOR/p70S6K pathway, potentially via an Akt-independent signaling pathway.

Although insulin-like growth factor I plays a critical role in skeletal muscle differentiation and hypertrophy,^1,2 little is known about the signaling pathways mediating IGF-I–induced hypertrophy in vivo. A murine model of persistent, functional myocyte hypertrophy using a tissue-restricted and fast fiber–specific transgene encoding a locally acting isoform of IGF-I that is expressed specifically in skeletal muscle (MLC/mIgf-I) has been generated and used for aging³ and Duchenne muscular dystrophy studies.⁴ There is a significant increase in muscle mass in the MLC/mIgf-I mice compared with the wild-type litter-mates.³ However, although protein kinase B or Akt activation has been shown to be a major component of how IGF-I mediates cell survival and growth in muscle in vitro,^5–7 Akt phosphorylation in MLC/mIgf-I muscle did not differ from that in control tissue.⁴ This surprising finding prompted us to search for potential mechanisms whereby IGF-I exerts its hypertrophic effect in skeletal muscle.

We have used a multi-immunoblotting proteomics screening technique called Kinetworks to examine the phosphorylation of 46 proteins in the skeletal muscle of MLC/mIgf-I mice. Skeletal muscle was collected when mice were 5 months old, when they are known to have already developed.³

We observed that persistent IGF-I expression in skeletal muscle is associated with increased phosphorylation of the protein kinases phosphoinositide-dependent protein kinase 1 (PDK1), mammalian target of rapamycin (mTOR), and p70S6K, whereas protein kinase B (Akt) phosphorylation was not changed. This observation indicates that the hypertrophic effect of IGF-I may be mediated through the PDK1-mTOR-p70S6K pathway independently of Akt.

Materials and Methods

Mouse Genotyping

Hemizygous MLC/mIgf-I transgenic mice that overexpress rat IGF-I and wild-type controls were obtained from the European Molecular Biology Laboratory (EMBL) laboratory. Protocols governing the use of animals were approved by the review committees of the respective institutions.

Genotyping of MLC/mIgf-I mice was performed using polymerase chain reaction (PCR) of mouse genomic deoxyribonucleic acid (DNA), extracted by incubating mouse tail in a mixture of Chelex (5% w/v), proteinase K (2 μg/μL), and ribonuclease (1 μg/μL), followed by extraction with combined phenol/chloroform/isoamyl alcohol and ethanol precipitation. PCR was carried out using the following primers: upper TTCCTGTCTACAGTGTCTGTG, down GAGCTGACTTTGTAGGCTTCA.

Muscle Lysates

Tissue was homogenized in lysis buffer containing 0.05 M Tris-HCl, pH 7.4, 0.15 M NaCl, 0.25% deoxycholic acid, 1% Nonidet^® P 40, 1 mM ethylenediaminetetraacetic acid (EDTA) supplemented with protease and phosphatase inhibitors. The lysates were centrifuged at 13,000 g at 4°C for 30 minutes, and the supernatants were diluted to 2 mg/mL protein in lysis buffer.

Phosphoprotein Screen

Protein samples from the skeletal muscle of MLC/mIgf-I and wild-type controls were probed for the quantitative phosphorylation of 46 proteins using validated commercial antibodies in the Kinetworks KPSS 4.0 immunoblotting analysis provided by Kinexus Bioinformatics Corporation of Vancouver, British Columbia, Canada. Samples were resolved on 12.5% sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS-PAGE) gels followed by electrophoretic transfer to a thin support membrane. The membranes were then probed with antibody mixes that have been thoroughly validated for their potency and specificity in human, mouse, and rat. Bound antibodies were detected using the ECL Detection System (Amersham Biosciences Corp., Piscataway, NJ). Each sample's immunoblot was scanned at its maximum scan time to ensure that the signal for the strongest immunoreactive protein on the immunoblot is just below saturation. This ensures the detection of minor immunoreactive proteins and accurate quantitation over a 2,000-fold range of linearity. The resulting trace quantity for each band scanned at the maximum scan time was termed the raw data. As the relationship between scan time and band intensity was linear over the quantifiable range of the signal intensity, the raw data from the scans were normalized to 60 seconds (counts per minute [cpm]) for uniformity. To safeguard against inaccuracies in protein determination and protein loading, the cpm was normalized. As an equal amount of protein was applied for each sample, the total signal on each immunoblot should be equal. The normalized cpm was obtained by multiplying the cpm with a scaling factor or “coefficient” so that the sum of each sample's signal was normalized to the average total signal between all samples processed by the same Kinetworks screen. Identification of the detected bands involves a software program called IRIS (Immuno-Reactivity Identification System, Kinexus Bioinformatics Corporation). IRIS was developed using historical data obtained from analysis of diverse samples of different cell lines and tissue. IRIS was species specific because it takes into account the fact that the same protein in different species may have very different mobilities.

Western Blot

This assay was similar to that of the protein screen as described above, except that α-tubulin was used as loading control and for normalization.

Single-Fiber Analysis

A muscle fiber bundle from the gastrocnemius muscle (one transgenic and one wild type) was transferred to a dissection dish containing a relaxing solution at 4°C. Individual fibers were then dissected under a microscope, transferred to a 1.5 mL Ependorff tube, and solubilized in 20 μL of 1% SDS sample buffer. Five percent SDS-PAGE analysis of 104 fibers from each muscle fiber bundle was performed for the determination of the myosin heavy chain (MHC) expression. The gels were fixed with an alcohol acid fixing solution followed by glutaraldehyde crosslinking. The methodology for the silver staining and developing of the SDS-PAGE gels has been described in detail.⁸ The MHC isoforms were identified according to the migration rates and compared with molecular-weight standards for each specific fiber analyzed. Of the 104 fibers analyzed, 94 and 80 fibers were able to be detected on the gel for the MLC/igf-1 and wild-type mice, respectively. Single muscle fibers were used to identify fibers that coexpressed more than one MHC isoform. This allowed us to determine if the fibers were in a transitional state or if they were “pure fibers” (contained only one isoform).

Data Analysis

Western blot data represent the mean ± standard deviation of four mice in each group, and the results were analyzed using Student's t-test. A p value <.05 was considered statistically significant.

Results

Phosphoprotein Screen

To evaluate the expression of a large number of phosphoproteins, we performed Kinetworks protein profiling employing multi-immunoblotting with prevalidated antibodies. Each lane of these immunoblots is probed with cocktails of one to three different antibodies for phosphoproteins. Figure 1 shows examples of the multi-immunoblots of phosphoproteins in the muscle lysates of the wild-type littermates (Figure 1A) and the transgenic mice (Figure 1B). The multiple bands in each lane reflect the expression of each of these target proteins and some unidentified cross-reactive proteins in the samples. Table 1 shows the expression levels of 46 phosphoproteins in the gastrocnemius muscle of MLC/mIgf-I and wild-type mice. Data are presented as percentage change over wild type. The list of kinases with enhanced phosphorylation in the transgenic mice includes those involved in IGF-I signaling (PDK1, mTOR, and p70S6K). As previously reported, Akt phosphorylation was unchanged.⁴ The list of kinases with reduced phosphorylation includes several that are involved in IGF-I signaling (eg, glycogen synthase kinase-3 α and β, I-kappa B kinase β (IKKβ), mitogen-activated protein kinase kinase (MEK1/2, MKK3/6), and members of the protein kinase C (PKC) family. The phosphorylation level of 22 kinases was not altered between the transgenic and wild-type mice.

Figure 1.

Kinetworks KPSS 4.0 phosphoprotein analyses of wild-type (A) and transgenic (B) mouse gastrocnemius muscle. The identities of protein targets are indicated by arrows and numbers. Tg = MLC/mIgf-I transgenic mice.

Table 1. Summary of Phosphoprotein Screen.

Description	% Change
Protein kinases that are up-regulated in IGF-I mice
AMP-activated protein kinase α (T172)	162
Bruton's tyrosine kinase (Y223)	24
Cyclin-dependent kinase 1 (Y15)	9
Etk (BMX) (Y40)	17
Raf (S259) (60)	16
Phosphoinositide-dependent protein kinase 1 (S241)	53
The mammalian target of rapamycin (mTOR) (S2448)	112
p70 S6 kinase (T421/T424)	254
Retinoblastoma protein (S780)	36
Protein kinases that are down-regulated in IGF-I mice
Protein kinase C α/β (T638)	−4
Protein kinase C δ (T505)	−70
Protein kinase θ(T538)	−8
Protein kinase D (protein kinase mu) (S916)	−37
PKC-related kinase 1 (T778)	−29
PKC-related kinase 2 (T816)	−50
Raf (S259) (70)	−10
Protein kinase B (T308)	−4
Glycogen synthase kinase-3 α (S21)	−50
Glycogen synthase kinase-3 β (S9)	−18
I-kappa B kinase β (S181)	−18
Lyn (Y507) (44)	−5
Lyn (Y507) (46)	−13
MAPK/Erk kinase 1/2 (S217/221)	−60
MKK3/6(1) (S189/S207)	−50
Protein kinases that are unaltered in IGF-I mice
elF-4E binding protein (S65) (16)	0
elF-4E binding protein (S65) (17)	0
elF-4E binding protein (S65) (18)	0
CaMKII (T286)	0
Cyclin-dependent kinase 1 (T161)	0
I-kappa B kinase α (S180)	0
MAP kinase–activated protein kinase 2 (T334)	0
MKK6 (2)(S207)	0
MAP kinase interacting kinase 1 (T197/202)	0
p38 MAPK (T180/Y182)	0
p70 S6 kinase (T389)	0
p85 S6 kinase 2 (T412)	0
p85 S6 kinase 2 (T444/S447)	0
90 kDa ribosomal S6 kinases (S380)	0

AMP = adenosine monophosphate; CaMKII = calcium calmodulin-activated protein kinase II; Etk(Bmx) = a member of the Tec family of nonreceptor tyrosine kinases; IGF-I = insulin-like growth factorI; MKK = mitogen-activated protein kinase kinases; MAPK = mitogen-activated protein kinases; PKC = protein kinase C.

Examination of these results reveals additional novel findings; for example, we found increased phosphorylation of Btk and Etk, as well as decreased phosphorylation of IKKβ, src-like tyrosine kinase (Lyn), MKK, and protein kinase D in the IGF-I mice. The above-mentioned kinases have not been implicated in IGF-I signaling. On the other hand, the involvement of seven of these kinases (cyclin-dependent kinase (CDK), extracellular signal-regulated kinases 1 and 2 (ERK1/2), p38 mitogen-activated protein kinases (MAPK), p38 MAPK, p70S6K T389, p90RSK, PKCξ, and PP1) in IGF-I signaling has been previously documented, but their phosphorylation was not altered in MLC/mIgf-I mice.

Validation of the Kinetworks Screen

To verify the Kinetworks results, we performed Western blot analysis for six phosphoproteins (three up-, three down-regulated). Skeletal muscle lysates from four individual IGF-I mice and four wild-type littermates were used for the validation. Western blot experiments (Figure 2 and Table 2) revealed that phosphorylation for adenosine monophosphate-activated protein kinase (AMPK), mTOR, and p70S6K is increased, whereas that of IKKβ, PKCδ, and MEK1/2 is decreased in the MLC/mIgf-I mice, in good agreement with the Kinexus KPSS phosphoprotein screen.

Figure 2.

Validation of phosphoprotein screen by Western blot. Phosphorylation levels of selected protein kinases in the gastrocnemius muscle from transgenic MLC/mIgf-I mice (T) and wild-type mice (W) were analyzed by Western blot.

Table 2. Validation of KPSS Phosphoprotein Screen with Western Blot For Six Selected Kinases.

Description	Western Blot, % Change	KPSS 4.0, % Change
AMPK T172	102 ± 12.5	162
mTOR S2448	77 ± 8.1	112
p70S6K T421/T424	353 ± 12.8	254
IKKβ S181	−36 ± 1.1	−18
PKCδ T505	−77 ± 6.1	−70
MEK1/2 S217/221	−88 ± 2.2	−60

AMPK = adenosine monophophate–activated protein kinase; IKK = I-kappa B kinase; MEK = MAP kinase kinase; mTOR = mammalian target of rapamycin; PKC = protein kinase C.

Single-Fiber MHC

To characterize the impact of persistent overexpression of IGF-I on muscle fiber type, we performed single-fiber analysis of the gastrocnemius muscle of both transgenic and wild-type littermates. The majority of MHC isoforms found in each mouse were a coexpression of IIa/IIx (71.3% and 73.8% for MLC/mIgf-I and wild-type mice, respectively). There was a trend toward the MLC/mIgf-I mouse expressing a higher percentage of the faster fast twitch fibers (IIb, 1.1/0; IIx, 26.6/18.8) compared with the wild-type mouse. Quantitative results are shown in Table 3, and a representative SDS-PAGE of single-fiber analysis is shown in Figure 3.

Table 3. Percent Distribution of Myosin Heavy Chain Isoforms for MLC/mIgf-I and Wild-Type Mice.

MHC Isoform	I	I/IIb	IIb	IIx	IIa/IIx	IIa
MLC/mIgf-I	1.1	0	1.1	26.6	71.3	0
Wild type	0	1.3	0	18.8	73.8	6.3

Figure 3.

Single-fiber analysis of mouse myosin heavy chain. A pictorial representation of the sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS-PAGE) for the MLC/mIgf-I mouse (A) and wild-type mouse (B) demonstrating the different pure and hybrid isoforms that are expressed for the MLC/mIgf-I and wild-type mice, respectively.

Discussion

We used the Kinetworks screening system to systematically analyze the phosphorylation status of 46 kinases in skeletal muscle lysates of IGF-I transgenic mice and wild-type littermate controls. Among the 46 kinases that were analyzed, the phosphorylation levels of 24 of these kinases were either up- or down-regulated, of which 6 kinases were selected for verification by Western blot. Our Western blot data showed a good agreement with the Kinexus KPSS 4.0 screen. Of the 16 down-regulated kinases, 4 had a less than 10% decrease, which is of uncertain biologic significance.

Phosphatidylinositol 3-Kinase/Akt/mTOR/p70S6K Pathway

We observed increased phosphorylation of PDK1 (on serine 241), mTOR (on Ser2448), and p70S6K (on Thr421/424) but no significant change in phosphorylation of Akt in the lysates of IGF-I muscle compared with controls. To our knowledge, this is the first report that IGF-I–mediated skeletal muscle hypertrophy is accompanied by increased phosphorylation of mTOR in vivo. Previous studies using C2C12 cells have shown that the hypertrophic response of cultured myotubes to IGF-I is mediated by Akt, which, in turn, promotes hypertrophy by activating mTOR,⁹ a serine and threonine kinase that regulates muscle cell growth and myogenesis.^10,11 Contrary to these findings obtained using an in vitro system, our data show that long-term overexpression of IGF-I did not increase Akt phosphorylation. It has been shown that activation of Akt promotes the phosphorylation and activation of mTOR,¹⁰ which, in turn, phosphorylates 4E-BP1 and p70S6K. mTOR can be activated by a variety of stimuli, including amino acids, contractile activity, insulin, IGF-I, and other growth factors. In response to insulin, mTOR activation is believed to occur through sequential activation of phosphatidylinositol (PI) 3-kinase, PDK1, and Akt, which has been shown to phos-phorylate mTOR on Ser2448 in vitro.^12,13 However, there is evidence that activation of mTOR by amino acids and contractile activity does not require Akt.^13–15

When activated, mTOR influences translation initiation by at least two distinct mechanisms, the first involving 5′ cap binding via phosphorylation of the eukaryotic initiation factor binding protein (eIF-4E-BP1) and the second involving phosphorylation of p70S6K, which, in turn, phosphorylates the S6 ribosomal protein and allows the up-regulation of a subclass of messenger ribonucleic acids (mRNAs) encoding the translational apparatus.¹⁶ Our observation that the phosphorylation of p70S6K but not 4E-BP1 is enhanced in the IGF-I mice may indicate that the anabolic effect of IGF-I is mediated mainly by the mTOR/p70S6K pathway and that activation of this pathway is Akt independent.

p70S6K is a mitogen-activated serine/threonine kinase that plays a critical role in cell growth and survival.^17–20 IGF-I has been shown to induce Akt-independent phosphorylation and activation of p70S6K (Thr421/Ser424 and Thr389) in intestinal smooth muscle cells.²¹ The involvement of p70S6K in skeletal muscle hypertrophy has been documented in various animal models. Thus, a single bout of high-frequency electrical stimulation results in prolonged phosphorylation of p70S6K, which is associated with hypertrophy.²² Li and colleagues showed that an intraperitoneal injection of desIGF-I increased phosphorylation of p70S6K at Thr421/Ser424 in skeletal muscle.²³ Our observation that Thr421/Ser424 but not Thr389 phosphorylation is increased in skeletal muscle is different from that of smooth muscle cells. The fact that PDK1 phosphorylation is also increased indicates that Thr421/Ser424 phosphorylation may be PDK1 dependent.

MAPK Pathway and Its Interaction with PI3-Kinase/mTOR/p70S6K

It is generally believed that IGF-I, acting through a single receptor, stimulates both proliferation and differentiation and that the mitogenic response is mediated primarily by the Ras/Raf/MAPK pathway and the myogenic response by the PI 3-kinase/p70S6k pathway. However, interactions between these two pathways have been reported. Coolican and colleagues showed that PD098059, an inhibitor of MAPK kinase activation, caused a dramatic enhancement of differentiation, which is accompanied by enhanced p70S6K activity, suggesting that the MAPK pathway is inhibitory to the myogenic response in L6A1 myoblasts.²⁴ In contrast, a recent report² showed that coinfusion of PD-098059 with IGF-I blunted the IGF-I–induced increase in p70S6K phosphorylation and prevented IGF-I–induced hypertrophy.²⁵ These discrepancies might be explained by the differences in the models (isolated cells vs short-term muscle infusion) that were used. Our model differs from the above-mentioned models in that it is characterized by chronic and persistent overexpression of IGF-I in the skeletal muscle. Our data showed decreased phosphorylation of MEK1/2 and MKK3/6, which is accompanied by enhanced phosphorylation of p70S6K in the IGF-I mice. Our data suggest that, at least in our model, IGF-I–induced skeletal muscle hypertrophy is mediated by activation of the mTOR/p70S6K pathway and inhibition of the MAPK pathway. Adi and colleagues showed that IGF-I has a unique biphasic effect on skeletal muscle cell differentiation.²⁶ Initially, IGF-I inhibits differentiation and promotes proliferation of skeletal myoblasts; subsequently, IGF-I stimulates differentiation of these cells. They also showed an early stimulation and late inhibition of ERK1/2 phosphorylation by IGF-I in these cells. These reports appear to be consistent with our findings, although we do not know whether such a biphasic response actually occurred during the development of hypertrophy in MLC/mIgf-I mice.

Adenosine Monophosphate–Activated Protein Kinase

Another novel finding derived from this study is the increased phosphorylation of AMPK in the IGF-I mice. AMPK is a well-conserved eukaryotic protein kinase that is activated by cellular stresses such as heat shock, ischemia, or hypoxia in cardiac muscle, and exercise in skeletal muscle, causing adenosine triphosphate (ATP) depletion, leading to elevation of the adenosine monophosphate (AMP) to ATP ratio.^27,28 In addition to allosteric activation by AMP, AMPK is activated by phosphorylation by an upstream kinase termed AMPK kinase.²⁹ Once activated, AMPK suppresses the key enzymes involved in ATP-consuming anabolic pathways, such as fatty acid and cholesterol synthesis.³⁰ In addition, AMPK initiates a series of compensatory changes that increase cellular ATP supply by activating the rate of fatty acid oxidation³¹ and glucose uptake in cardiac and skeletal muscle.³² Thus, AMPK has been speculated to play a role as a “fuel gauge” that recognizes ATP depletion and maintains the ATP level. It has been shown that activation of AMPK by 5-aminoimidazole-4-carboxamide 1-β-d-ribonucleoside (AICAR), an agonist of AMPK in NIH-3T3 cells, resulted in drastic inhibitions of Ras, Raf-1, and Erk activation induced by IGF-I. Furthermore, injections of AICAR in rats resulted in reduced phosphorylation of Akt on Ser473, mTOR on Ser2448, p70S6K on Thr389, and eukaryotic initiation factor eIF-4E-BP on Thr37. Therefore, the enhanced phosphorylation of AMPK in our MLC/mIGF-I mice might be a negative feedback mechanism as a result of the chronic anabolic action of IGF-I and potentially explain the decrease in MEK1/2 phosphorylation.

Protein Kinase C

Our data revealed decreased expression of phospho-PKCδ on T505 in the IGF mice. To our knowledge, regulation of PKCδ on T505 by IGF-I has not been previously reported. It has been shown that IGF-I induces physical association between the IGF-I receptor and PKCδ in isolated skeletal muscle cells,³³ although the significance of this association is not known. However, it has been shown that insulin induces the tyrosine phosphorylation of PKCδ, which proceeds to induce serine phosphorylation and internalization of the insulin receptor.³³ The significance of reduced phosphorylation of PKCδ on T505 in MLC/mIgf-I mice remains unknown.

I-Kappa B Kinase β

Our data revealed reduced phosphorylation of IKKβ on Ser181 in the MLC/mIgf-I mice. IKKβ is one of the catalytic subunits of the IKK complex involved in the activation of nuclear factor kappa B NF-κB). On phosphorylation on Ser181, IKKβ will phosphorylate I-kappa B (IκB), the inhibitor of NF-κB. When IκB is phosphorylated by IKKβ, IκB is targeted for ubiquitylation and degradation by the proteasome, which frees NF-κB to translocate to the nucleus and activate gene transcription. NF-κB activation has been implicated in tumor necrosis factor (TNF)-α–induced muscle wasting.³⁴ It has been shown that TNF-α–activated NF-κB and interfered with the expression of muscle proteins in differentiating C2C12 cells.³⁵ Undifferentiated C2C12 cells are the in vitro equivalent of satellite cells, which are indispensable for the maintenance of functional muscle. It has been suggested that the inhibition of myogenic differentiation of satellite cells may constitute an important mechanism leading to muscle wasting in chronic inflammatory conditions through impairment of the regeneration process.³⁵ Furthermore, it has been shown that IGF-I can enhance aged muscle regrowth possibly through increased satellite cell proliferation.³⁶ Therefore, our finding that IKKβ phosphorylation is reduced in the MLC/mIgf-I mice suggests that IGF-I inhibition of NF-κB activity could be a mechanism whereby IGF-I exerts its anabolic effect.

Effect of Chronic Expression of IGF-I on Fiber Type

A further interesting finding of this study is that IGF-I over-expression is associated with a trend for increased fast IIb and IIx muscle fibers. This is similar to hypertrophy induced by β₂-adrenoceptor agonists, such as clenbuterol, which have been shown to increase IGF-I mRNA accompanied by a phenotype change in soleus MHCs from slow to fast.³⁷ However, unweighting and passive stretch of skeletal muscle in rabbits^38,39 up-regulate IGF-I mRNA but shift muscle fiber phenotype from fast to slow.

Li and colleagues showed that an intraperitoneal injection of desIGF-I increased phosphorylation of p70S6K at Thr421/Ser424 in skeletal muscle within 20 minutes of injection.²³ Our finding that phosphorylation of S6K at Thr421/Ser424 is increased in the skeletal muscle of IGF-I transgenic mice is consistent with this previous report.²³ The difference between our study and that of Li and colleagues is one of the chronic versus acute responses to IGF-I. The MLC/mIgf-I mice (5 months old) have persistent hypertrophy consistent with the anabolic effects of IGF-I. The chronic IGF-I presence could explain the activation of other genes (such as AMP kinase) that normally counteract mTOR signaling and may not be activated acutely.

In conclusion, the data presented here demonstrate, for the first time, the expression profile of 46 phosphoproteins in hypertrophied mouse skeletal muscle using a quantitative and accurate proteomics screening technique. These normative data may help identify protein kinases present in the skeletal muscle that could be important for the regulatory functions of IGF-I.