Abstract
Obesity is associated with increased monocyte infiltration into adipose tissue and hence increased interaction between adipocytes and monocytes. Although it has been shown that matrix metalloproteinases (MMP) play a critical role in adipose tissue development, the effect of adipocyte and monocyte interaction on MMP production remains largely unknown. Furthermore, although it has been shown that Toll-like receptor 4 (TLR4), a receptor mediating innate immune response, plays an important role in the obesity-associated inflammation and insulin resistance, the effect of TLR4 activation in coculture of adipocytes and monocytes on MMP production has not been investigated. In this study, we cocultured adipocytes with U937 mononuclear cells in a Transwell coculture system and activated TLR4 with lipopolysaccharide or palmitic acid. We found that TLR4 activation and the coculture had a synergistic effect on MMP-1 production. In our further investigation on the underlying mechanisms, it was indicated that adipocyte-derived IL-6 and TLR4 activation acted in concert to synergistically stimulate MMP-1 expression by U937 cells. Taken together, this study has uncovered a novel mechanism potentially involved in MMP-1 up-regulation in adipose tissue, which may facilitate adipose tissue development and obesity.
Development of adipose tissue is a multifaceted process involving not only adipocyte differentiation but also angiogenesis and tissue remodeling (1, 2). Given that matrix metalloproteinases (MMP) play an important role in angiogensis (3) and connective tissue remodeling (4, 5), MMP are considered to be essential for development of adipose tissue (6). Indeed, findings from a large number of investigations support this conclusion (7, 8). In the literature, the animal studies provided strongest evidence because they showed that the deficiency of MMP changed adipose tissue development (9) and that the treatment of mice with MMP inhibitors impaired adipose tissue development (10). Additionally, it has been also demonstrated that as the result of overdevelopment of adipose tissue, obesity is associated with up-regulation of MMP expression in adipose tissue in mice (11).
An important finding from obesity research is that obesity is associated with increased monocyte infiltration into adipose tissue (12, 13). Evidently, increased content of monocytes in the adipose tissue leads to increased interaction between monocytes and adipocyte. Furthermore, in vitro studies have demonstrated that coculture of adipocytes with monocytes changes the expression of proinflammatory genes and thus exerts impact on the inflammatory state in adipose tissue (14, 15). Suganami et al. (14) have reported that the coculture of adipocytes with monocytes resulted in the activation of nuclear factor-κB (NFκB), a transcription factor involved in the expression of proinflammatory genes. Our group has also reported recently that adipocyte-mononuclear cell interaction up-regulates the expression of osteopontin, a multifunctional protein involved in inflammation (15). Although MMP are believed to play an important role in adipose tissue development, the effect of interaction between adipocytes and monocytes on MMP expression has not been well studied. Furthermore, although recent studies have indicated that Toll-like receptor 4 (TLR4) is important in the obesity-related inflammation (16, 17), it remains unclear how TLR4 activation in both adipocytes and mononuclear cells in their coculture affects MMP expression.
In the present study, we demonstrated that the coculture of adipocytes and U937 mononuclear cells increased MMP-1 expression through an IL-6-mediated mechanism. More importantly, we demonstrated that TLR4 activation acts in concert with the interaction between adipocytes and U937 cells to further augment MMP-1 expression.
Materials and Methods
Cell culture
Human preadipocytes isolated from human adipose tissue in pericardiac fat, preadipocyte growth medium, and adipocyte differentiation medium were purchased from Cell Applications, Inc. (San Diego, CA). For adipocyte differentiation, 2-d postconfluent preadipocytes were treated with adipocyte differentiation medium for 10 d. The medium was changed every 2 d. After differentiation, the conversion of preadipocytes to adipocytes was confirmed by Oil Red O staining. U937 mononuclear cells (18) (American Type Culture Collection, Manassas, VA) were cultured in a 5% CO2 atmosphere in RPMI 1640 medium containing 10% fetal calf serum, 1% MEM nonessential amino acid solution, and 0.6 g/100 ml HEPES. A stock solution containing 5 mm palmitate and 10% BSA was prepared as described previously (19). The cells were challenged with 100 ng/ml lipopolysaccharide (LPS) or 100 μm palmitic acid (Sigma Chemical Co., St. Louis, MO) for 24 h. Human monocytes were isolated as described previously (20) from blood obtained from healthy donors and differentiated into macrophages [human monocyte-derived macrophages (HMDM)] by treatment of monocytes with 30% human serum for 10 d. The treatment of HMDM with LPS or palmitic acid was the same as that of U937 cells. For coculture, adipocytes and U937 cells or HMDM were grown in 12-well Corning Transwell plates (Fisher Scientific, Pittsburgh, PA). Adipocytes were grown to confluence (about 2 × 105 cells per well) in the lower compartment, and U937 cells or HMDM were cultured (1 × 106 per well) in the upper compartment. Goat antihuman IL-6, IL-1α, IL-1β, and TNFα antibodies were purchased from R&D System (Minneapolis, MN), and the neutralization experiments were performed with these antibodies at the concentration of 1 μg/ml. Goat IgG was used as control antibody.
Enzyme-linked immunosorbent assay
MMP-1 and IL-6 in conditioned medium was quantified using sandwich ELISA kits according to the protocols provided by the manufacturers (R&D Systems) and BioLegend (San Diego, CA), respectively.
Real-time polymerase chain reaction
Total RNA was isolated from cells using the RNeasy minikit (QIAGEN, Santa Clarita, CA). First-strand cDNA was synthesized with the iScript cDNA synthesis kit (Bio-Rad Laboratories, Hercules, CA). The Beacon designer software (PREMIER Biosoft International, Palo Alto, CA) was used for primer designing (MMP-1, forward primer sequence CTGGGAAGCCATCACTTACCTTGC and reverse primer sequence GTTTCTAGAGTCGCTGGGAAGCTG). Primers were synthesized by Integrated DNA Technologies, Inc. (Coralville, IA), and real-time PCR was performed in duplicate using 25 μl reaction mixture containing 1.0 μl reverse transcription mixture, 0.2 μm of both primers, and 12.5 μl iQ SYBR Green Supermix (Bio-Rad). Real-time PCR was run in the iCycler real-time detection system (Bio-Rad) with a two-step method. The hot-start enzyme was activated (95 C for 3 min), and cDNA was then amplified for 40 cycles consisting of denaturation at 95 C for 10 sec and annealing/extension at 53 C for 45 sec. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as a control (forward primer sequence GAATTTGGCTACAGCAACAGGGTG; reverse primer sequence: TCTCTTCCTCTTGTGCTCTTGCTG).The average starting quantity (SQ) of fluorescence units was used for analysis. Quantification was calculated using the SQ of targeted cDNA relative to that of GAPDH cDNA in the same sample.
Transfection of adipocytes with small interfering RNA (siRNA)
Human adipocytes or U937 cells were transfected with 20–100 nm stealth siRNA directed against IL-6 (CAGACAGCCACUCACCUCUUCAGAA) (GenBank accession number NM 000600) or control siRNA (CAGGACCCACUCAUCUCCUACAGAA) using Lipofectamine RNAi MAX (Life Technologies Corp., Carlsbad, CA) as transfection reagent according to the manufacturer's instruction. After 48 h transfection, transfected adipocytes were cocultured with untransfected U937 cells or transfected U937 cells were cocultured with untransfected adipocytes.
PCR array
The first-strand cDNA was synthesized from RNA using RT2 First Strand Kit (SuperArray Bioscience Corp., Frederick, MD). Human extracellular matrix (ECM)/adhesion molecule PCR array (catalog item PAHS-013; SuperArray Bioscience) was used to profile the MMP expression.
Signaling pathway inhibition study
Adipocytes were treated with 100 ng/ml LPS for 24 h, and conditioned medium was then collected. U937 cells were incubated with 50% fresh medium and 50% adipocyte-conditioned medium in the absence or presence of different signaling pathway inhibitors for 24 h. After the treatment, MMP-1 released in the culture medium was quantified using ELISA.
Statistical analysis
Data were presented as mean ± sd. Student's t tests were performed to determine the statistical significance of cytokine expression among different experimental groups. A value of P < 0.05 was considered significant.
Results
Marked changes of collagen and MMP expression after adipocyte differentiation
Gene expression profiling analysis showed that there were remarkable changes of collagen and MMP expression after adipocyte differentiation (Table 1). Several types of collagen such as collagen IV, VIII, XI, XII, and XV were increased by 6- to 10-fold, whereas other types of collagen such as collagen VII and XIV were decreased by 60–80%. Interestingly, MMP-1, MMP-3, MMP-9, MMP-12, MMP-10, and MMP-16 were significantly decreased, whereas MMP-15, MMP-8, MMP-11, and MMP13 were increased. The remarkable changes of collagen and MMP expression suggest the involvement of collagens and MMP in adipocyte differentiation.
Table 1.
The effect of adipocyte differentiation on collagen and MMP expression
| Collagens and MMP | Preadipocytes | Differentiated adipocytes |
|---|---|---|
| Collagen 4α2 | 1.0 (24.7) | 10.6 (21.3) |
| Collagen 11α1 | 1.0 (31.1) | 10.6 (27.7) |
| Collagen 12α1 | 1.0 (24.7) | 7.0 (21.9) |
| Collagen 8α1 | 1.0 (30.4) | 6.7 (27.6) |
| Collagen 15α1 | 1.0 (26.1) | 8.6 (23.0) |
| Collagen 14α1 | 1.0 (28.5) | 0.4 (30.0) |
| Collagen 7α1 | 1.0 (27.9) | 0.2 (30.3) |
| MMP-1 | 1.0 (20.8) | 0.005 (28.4) |
| MMP-3 | 1.0 (19.1) | 0.008 (26.1) |
| MMP-12 | 1.0 (25.6) | 0.01 (31.9) |
| MMP-10 | 1.0 (29.5) | 0.04 (34.2) |
| MMP-16 | 1.0 (25.7) | 0.09 (29.2) |
| MMP-15 | 1.0 (38.6) | 97.0 (32.0) |
| MMP-8 | 1.0 (31.7) | 4.0 (29.7) |
| MMP-11 | 1.0 (29.1) | 3.0 (27.5) |
| MMP-13 | 1.0 (33.8) | 2.0 (32.8) |
The expression of collagens and MMP in preadipocytes was designated as 1.0, and the expression of collagens and MMP in differentiated adipocytes was expressed as fold of that in preadipocytes. The numbers in the parentheses are threshold cycles that are inversely correlated to the expression level of the gene. The data presented are averages of two experiments.
Adipocyte/U937 mononuclear cell interaction and TLR4 activation synergistically increase MMP-1 secretion
To determine the effect of adipocyte and mononuclear cell interaction and TLR4 activation on MMP-1 secretion, adipocytes and U937 mononuclear cells were cultured independently or together in a two-chamber Transwell system in the absence or presence of 10 or 100 ng/ml LPS for 24 h. Results showed that in the absence of LPS, the amount of MMP-1 secreted from adipocytes was very low, which is consistent with the finding in Table 1, and the coculture of adipocytes and U937 cells led to a significant increase in MMP-1 secretion compared with the individual culture of adipocytes or U937 cells (Fig. 1A). Interestingly, although LPS increased MMP-1 secretion from independent adipocyte or U937 cell culture, it stimulated more MMP-1 secretion from the coculture of adipocytes and U937 cells than the sum of MMP-1 from independent cultures of adipocytes and U937 cells (Fig. 1A), revealing a synergistic effect of TLR4 activation and coculture of adipocytes and U937 cells on MMP-1 secretion.
Fig. 1.
The effect of adipocyte/mononuclear cell coculture and TLR4 activation on MMP expression. A–C, The effect of adipocyte/U937 mononuclear cell coculture and LPS on MMP-1 (A), MMP-9 (B), and MMP-2 (C) secretion. Independent culture of human adipocytes or U937 cells and coculture of adipocytes and U937 cells were treated with or without 100 ng/ml LPS for 24 h, and MMP-1, MMP-9, and MMP-2 in culture medium were then quantified using ELISA. D, The effect of adipocyte/U937 mononuclear cell coculture and palmitic acid on MMP-1 secretion. Independent culture of human adipocytes or U937 cells and coculture of adipocytes and U937 cells were treated with or without 100 μm palmitic acid for 24 h, and MMP-1 in culture medium was then quantified using ELISA. E, The effect of coculture of adipocytes and monocyte-derived macrophages and TLR4 activation by LPS or palmitic acid on MMP-1 secretion. Independent culture of human adipocytes or monocyte-derived macrophages and coculture of adipocytes and monocyte-derived macrophages were treated with or without 100 ng/ml LPS or 100 μm palmitic acid for 24 h, and MMP-1 in culture medium was then quantified using ELISA. The data are mean ± sd from three experiments.
Exposure of the coculture of adipocytes and U937 cells to LPS also increased MMP-9 secretion compared with MMP-9 secretion by U937 cells alone (Fig. 1B). In contrast, although the basal secretion of MMP-2 by adipocytes was much higher than MMP-1, no increase was observed in the coculture of adipocytes and U937 cells or by LPS stimulation (Fig. 1C).
Activation of TLR4 with palmitic acid and the coculture of adipocytes and U937 cells also have synergistic effect on MMP-1 secretion
Because it has been shown that increased circulating palmitic acid is associated with obesity (21), we used palmitic acid, another TLR4 agonist (22), to activate TLR4. Results showed that similar to LPS, palmitic acid also significantly increased MMP-1 secretion by the coculture of adipocytes and U937 cells (Fig. 1D).
The mRNA expression of MMP and tissue inhibitors of metalloproteinase (TIMP) in adipocytes and U937 cells after they were cocultured in the absence or presence of LPS or palmitic acid was further investigated using the PCR arrays. Results showed that LPS and coculture synergistically up-regulated MMP-12 and MMP-10 mRNA expression in adipocytes and MMP-1, MMP-8, and MMP-9 mRNA expression in U937 cells (Table 2). Results also showed that palmitic acid and coculture synergistically up-regulated MMP-1, MMP-12, and MMP-8 expression in adipocytes and MMP-1 expression in U937 cells (Table 3).
Table 2.
Regulation of MMP and TIMP expression in adipocytes and U937 cells by their coculture and/or LPS
| No treatment | LPS | Coculture | LPS and coculture | |
|---|---|---|---|---|
| Adipocytes | ||||
| MMP-12 | 1.0 (31.9) | 24.3 (27.3) | 1.2 (31.6) | 34.3 (26.8) |
| MMP-10 | 1.0 (34.2) | 6.1 (31.6) | 0.6 (34.9) | 21.1 (29.8) |
| MMP-1 | 1.0 (28.4) | 6.1 (25.8) | 1.7 (27.6) | 9.2 (25.2) |
| MMP-3 | 1.0 (26.1) | 4.0 (24.1) | 0.8 (26.5) | 4.6 (23.9) |
| MMP-2 | 1.0 (21.9) | 1.1 (21.7) | 0.8 (22.3) | 1.1 (21.8) |
| MMP-8 | 1.0 (29.7) | 0.5 (30.7) | 0.3 (31.6) | 0.2 (32.3) |
| MMP-11 | 1.0 (27.5) | 0.6 (28.2) | 0.5 (28.5) | 0.3 (29.3) |
| TIMP-1 | 1.0 (20.5) | 1.5 (19.9) | 0.9 (20.7) | 1.9 (19.6) |
| TIMP-2 | 1.0 (22.4) | 0.9 (22.6) | 0.6 (23.2) | 0.5 (23.5) |
| GAPDH (housekeeping gene) | 1.0 (22.2) | 1.0 (22.2) | 0.8 (22.6) | 0.8 (22.5) |
| U937 cells | ||||
| MMP-1 | 1.0 (27.6) | 13.9 (23.8) | 1.4 (27.1) | 18.4 (22.4) |
| MMP-8 | 1.0 (31.6) | 7.5 (28.7) | 0.9 (31.8) | 13.9 (27.8) |
| MMP-9 | 1.0 (27) | 7.0 (24.2) | 1.5 (26.4) | 10.6 (23.6) |
| MMP-2 | 1.0 (24.8) | 1.1 (25.0) | 1.3 (25.2) | 1.2 (25.0) |
| MMP-14 | 1.0 (32.3) | 1.2 (32.0) | 0.5 (33.2) | 1.5 (31.7) |
| TIMP-1 | 1.0 (20.9) | 0.8 (21.2) | 0.8 (21.2) | 0.9 (21.0) |
| TIMP-2 | 1.0 (25.2) | 0.8 (25.6) | 0.8 (25.6) | 0.9 (25.3) |
| GAPDH (housekeeping gene) | 1.0 (20.7) | 0.9 (20.8) | 0.8 (21.0) | 1.0 (20.7) |
Adipocytes or U937 cell independent cultures or their cocultures were treated with or without 100 ng/ml LPS for 24 h, and the mRNA expression of MMP and TIMP was quantified with the PCR array analysis. The data are presented as fold of that by independent culture of adipocytes or U937 cells without LPS treatment, which was designated as 1.0. The numbers in parentheses are threshold cycles that are inversely correlated to mRNA expression level. The data presented are averages of two experiments.
Table 3.
Regulation of MMP and TIMP expression in adipocytes and U937 cells by their coculture or/and palmitic acid
| No treatment | Palmitic acid | Coculture | Palmitic acid and coculture | |
|---|---|---|---|---|
| Adipocytes | ||||
| MMP-12 | 1.0 (30.2) | 1.0 (30.2) | 1.4 (29.7) | 6.1 (27.6) |
| MMP-10 | 1.0 (30.7) | 16.0 (26.7) | 3.0 (29.1) | 7.5 (27.8) |
| MMP-1 | 1.0 (30.3) | 3.7 (28.4) | 12.1 (26.7) | 29.9 (25.4) |
| MMP-3 | 1.0 (26.9) | 2.0 (25.9) | 2.1 (25.8) | 4.6 (24.7) |
| MMP-2 | 1.0 (22.3) | 1.3 (21.9) | 2.3 (21.1) | 2.5 (21.0) |
| MMP-8 | 1.0 (29.8) | 0.9 (30.0) | 1.5 (29.2) | 4.6 (27.6) |
| MMP-11 | 1.0 (27.0) | 1.1 (26.8) | 2.1 (25.9) | 2.5 (25.7) |
| TIMP-1 | 1.0 (21.0) | 1.4 (20.5) | 1.9 (20.1) | 3.0 (19.4) |
| TIMP-2 | 1.0 (21.0) | 1.1 (20.8) | 1.1 (20.8) | 1.1 (20.8) |
| GAPDH (housekeeping gene) | 1.0 (20.6) | 1.1 (20.5) | 1.5 (20.0) | 1.5 (20.0) |
| U937 cells | ||||
| MMP-1 | 1.0 (27.6) | 2.8 (26.1) | 1.4 (27.1) | 4.6 (25.4) |
| MMP-8 | 1.0 (27.0) | 1.9 (26.1) | 1.2 (26.7) | 1.9 (26.1) |
| MMP-9 | 1.0 (25.7) | 1.9 (24.8) | 1.1 (25.5) | 1.7 (24.9) |
| MMP-2 | 1.0 (24.5) | 1.5 (23.9) | 1.1 (24.4) | 1.1 (24.4) |
| MMP-14 | 1.0 (29.0) | 0.9 (29.1) | 1.6 (28.3) | 0.7 (29.5) |
| TIMP-1 | 1.0 (20.8) | 1.2 (20.5) | 1.2 (20.5) | 1.1 (20.6) |
| TIMP-2 | 1.0 (23.7) | 1.3 (23.3) | 0.9 (23.8) | 1.1 (23.6) |
| GAPDH (housekeeping gene) | 1.0 (17.0) | 1.4 (16.5) | 1.7 (16.2) | 1.4 (16.5) |
Adipocytes or U937 cell independent cultures or their cocultures were treated with or without 100 μm palmitic acid for 24 h, and the mRNA expression of MMP and TIMP was quantified with the PCR array analysis. The data are presented as fold of that by independent culture of adipocytes or U937 cells without palmitic acid treatment, which was designated as 1.0. The numbers in the parentheses are threshold cycles that are inversely correlated to mRNA expression level. The data presented are averages of two experiments.
Activation of TLR4 with LPS or palmitic acid and the coculture of adipocytes and human macrophages have synergistic effect on MMP-1 secretion
In these experiments, U937 cells were replaced by HMDM to determine whether the above findings obtained from U937 cells can be also observed in HMDM. Results showed that in the absence of LPS or palmitic acid, the coculture of adipocytes and HMDM released more MMP-1 than total MMP-1 released by independent cultures of adipocytes and HMDM (Fig. 1E). In the presence of LPS or palmitic acid, the coculture of adipocytes and HMDM also released more MMP-1 than total MMP-1 released by independent cultures of adipocytes and HMDM. These results indicate that the coculture of adipoyctes and U937 cells had a similar response to TLR4 activation as the coculture of adipocytes and HMDM.
Treatment of coculture of adipocytes and U937 cells with LPS stimulates MMP-1 mRNA expression in U937 cells but not adipocytes
To determine whether adipocytes, U937 cells, or both contribute to increased MMP-1 production in the coculture system in response to LPS, we quantified MMP-1 mRNA after treatment of coculture of adipocytes and U937 cells with or without LPS. Results showed that LPS and coculture of adipocytes and U937 cells synergistically stimulated MMP-1 secretion (Fig. 2A). Interestingly, real-time PCR analysis of MMP-1 mRNA expression showed that MMP-1 mRNA expression by U937 cells in the coculture system was increased tremendously in response to LPS, whereas the increase in MMP-1 mRNA expression by adipocytes in the coculture system was negligible (Fig. 2B). There data strongly indicate that U937 cells, but not adipocytes, are the predominant contributor for MMP-1 production in the coculture system.
Fig. 2.
Up-regulation of MMP-1 mRNA expression in U937 cells by coculture of adipocytes and U937 cells and LPS. Human adipocytes and U937 cells were cultured independently or together in a Transwell coculture system in the presence or absence of 100 ng/ml LPS for 24 h. After the treatment, MMP-1 in culture medium of the independent cultures of adipocytes or U937 mononuclear cells or the coculture of adipocytes and U937 cells (A) and MMP-1 mRNA in adipocytes and U937 cells of their independent cultures or coculture (B) were quantified using ELISA and real-time PCR, respectively. The data are mean ± sd from two experiments. Adip, Adipocyte.
Inhibition of LPS-stimulated MMP-1 production in the coculture system by IL-6-neutralizating antibody
The findings shown in Fig. 2 suggest that soluble factors released by adipocytes may stimulate MMP-1 mRNA expression in U937 cells in the coculture of adipocytes and U937 cells. Because it is well known that adipocytes release proinflammatory cytokines (23) that are capable of stimulating MMP-1 expression (24), we applied cytokine-neutralizing antibodies to the coculture of adipocytes and U937 cells to determine which proinflammatory cytokine was involved in the stimulation. Results showed that although IL-1α-, IL-1β-, or TNFα-neutralizing antibody had no effect on LPS-stimulated MMP-1 secretion, the addition of IL-6-neutralizing antibody significantly inhibited MMP-1 secretion (Fig. 3A), suggesting that IL-6 released by adipocytes may contribute to the increased MMP-1 secretion in the coculture system.
Fig. 3.
The inhibition of MMP-1 secretion from the coculture of adipocytes and U937 cells by IL-6-neutralizing antibody and IL-6 siRNA. A, The coculture of adipocytes and U937 cells was treated with or without 100 ng/ml LPS in the presence or absence of 1 μg/ml IL-1α-, IL-1β-, IL-6-, or TNFα-neutralizing antibody for 24 h. After the treatment, MMP-1 in culture medium was quantified using ELISA. The data are mean ± sd from two experiments. Ab, Antibody; Ctr, control. B, Adipocytes were transfected with control siRNA or IL-6 siRNA. Forty-eight hours after the transfection, adipocytes were treated with or without 100 ng/ml LPS for 24 h. After the treatment, IL-6 in culture medium was quantified using ELISA. C, Comparison of MMP-1 secretion among untransfected adipocytes, adipocytes transfected with control siRNA (ctr siRNA), and those transfected with IL-6 siRNA in the absence or presence of 100 ng/ml LPS. D, Adipocytes transfected with control siRNA or IL-6 siRNA were cocultured with U937 cells in the presence or absence of 100 ng/ml LPS for 24 h. After the treatment, MMP-1 in the culture medium was quantified using ELISA. For control, adipocytes and U937 cells were cultured independently in the presence or absence of LPS for 24 h. E, U937 cells were transfected with control siRNA or IL-6 siRNA. Forty-eight hours after the transfection, U937 cells were treated with or without 100 ng/ml LPS for 24 h. After the treatment, IL-6 in culture medium was quantified using ELISA. F, U937 cells transfected with control siRNA or IL-6 siRNA were cocultured with adipocytes in the presence or absence of 100 ng/ml LPS for 24 h. After the treatment, MMP-1 in the culture medium was quantified using ELISA. For control, adipocytes and U937 cells were cultured independently in the presence or absence of LPS for 24 h. The data are mean ± sd from two independent experiments.
The inhibition of IL-6 expression by siRNA in adipocytes reduces MMP-1 secretion in the coculture of adipocytes and U937 cells
To confirm the involvement of IL-6 released by adipocytes in increased MMP-1 secretion by the coculture system, we knocked down the IL-6 expression in adipocytes using IL-6 siRNA. Results showed that transfection of adipocytes with IL-6 siRNA inhibited IL-6 secretion in the absence and presence of LPS by 85 and 60%, respectively (Fig. 3B). Results also showed that transfection of IL-6 siRNA in adipocytes did not significantly change MMP-1 secretion when compared with untransfected adipocytes and those transfected with control siRNA (Fig. 3C). Furthermore, data from MMP-1 quantification showed that compared with the transfection with control siRNA, transfection with IL-6 siRNA in adipocytes reduced MMP-1 secretion from the coculture of adipocytes and U937 cells in the absence and presence of LPS by 55 and 40%, respectively (Fig. 3D). Furthermore, we found that the IL-6 knockdown in U937 cells by siRNA did not reduce MMP-1 secretion from the cocuture of adipocytes and U937 cells significantly in the absence or presence of LPS (Fig. 3, E and F), suggesting that IL-6 released by adipocytes, but not U937 cells, plays a major role in up-regulation of MMP-1 by coculture of adipocytes and U937 cells.
IL-6 and LPS have a synergistic effect on MMP-1 secretion by U937 cells
In this study, U937 cells were treated with IL-6, LPS, or both for 24 h, and results showed that IL-6 and LPS had a synergistic effect on MMP-1 secretion (Fig. 4A). Thus, these results support the hypothesis that IL-6 released from adipocytes acted in concert with TLR4 activation in U937 cells to stimulate MMP-1 expression.
Fig. 4.
Synergistic effect of IL-6 and LPS on MMP-1 secretion from U937 cells (A) and stimulation of IL-6 secretion by adipocyte/U937 mononuclear cell coculture and LPS (B). A, U937 cells were treated with 10 ng/ml IL-6, 100 ng/ml LPS, or both for 24 h, and MMP-1 in culture medium was then quantified using ELISA. The data presented are mean ± sd of three experiments. B, Human adipocytes and U937 cells were cultured independently or together in a Transwell coculture system in the presence or absence of 100 ng/ml LPS for 24 h. After the treatment, IL-6 in culture medium was quantified using ELISA. The data are mean ± sd from three experiments.
Increased IL-6 secretion by the coculture of adipocytes and U937 cells and treatment with LPS
To further understand how IL-6 released by adipocytes contributed to augment MMP-1 secretion by the coculture of adipocytes and U937 cells, we quantified IL-6 released by independent culture of adipocytes or U937 cells and the coculture of adipocytes and U937 cells. Results showed that the basal IL-6 secretion by adipocytes was higher than that by U937 cells, and the coculture of adipocytes and U937 cells had a synergistic effect on IL-6 secretion (Fig. 4B). Moreover, although LPS increased IL-6 secretion by independent culture of adipocytes or U937 cells, it further increased IL-6 secretion by the coculture of adipocytes and U937 cells (Fig. 4B).
MAPK signaling pathways mediate coculture-stimulated MMP-1 secretion
It is known that IL-6 stimulated gene expression through both Janus kinase (JAK)-signal transducer and activator of transcription 3 (STAT3) and MAPK pathways (24). To determine which signaling pathway mediates the coculture-stimulated MMP-1 expression, we collected conditioned medium from adipocytes after 24 h incubation and treated U937 cells with the conditioned medium in the absence or presence of specific inhibitors of JAK-STAT3 and MAPK pathways. Results showed that although the addition of adipocyte-conditioned medium markedly increased MMP-1 secretion by U937 cells, the presence of PD98059 (ERK pathway inhibitor), SB203580 (p38 MAPK pathway inhibitor), or SP600125 [c-Jun N-terminal kinase (JNK) pathway inhibitor] significantly inhibited MMP-1 secretion (Fig. 5). In contrast, piceatannol (JAK-STAT3 pathway inhibitor) did not inhibit MMP-1 secretion. Interestingly, AG490 (JAK-STAT3 and JAK-STAT1 pathway inhibitor) and Bay117082 (NFκB pathway inhibitor) increased MMP-1 secretion. This blocking study indicates that MAPK pathways, including ERK, p38, and JNK cascades, mediate a positive regulation of MMP-1 expression by IL-6, whereas JAK-STAT3 and NFκB pathways may mediate a negative regulation of MMP-1 expression by IL-6.
Fig. 5.
Inhibition of basal and adipocyte-conditioned medium-stimulated MMP-1 secretion from U937 cells by signaling pathway inhibitors. Adipocytes were treated with 100 ng/ml LPS for 24 h, and medium was collected afterward. U937 cells were then cultured with either 100% fresh medium or 50% fresh medium plus 50% adipocyte-conditioned medium in the presence or absence of different inhibitors of signaling pathways including 10 μm PD98059 (PD), 10 μm SB203580 (SB), 10 μm SP600125 (SP), 10 μm AG490 (AG), 10 μm piceatannol (PI), or 1 μm Bay117082 for 24 h. After the treatment, MMP-1 in culture medium was quantified using ELISA. The data presented are from one of two independent experiments with similar results.
Discussion
The most important finding from this study is that IL-6 released by adipocytes played an essential role in the stimulation of MMP-1 expression by U937 cells in the coculture. As illustrated in Fig. 6, in the absence of LPS or palmitic acid, coculture of adipocytes and U937 cells increased IL-6 secretion by adipocytes and U937 cells, leading to augmentation of MMP-1 secretion by U937 cells. In the presence of LPS or palmitic acid, IL-6 secretion by adipocytes and U937 cells in the coculture is further increased. The increased IL-6 concentration in the culture medium and TLR4 activation of U937 cells exert a synergistic effect on MMP-1 expression by U937 cells, resulting in a remarkable increase in MMP-1 secretion.
Fig. 6.
Illustration of the mechanisms involved in the synergistic effect of TLR4 activation and adipocyte/U937 cell coculture on MMP-1 expression.
Our gene expression profiling showed that several types of collagen such as collagen 4, 8, 11, 12, and 15 were up-regulated during adipocyte differentiation (Table 1). Accompanying these changes, several MMP such as MMP-1, -3, -9, -12, and -10 were down-regulated. These findings, therefore, indicate that the process for adipocyte differentiation requires collagen as the components of ECM. Interestingly, although the expression of MMP-1 was markedly low in differentiated adipocytes as shown in our study (Table 1), it has been reported that MMP-1 is highly expressed in human adipose tissue (25). One possible explanation for these observations is that cells other than adipocytes in adipose tissue such as infiltrated mononuclear cells express MMP-1. Indeed, in the present study, we demonstrated that the coculture of adipocytes and U937 mononuclear cells markedly increased MMP-1 expression by U937 cells. Thus, it is likely that although MMP-1 expression is suppressed in differentiated adipocytes, MMP-1 expression by infiltrated monocytes is increased by interaction with adipocytes through an IL-6-dependent mechanism. Therefore, MMP-1 can be continually produced by adipose tissue in a monocyte/macrophage-accumulated area to play important roles in the pathophysiological processes such as angiogenesis and tissue remodeling for adipose tissue development.
Adipogenesis is tightly associated with angiogenesis as shown by the findings that adipose tissue explants trigger blood vessel formation (7). It is known that MMP such as MMP-1 and MMP-9 are important for angiogenesis (26). Forough et al. (27, 28) have demonstrated a coordinated interaction between fibroblast growth factor-1 and MMP-1 in the migration of cultured postcapillary venular endothelial cells. In addition to angiogenesis, MMP-1 and MMP-9 also play an important role in adipose tissue development by affecting ECM remodeling. Because the major proteins in the ECM in adipose tissue are collagens (29, 30) that are the substrate of MMP-1 and MMP-9, MMP-1 and MMP-9 are likely to be involved in adipose tissue remodeling by degrading collagen and other ECM proteins. Indeed, high expression of MMP-1 in human adipose tissue has been shown (25), suggesting that MMP-1 is important for adipose tissue development.
Another important finding from this study is that TLR4 activation by LPS or palmitic acid has a synergistic effect with the coculture of adipocytes and U937 cells on MMP-1 expression. It has been shown that TLR4 deficiency selectively protects against obesity induced by diets containing high saturated fat such as palmitate (31), suggesting that TLR4 is involved in adipose tissue development. However, the underlying mechanisms remain largely unknown. The finding from the present study indicates that TLR4 activation in adipose tissue by palmitate may facilitate further growth of adipose tissue by increasing MMP expression. Furthermore, using TLR4-deficient mice, several studies have demonstrated consistently that TLR4 plays a pivotal role in the inflammation and insulin resistance in adipose tissue (32–34). Given the essential role of MMP-1 in inflammation (35, 36), our findings from the present study that TLR4 activation led to increased MMP-1 expression revealed a novel mechanism by which TLR4 promotes inflammation in adipose tissue.
We demonstrated that TLR4 activation by either LPS or palmitic acid directly stimulated MMP-1 expression by U937 cells. We also demonstrated that TLR4 activation increased release of IL-6, which is a potent stimulator of MMP-1 expression (24). Thus, these results indicate that TLR4 activation may up-regulate MMP-1 expression via direct stimulation and indirect stimulation via IL-6 release. In support of this hypothesis, we demonstrated that TLR4 activation and IL-6 stimulation had a synergistic effect on MMP-1 expression by U937 cells (Fig. 4A). These findings, therefore, have revealed a potential regulatory mechanism involved in up-regulation of MMP-1 expression in adipose tissue by coordinated actions of TLR4 and proinflammatory cytokines.
In conclusion, the present study has demonstrated that cross talk between adipocytes and U937 cells through an IL-6-mediated mechanism increases MMP-1 expression by U937 cells, and TLR4 activation further increased MMP-1 expression. Furthermore, MAPK pathways including ERK, JNK, and p38 cascades, but not JAK/STAT3 and NFκB pathways, are required for the coculture-stimulated MMP-1 expression. This study suggests that IL-6 is a potential target to attenuate MMP-1 production in adipose tissue and control adipose tissue development.
Acknowledgments
This work was supported by a Merit Review Grant from Department of Veterans Affairs and National Institutes of Health Grant DE16353 (to Y.H.).
Disclosure Summary: The authors have nothing to disclose.
Footnotes
- ECM
- Extracellular matrix
- HMDM
- human monocyte-derived macrophages
- JAK
- Janus kinase
- JNK
- c-Jun N-terminal kinase
- LPS
- lipopolysaccharide
- MMP
- matrix metalloproteinase
- NFκB
- nuclear factor-κB
- siRNA
- small interfering RNA
- STAT3
- signal transducer and activator of transcription 3
- TIMP
- tissue inhibitors of metalloproteinase
- TLR4
- Toll-like receptor 4.
References
- 1. Vernochet C, Peres SB, Farmer SR. 2009. Mechanisms of obesity and related pathologies: transcriptional control of adipose tissue development. FEBS J 276:5729–5737 [DOI] [PubMed] [Google Scholar]
- 2. Ailhaud G, Grimaldi P, Négrel R. 1992. Cellular and molecular aspects of adipose tissue development. Annu Rev Nutr 12:207–233 [DOI] [PubMed] [Google Scholar]
- 3. Arroyo AG, Genís L, Gonzalo P, Matías-Román S, Pollán A, Gálvez BG. 2007. Matrix metalloproteinases: new routes to the use of MT1-MMP as a therapeutic target in angiogenesis-related disease. Curr Pharm Des 13:1787–1802 [DOI] [PubMed] [Google Scholar]
- 4. Rodriguez JA, Orbe J, Martinez de Lizarrondo S, Calvayrac O, Rodriguez C, Martinez-Gonzalez J, Paramo JA. 2008. Metalloproteinases and atherothrombosis: MMP-10 mediates vascular remodeling promoted by inflammatory stimuli. Front Biosci 13:2916–2921 [DOI] [PubMed] [Google Scholar]
- 5. Vanhoutte D, Heymans S. 2010. TIMP and cardiac remodeling: ‘Embracing the MMP-independent-side of the family’. J Mol Cell Cardiol 48:445–453 [DOI] [PubMed] [Google Scholar]
- 6. Christiaens V, Scroyen I, Lijnen HR. 2008. Role of proteolysis in development of murine adipose tissue. Thromb Haemost 99:290–294 [DOI] [PubMed] [Google Scholar]
- 7. Christiaens V, Lijnen HR. 2010. Angiogenesis and development of adipose tissue. Mol Cell Endocrinol 318:2–9 [DOI] [PubMed] [Google Scholar]
- 8. Christiaens V, Lijnen HR. 2006. Role of the fibrinolytic and matrix metalloproteinase systems in development of adipose tissue. Arch Physiol Biochem 112:254–259 [DOI] [PubMed] [Google Scholar]
- 9. Lijnen HR, Maquoi E, Hansen LB, Van Hoef B, Frederix L, Collen D. 2002. Matrix metalloproteinase inhibition impairs adipose tissue development in mice. Arterioscler Thromb Vasc Biol 22:374–379 [DOI] [PubMed] [Google Scholar]
- 10. Rupnick MA, Panigrahy D, Zhang CY, Dallabrida SM, Lowell BB, Langer R, Folkman MJ. 2002. Adipose tissue mass can be regulated through the vasculature. Proc Natl Acad Sci USA 99:10730–10735 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11. Maquoi E, Munaut C, Colige A, Collen D, Lijnen HR. 2002. Modulation of adipose tissue expression of murine matrix metalloproteinases and their tissue inhibitors with obesity. Diabetes 51:1093–1101 [DOI] [PubMed] [Google Scholar]
- 12. Cancello R, Clément K. 2006. Is obesity an inflammatory illness? Role of low-grade inflammation and macrophage infiltration in human white adipose tissue. Bjog 113:1141–1147 [DOI] [PubMed] [Google Scholar]
- 13. Heilbronn LK, Campbell LV. 2008. Adipose tissue macrophages, low grade inflammation and insulin resistance in human obesity. Curr Pharm Des 14:1225–1230 [DOI] [PubMed] [Google Scholar]
- 14. Suganami T, Tanimoto-Koyama K, Nishida J, Itoh M, Yuan X, Mizuarai S, Kotani H, Yamaoka S, Miyake K, Aoe S, Kamei Y, Ogawa Y. 2007. Role of the Toll-like receptor 4/NF-κB pathway in saturated fatty acid-induced inflammatory changes in the interaction between adipocytes and macrophages. Arterioscler Thromb Vasc Biol 27:84–91 [DOI] [PubMed] [Google Scholar]
- 15. Samuvel DJ, Sundararaj KP, Li Y, Lopes-Virella MF, Huang Y. 2010. Adipocyte-mononuclear cell interaction, Toll-like receptor 4 activation, and high glucose synergistically up-regulate osteopontin expression via an interleukin 6-mediated mechanism. J Biol Chem 285:3916–3927 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16. Milanski M, Degasperi G, Coope A, Morari J, Denis R, Cintra DE, Tsukumo DM, Anhe G, Amaral ME, Takahashi HK, Curi R, Oliveira HC, Carvalheira JB, Bordin S, Saad MJ, Velloso LA. 2009. Saturated fatty acids produce an inflammatory response predominantly through the activation of TLR4 signaling in hypothalamus: implications for the pathogenesis of obesity. J Neurosci 29:359–370 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17. Kim JJ, Sears DD. 2010. TLR4 and insulin resistance. Gastroenterol Res Pract 10.1155/2010/212563 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18. Sundström C, Nilsson K. 1976. Establishment and characterization of a human histiocytic lymphoma cell line (U-937). Int J Cancer 17:565–577 [DOI] [PubMed] [Google Scholar]
- 19. Cousin SP, Hügl SR, Wrede CE, Kajio H, Myers MG, Jr, Rhodes CJ. 2001. Free fatty acid-induced inhibition of glucose and insulin-like growth factor I-induced deoxyribonucleic acid synthesis in the pancreatic β-cell line INS-1. Endocrinology 142:229–240 [DOI] [PubMed] [Google Scholar]
- 20. Seager Danciger J, Lutz M, Hama S, Cruz D, Castrillo A, Lazaro J, Phillips R, Premack B, Berliner J. 2004. Method for large scale isolation, culture and cryopreservation of human monocytes suitable for chemotaxis, cellular adhesion assays, macrophage and dendritic cell differentiation. J Immunol Methods 288:123–134 [DOI] [PubMed] [Google Scholar]
- 21. Mu YM, Yanase T, Nishi Y, Tanaka A, Saito M, Jin CH, Mukasa C, Okabe T, Nomura M, Goto K, Nawata H. 2001. Saturated FFAs, palmitic acid and stearic acid, induce apoptosis in human granulosa cells. Endocrinology 142:3590–3597 [DOI] [PubMed] [Google Scholar]
- 22. Maloney E, Sweet IR, Hockenbery DM, Pham M, Rizzo NO, Tateya S, Handa P, Schwartz MW, Kim F. 2009. Activation of NF-κB by palmitate in endothelial cells: a key role for NADPH oxidase-derived superoxide in response to TLR4 activation. Arterioscler Thromb Vasc Biol 29:1370–1375 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23. Ajuwon KM, Spurlock ME. 2005. Palmitate activates the NF-κB transcription factor and induces IL-6 and TNFα expression in 3T3-L1 adipocytes. J Nutr 135:1841–1846 [DOI] [PubMed] [Google Scholar]
- 24. Li Y, Samuvel DJ, Sundararaj KP, Lopes-Virella MF, Huang Y. 2010. IL-6 and high glucose synergistically upregulate MMP-1 expression by U937 mononuclear phagocytes via ERK1/2 and JNK pathways and c-Jun. J Cell Biochem 110:248–259 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25. van Beek EA, Bakker AH, Kruyt PM, Vink C, Saris WH, Franssen-van Hal NL, Keijer J. 2008. Comparative expression analysis of isolated human adipocytes and the human adipose cell lines LiSa-2 and PAZ6. Int J Obes (Lond) 32:912–921 [DOI] [PubMed] [Google Scholar]
- 26. Sang QX. 1998. Complex role of matrix metalloproteinases in angiogenesis. Cell Res 8:171–177 [DOI] [PubMed] [Google Scholar]
- 27. Forough R, Weylie B, Collins C, Parker JL, Zhu J, Barhoumi R, Watson DK. 2006. Transcription factor Ets-1 regulates fibroblast growth factor-1-mediated angiogenesis in vivo: role of Ets-1 in the regulation of the PI3K/AKT/MMP-1 pathway. J Vasc Res 43:327–337 [DOI] [PubMed] [Google Scholar]
- 28. Partridge CR, Hawker JR, Jr, Forough R. 2000. Overexpression of a secretory form of FGF-1 promotes MMP-1-mediated endothelial cell migration. J Cell Biochem 78:487–499 [PubMed] [Google Scholar]
- 29. Bradshaw AD, Graves DC, Motamed K, Sage EH. 2003. SPARC-null mice exhibit increased adiposity without significant differences in overall body weight. Proc Natl Acad Sci USA 100:6045–6050 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30. Gabbay JS, Heller JB, Mitchell SA, Zuk PA, Spoon DB, Wasson KL, Jarrahy R, Benhaim P, Bradley JP. 2006. Osteogenic potentiation of human adipose-derived stem cells in a 3-dimensional matrix. Ann Plast Surg 57:89–93 [DOI] [PubMed] [Google Scholar]
- 31. Davis JE, Gabler NK, Walker-Daniels J, Spurlock ME. 2008. Tlr-4 deficiency selectively protects against obesity induced by diets high in saturated fat. Obesity (Silver Spring) 16:1248–1255 [DOI] [PubMed] [Google Scholar]
- 32. Tsukumo DM, Carvalho-Filho MA, Carvalheira JB, Prada PO, Hirabara SM, Schenka AA, Araújo EP, Vassallo J, Curi R, Velloso LA, Saad MJ. 2007. Loss-of-function mutation in Toll-like receptor 4 prevents diet-induced obesity and insulin resistance. Diabetes 56:1986–1998 [DOI] [PubMed] [Google Scholar]
- 33. Kim F, Pham M, Luttrell I, Bannerman DD, Tupper J, Thaler J, Hawn TR, Raines EW, Schwartz MW. 2007. Toll-like receptor-4 mediates vascular inflammation and insulin resistance in diet-induced obesity. Circ Res 100:1589–1596 [DOI] [PubMed] [Google Scholar]
- 34. Shi H, Kokoeva MV, Inouye K, Tzameli I, Yin H, Flier JS. 2006. TLR4 links innate immunity and fatty acid-induced insulin resistance. J Clin Invest 116:3015–3025 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35. Ray A, Shakya A, Ray BK. 2005. Inflammation-responsive transcription factors SAF-1 and c-Jun/c-Fos promote canine MMP-1 gene expression. Biochim Biophys Acta 1732:53–61 [DOI] [PubMed] [Google Scholar]
- 36. Li D, Williams V, Liu L, Chen H, Sawamura T, Antakli T, Mehta JL. 2002. LOX-1 inhibition in myocardial ischemia-reperfusion injury: modulation of MMP-1 and inflammation. Am J Physiol Heart Circ Physiol 283:H1795–H1801 [DOI] [PubMed] [Google Scholar]