Skp2 Is Required for Incretin Hormone-Mediated β-Cell Proliferation

Abstract

The glucoincretin hormone glucagon-like peptide-1 (GLP-1) and its analog exendin-4 (Ex-4) promote β-cell growth and expansion. Here we report an essential role for Skp2, a substrate recognition component of SCF (Skp, Cullin, F-box) ubiquitin ligase, in promoting glucoincretin-induced β-cell proliferation by regulating the cellular abundance of p27. In vitro, GLP-1 treatment increases Skp2 levels, which accelerates p27 degradation, whereas in vivo, loss of Skp2 prevents glucoincretin-induced β-cell proliferation. Using inhibitors of phosphatidylinositol 3-kinase and Irs2 silencing RNA, we also show that the effects of GLP-1 in facilitating Skp2-dependent p27 degradation are mediated via the Irs2-phosphatidylinositol-3 kinase pathway. Finally, we show that down-regulation of p27 occurs in islets from aged mice and humans, although in these islets, age-dependent accumulation of p16^Ink4a prevent glucoincretin-induced β-cell proliferation; however, ductal cell proliferation is maintained. Taken together, these data highlight a critical role for Skp2 in glucoincretin-induced β-cell proliferation.

Pancreatic β-cell mass is dynamic and responds to variations in insulin demand due to physiological and pathological challenges such as aging, pregnancy, and obesity. Failure of the endocrine pancreas to adapt the β-cell mass to changing insulin demand can lead to hyperglycemia and diabetes. Hence, understanding the mechanisms that regulate β-cell plasticity is important in developing effective therapeutic approaches for the treatment of diabetes. The glucoincretin hormone glucagon-like peptide-1 (GLP-1) and its long-acting peptide analog exendin-4, both well known therapeutic candidates, have pleiotropic effects that include potentiation of glucose-dependent insulin release as well as β-cell proliferation and survival (1–3). Activation of GLP-1 receptor by glucoincretins results in the induction of cAMP second messenger pathway. Increase in cAMP stimulates the expression of various genes that play a role in glucose sensing [GLUT2 (glucose transporter 2) and glucokinase] and insulin secretion (Pdx1 and insulin itself). GLP-1-mediated increase in cAMP also promotes β-cell survival by inducing Irs2 expression (4) and enhanced activation of AKT (5). However, despite the significant progress in our understanding of the signaling cascade initiated by GLP-1, the mechanisms by which glucoincretins induce β-cell proliferation to result in expansion of β-cell mass are not clear.

A number of studies have indicated that expansion of β-cell mass in adults is due to the replication of existing β-cells (6, 7). The cellular abundance of cell cycle inhibitor, p27, is a critical determinant of the transition from quiescence to a proliferative state (8). The level of p27 in the β-cells is controlled by a ubiquitin ligase complex that regulates p27 degradation (9–11). Skp2, an F box protein, functions as a receptor component of an SCF ubiquitin ligase complex, resulting in p27 ubiquitination and degradation (12, 13). In Skp2^−/− mice, accumulation of p27 prevents β-cell proliferation, resulting in decreased β-cell mass, hypoinsulinemia, and a corresponding decrease in the ability to dispose glucose from blood (14). The insulin receptor substrate 2 (Irs2) branch of insulin signaling has been linked to cell cycle regulation, because Irs2-deficient mice show progressive accumulation of p27 in the nuclei of β-cells (15). Deletion of p27 allele rescues the diabetic phenotype and β-cell mass of Irs2-deficient mice, indicating that p27 functions downstream of Irs2-mediated signaling to regulate β-cell proliferation (11). Glucoincretins also are known to induce Irs2 expression via the cAMP pathway, correlating with the induction of proliferation (5).

In the light of these studies, we hypothesized that GLP-1 signaling via Irs2 could regulate the stability of p27 and thereby control glucoincretin-induced β-cell proliferation and expansion of β-cell mass. In this study, we have analyzed whether glucoincretins regulate the degradation of p27 via Skp2 to mediate the proliferative effects of glucoincretins on pancreatic β-cells. The results presented here show that glucoincretins induce the degradation of p27 mediated by Skp2 via the Irs2 phosphatidylinositol 3-kinase (PI3-kinase) pathway. Using Skp2^−/− animals and silencing RNA targeting Irs2 in Min6 cells, we show that Skp2 is downstream of the Irs2-PI3-kinase pathway and that Skp2 mediated degradation of p27 is required for the proliferative effects of GLP-1/exendin-4 on β-cell mass expansion. Furthermore, we show that glucoincretins can also mediate the degradation of endogenous p27, by using prediabetic db/db mice (where p27 levels are normally very high), leading to β-cell proliferation in these animals. Finally, we present data on how the levels of another cell cycle inhibitor, p16^Ink4a, may override glucoincretin-dependent p27 degradation in β-cells in old animals. We also show that degradation of p27 is also the mechanism leading to ductal and exocrine proliferation in response of exendin-4 treatment. These results suggest that the proliferative effect of glucoincretins in young animals on pancreatic β-cells is mediated by Skp2-dependent degradation of p27. In summary, our study describes the molecular connection between the Irs2-PI3-kinase signaling cascade and Skp2-mediated p27 degradation as a means of induction of cellular proliferation in response to glucoincretins.

Results

GLP-1 regulates Skp2-mediated p27 degradation through the Irs2-PI3-kinase pathway

Our previous work has shown a critical role for Skp2-mediated p27 degradation in regulating β-cell proliferation (14). Glucoincretins such as GLP-1 induce proliferation of β-cells (16), and long-term treatment of isolated mouse islets with long-acting GLP-1 analog exendin-4 has been shown to cause elevated Skp2 levels (17). These data suggest that glucoincretins induce β-cell proliferation by modulating Skp2 levels. To address whether a short-term GLP-1 treatment also induces Skp2-mediated p27 degradation in cultured islets, isolated human islets were incubated with GLP-1 for 24 and 48 h, and the protein levels of Skp2 and p27 were measured by immunoblotting. GLP-1 treatment increased Skp2 levels 2.6-fold after 24 h of treatment, and to 4-fold after 48 h (Fig. 1, A and B). Levels of p27 protein were decreased after 24 h of GLP-1 treatment and reduced 3.5-fold after 48 h (Fig. 1, A and C). Similar effects of short-term GLP-1 treatment were observed in cultured mouse islets (data not shown). Glucoincretins utilize the PI3-kinase cascade to mediate diverse effects, including β-cell proliferation (1, 4, 5, 18). To assess whether the effect of GLP-1 on Skp2 is also mediated through the PI3-kinase pathway, we included the PI3-kinase inhibitor along with GLP-1 treatment (16). The effects of GLP-1 on Skp2 and p27 levels were blocked by PI3-kinase inhibitor (LY294002, 50 μmol/liter) (Fig. 1, A–C), indicating the involvement of the PI3-kinase-signaling pathway in GLP-1-induced Skp2-mediated degradation of p27. We further examined whether reduction of p27 levels in human islets after GLP-1 treatment leads to β-cell proliferation. We did not observe any Ki67 and insulin double-positive cells in human islets after 48 h of GLP-1 treatment (Fig. 1, D and E). Therefore, we reasoned that another cell cycle inhibitor, p16^Ink4a, may constrain islet proliferation. Previous studies have shown that p16^Ink4a prevented adult mouse and human islets proliferation (20–22). To test this idea, we measured levels of p16 in control and GLP-1-treated human islets by immunoblotting. Indeed, high levels of p16 ^Ink4a were detected in these islets, and the levels of p16 ^Ink4a did not change after 48 h of GLP-1 treatment (Fig. 1F).

Fig. 1.

Skp2-mediated p27 degradation is activated in response to GLP-1 treatment and is regulated posttranscriptionally via a PI3-kinase-dependent pathway. Cultured human islets were treated with GLP-1 (10 nmol/liter) with or without Ly294002 (50 μmol/liter) for indicated time periods. Protein levels of Skp2 and p27 were measured by Western blotting (A). Ly294002 was added 30 min before GLP-1 stimulation. Data show representative from three individual experiments. Bar graphs and the error bars represent the mean ± se of Skp2 (B) and p27 (C) protein levels normalized with β-tubulin from two identical experiments. Control (D) and GLP-1-treated (panel E, 10 nmol/liter) human islets were immunostained with insulin (green) and ki67 (red). No insulin-ki67 double positive cells were observed after 48 h of GLP-1 treatment. Protein levels of p16 from control and GLP-1-treated human islets (48 h) were measured by Western blotting (F). Data show representatives from three individual experiments. Bargraphs and the error bars represent the mean ± se of p16 protein levels normalized with β-tubulin from three experiments. *, P = 0.12. β-Tub, β-Tubulin; Ins, insulin.

Exendin-4 is known to increases cAMP levels, which promotes Irs2 expression and stimulates Akt phosphorylation via PI3-kinase, resulting in β-cell proliferation (4, 5). We, therefore, reasoned that glucoincretins promote Skp2-mediated degradation of p27 and β-cell proliferation by inducing Irs2 expression. We used loss-of-function of Irs2 by transfecting specific silencing RNA (siRNA) in Min6 cells to determine whether the effects of exendin-4 on proliferation, mediated by Skp2 and p27, are directly regulated by Irs2-signaling pathway in β-cells. Min6 cells were transfected with Irs2 siRNA or scrambled siRNA 24, and cell samples were collected 24 h or 48 h after transfection and measured by real-time PCR for mRNA transcription and Western blotting for protein levels. Both mRNA transcription and protein levels were decreased (Fig. 2A). We then measured protein levels of p27 and Skp2 in Irs2 siRNA or scrambled siRNA-transfected Min6 cells, treated with or without exendin-4. Min6 cells were transfected with Irs2 siRNA or scrambled siRNA 24 h before exendin-4 (2.5 nm) treatment. Exendin-4 treatment was associated with 6-fold increase in Skp2 levels and 3.5-fold decrease in p27 levels in control Min6 cells transfected with scrambled siRNA (*P < 0.05). By contrast, transfection of Irs2 siRNA in Min6 cells reduced the Skp2 levels in sham treatment group and blocked the effect of exendin-4 to increase Skp2 and reduce p27 levels (Fig. 2B). Taken together, these data show that glucoincretins accelerated p27 degradation via up-regulation of Skp2 levels, which is downstream of PI3-kinase cascade mediated via Irs2.

Fig. 2.

Irs2-signaling pathway mediates the effects of glucoincretins-induced Skp2-mediated p27 degradation. Min6 cells were transfected with Irs2 siRNA (500 nm) for 24 h or 48 h. RNA and protein were isolated. Quantitative RT-PCR analysis showing levels of Irs2 transcript in Min6 cells treated with Irs2 siRNA (A, left). Western blotting was also performed to evaluate IRS2 protein levels (A, middle). The error bars represent sem (n = 3) for each experiment; P < 0.05 (panel A). Min6 cells were transfected with scramble siRNA or Irs2 siRNA 24 h before exendin-4 (2.5 nm) treatment. Cell lysates were collected 24 h after exendin-4 treatment, and levels of Skp2 and p27 were measured by Western blotting. Data show representatives from four individual experiments. Bar graphs and the error bars represent the mean ± se of Skp2 and p27 protein levels normalized with β-tubulin from two identical experiments (panel B). ctrl, Control; Ex-4, exendin-4; Ins, insulin; β-Tub, β-tubulin.

Skp2-mediated p27 degradation is required for glucoincretin-mediated β-cell mass expansion in mice

Several reports have suggested that continuous short-term glucoincretin treatments in mice leads to β-cell mass expansion (3, 16). Because Skp2 levels quickly increase in isolated islets in response to GLP-1 treatment, we further examined whether Skp2 mediates glucoincretins-induced β-cell mass expansion in vivo by regulating cellular abundance of p27. The long-acting form of GLP-1, exendin-4 (10 nmol/kg body weight) or PBS sham control were administered ip to young (7–8 wk of age) Skp2^−/− mice and control littermates daily for 7 d. Skp2^+/− mice were used as control littermates because these heterozygous mice do not exhibit any phenotypes (14). No significant weight differences were observed between PBS- or exendin-4-treated groups (Fig. 3A). Pancreata from both groups were collected, and pancreatic sections were stained with antiinsulin antibody to measure β-cell mass in each group. Exendin-4-treated control littermates displayed a 2.5-fold increase in β-cell mass when compared with PBS-treated controls. In contrast, exendin-4 treatment of Skp2^−/− mice did not show any differences in β-cell mass compared with PBS treatment in these mice (Fig. 3B). To assess whether exendin-4-mediated expansion of β-cell mass is dependent on β-cell proliferation, the number of proliferating β-cells was further determined by Ki67 staining. Exendin-4-treated control Skp2^+/− mice showed a 7.2-fold increase in Ki67-positive β-cells compared with PBS-treated controls (Fig. 3C). In contrast, Skp2^−/− mice showed little or no differences between exendin-4 and PBS treatments in the number of Ki67-positive β-cells. These observations show a requirement for Skp2 in glucoincretin-induced β-cell mass expansion.

Fig. 3.

Exendin-4-induced β-cell mass expansion is blocked in Skp2^−/− mice. Young (7–8 wk of age) wild-type control (Skp2^+/−) and Skp2^−/− mice were ip injected with PBS or exendin-4 (10 nmol/kg body weight) daily for 7 d. Skp2^+/− mice were used as wt control because no phenotype was observed. Body weights were measured after 7 d of exendin-4 injection. No significant weight differences were observed between PBS or exendin-4-treated groups. Black bar represents wt control; gray bar, Skp2 ^−/− (A). Mice were killed and β-cell mass was analyzed. A 2.5-fold increase in β-cell mass was observed in exendin-4-treated wt control littermates when compared with PBS-treated group. No differences in β-cell mass were found in Skp2^−/− mice treated with exendin-4 or PBS. Data are shown as mean ± se from five to seven sections per mouse, three to four mice per group. *, P < 0.05. Black bar, PBS treated; gray bar (B). Exendin-4 treated β-cell replication was evaluated by immunohistochemistry with antiinsulin and anti-Ki67 antibodies. Numbers of Ki67-positive β-cells were quantified in pancreata from Skp2^+/− and Skp2^−/− mice after daily injection of PBS or exendin-4 for 7 d. Wild-type control mice show a 7.2-fold increase in β-cell proliferation in response to exendin-4 treatment whereas no differences were observed in Skp2^−/− mice. Black bar, PBS; gray bar, exendin-4. Data are shown as mean ± se from five sections per mouse, three mice per group; *, P < 0.05 (C). Exendin-4 treatment in vivo leads to p27 degradation. Pancreatic sections from wt control mice (∼7–8 wk of age) treated with PBS (left) or exendin-4 (right) were immunostained with antimouse insulin (green) and anti-mouse p27 (red) antibodies. Data show representatives from three individual experiments (D). Ex4, Exendin-4.

To assess the levels of p27 protein in exendin-4-dependent β-cell mass expansion, pancreatic sections from exendin-4 or PBS-treated 7-wk-old wild-type mice were analyzed for the expression of p27 and insulin by immunohistochemistry. A number of β-cells in the PBS-treated control mice showed normal accumulation of p27 in the nucleus (Fig. 3D, left). In contrast, β-cells in the exendin-4-treated mice showed loss of p27 in the nucleus (Fig. 3D, right), which correlates with the increment in β-cell proliferation (Fig. 3C). Levels of another cyclin kinase inhibitor, p21, were also analyzed by immunohistochemistry, and no differences were observed between exendin-4 or PBS-treated mice (data not shown), thus indicating specificity for p27. To rule out the possibility of antiapoptotic effects of exendin-4 in β-cell mass expansion, terminal deoxynucleotide transferase-mediated dUTP nick end labeling (TUNEL) assay was performed on pancreatic sections from exendin-4- or PBS-treated Skp2^−/− mice and control littermates, and no differences in apoptosis were observed (data not shown). These data, therefore, demonstrate that Skp2 is required for exendin-4-dependent expansion of β-cell mass via β-cell proliferation.

Exendin-4 promotes β-cell replication in db/db mice by promoting degradation of p27

The nuclei of β-cells of Irs2^−/− mice and mice lacking the long form of the leptin receptor (Lepr^−/− or db/db) show progressive accumulation of p27 and decreased β-cell proliferation, resulting in the inability of the pancreas to respond to insulin resistance (11). It is likely that endogenous accumulation of p27 in these animals occurs due to Skp2 deficiency. To confirm whether a deficit in Skp2 associates with the accumulation of p27 in db/db mice, we measured Skp2 and p27 levels by Western blotting using isolated islets from young db/db and wild-type mice. These experiments showed that indeed, the levels of Skp2 in the islets isolated from db/db mice were negligible, accounting for the high levels of p27 in this model. This was in contrast to islets from wild-type mice, which showed normal levels of Skp2 protein and correspondingly low levels of p27 (Fig. 4A). Elevated p27 levels in islets of db/db mice were further confirmed by immunohistochemistry (Fig. 4B). These data suggest that accumulation of p27 in db/db mice results from low levels of Skp2 leading to reduce β-cell proliferation.

Fig. 4.

Accumulation of p27 levels in β-cells of db/db mice. Islets from young (5 wk of age) prediabetic db/db and wild-type mice were isolated, and protein levels of Skp2 and p27 were measured by Western blotting. Data show a representative from three individual experiments. Bar graphs and the error bars represent the quantification and average deviation from three identical experiments. Black bar, db/db mice; white bar, wild-type mice. **, P < 0.01 (panel A). Pancreatic sections from db/db (panel B) and wild type (panel C) control mice were immunostained with antimouse insulin (green) and antimouse p27 (red) antibodies. β-Tub, β-tubulin; WT, wild type.

We next investigated whether treatment of db/db mice with exendin-4 could induce Skp2 and promote degradation of endogenous p27. We used 4-wk-old db/db mice that displayed normal blood glucose levels to avoid any complications from hyperglycemia. These 4-wk-old prediabetic mice were treated with exendin-4 ip for 7 d, and pancreatic sections from control and treated mice were analyzed for the expression of p27 and insulin. As expected, immunostaining showed that p27 protein accumulated in the nuclei of β-cells in control db/db mice (Fig. 5A), as previously reported (11). Interestingly, most of the β-cells in the exendin-4-treated db/db mice showed a significant reduction of p27 levels (Fig. 5B), suggesting that exendin-4 can reduce endogenous p27 in β-cells. No significant differences were observed in TUNEL staining between two groups, suggesting that apoptosis rates were not affected by short-term exendin-4 treatment (Fig. 5, C and D). To further examine whether the exendin-4 treatment decreased accumulation of p27 protein by increasing Skp2 levels, islets isolated from control and exendin-4-treated db/db mice were subjected to immunoblot analysis. Islets from exendin-4-treated db/db mice showed dramatic increase in Skp2 levels and decreased p27 levels compared with islets from PBS-treated littermates (Fig. 5E). To further examine whether Skp2-induced p27 degradation resulted in increased β-cell proliferation in db/db mice, β-cell proliferation was evaluated in both groups by Ki67 staining. Exendin-4 treatment in prediabetic young db/db mice resulted in significantly more Ki67-positive β-cells compared with control littermate mice treated with PBS (Fig. 5F, 2.6-fold increase, P < 0.01), suggesting that prediabetic db/db mice have the capacity to respond to exendin-4 to increase Skp2 levels, reduce p27 levels, and increase their β-cell proliferation.

Fig. 5.

Endogenous p27 degradation is required for glucoincretins action on β-cell proliferation. Pancreatic sections from 4-wk-old db/db mice daily treated with PBS (A) or exendin-4 (B) for 7 d were immunostained with antimouse p27 (red) and antimouse insulin (green) antibodies. β-Cell apoptosis was examined by TUNEL staining (red) costained with antimouse insulin (green) antibodies in 4-wk-old db/db mice treated with PBS (C) or exendin-4 (D). Islets were isolated from 4-wk-old db/db mice treated with PBS or exendin-4 for 7 d, and protein levels of Skp2 and p27 were measured by Western blotting. Data show representatives from three individual experiments. Bar graphs and the error bars represent the quantification and average deviation from three identical experiments (E). β-Cell replication was evaluated by immunohistochemistry with antiinsulin and anti-Ki67 antibodies. Number of Ki67-positive β-cells was quantified in pancreata from db/db mice (4 wk of age) after daily injection of PBS or exendin-4 for 7 d. A 2.5-fold increment was observed in exendin-4-treated wild-type animals. Data are shown as mean ± se from four sections per mouse, four mice per group; **, P < 0.01 (F). Nuclear staining with DAPI is shown in blue. Ex-4. Exendin-4.

Exendin-4 fails to induce β-cell proliferation in aged mice despite p27 degradation

Previously published work from our group and others has shown that young mice are able to respond to glucoincretin treatment by β-cell proliferation, which leads to an increase in β-cell mass. However, aged animals do not expand β-cell mass in response to glucoincretin treatment, primarily due to accumulation of p16^Ink4a, an inhibitor of cyclin D/cyclin-dependent kinase (Cdk)4 (3, 23). We first checked whether glucoincretins mediate any reduction of p27 levels in the islets, in aged mice. Wild-type mice (8 months of age) were treated with PBS or exendin-4 ip, and pancreas samples were collected. Exendin-4 treatment resulted in the reduction of p27 protein levels in the islets (Fig. 6, A and B); however, p16^Ink4a levels in the islets were unchanged (Fig. 6, C and D). These data suggest that despite reductions in p27 levels, high p16^Ink4a levels prevent cell cycle reentry of islet cells. Thus, glucoincretin treatment is unable to expand islet mass in aged animals.

Fig. 6.

Exendin-4 fails to induce β-cell proliferation in aged mice despite p27 degradation. Pancreatic sections from 7-month-old wild-type mice daily treated with PBS (control) or exendin-4 for 7 d were immunostained with various antibodies. Immunostaining of p27 (A and B) and p16 (C and D) within islets in PBS (A and C) or exendin-4 (B and D)-treated animals were examined. Levels of p27 in islets are reduced in exendin-4-treated wild-type mice (B) compared with PBS-treated wild-type mice (A). No differences were observed in p16 levels (C and D). Data were representative from four sections per mouse and three mice per group. Antimouse p27 (E and F) and antimouse p16 (G and H) were also costained with antimouse Mucin-1 in PBS (E and G)- or exendin-4 (F and H)-treated pancreatic sections. Arrows indicate ductal structures in control (E and G) and exendin-4-treated (F and H) wild-type mice. Levels of p27 in ductal cells is reduced in exendin-4-treated wt mice (F) compared with PBS-treated wild-type mice (E). No differences were observed in p16 levels (G and H). Data were representative from four sections per mouse and three mice per group. Numbers of Ki67-positive ductal cells were quantified by using antimouse Ki67 and antimouse Mucin-1. A 3-fold increase in ductal cell proliferation was observed in exendin-4-treated wild-type control littermates when compared with PBS-treated group. Data are shown as mean ± se from three sections per mouse and three mice per group. *, P < 0.05 (I). Arrows indicate ductal structures in control (J) and exendin-4-treated (K) wild-type mice. DAPI staining marking nuclei is shown in blue. Muc-1, Mucin-1.

To test whether this phenomenon was restricted to islets in the pancreas, we examined whether exendin-4 treatment in aged mice resulted in changes in p27 and p16 levels in other compartments of the pancreas. Several studies have shown that GLP-1 receptors are expressed throughout the pancreas (24–27), suggesting that GLP-1 treatment could affect the exocrine and ductal tissue. Expression analysis of p16^Ink4a revealed generally low levels of expression in exocrine and ductal tissue and in contrast to islet cells, no increase in p16^Ink4a levels were observed in these tissues with aging (data not shown). Pancreatic sections from control and exendin-4-treated 8-month-old animals revealed that exendin-4 treatment resulted in reduction of p27 levels in the exocrine and ductal tissue, in a manner similar to islets (Fig. 6, A, B, E, and F). Furthermore, the low levels of p16^Ink4a in the ductal and exocrine tissue remained unchanged in response to exendin-4 (Fig. 6, G and H). Costaining of Ki67 and Mucin-1 (a ductal marker) revealed a 3-fold increase in ductal proliferation in exendin-4-treated animals (Fig. 6, I–K) that correlated with the decreased levels of p27. These data suggest that glucoincretin treatment in aged mice can not induce proliferation of β-cells due to high p16^Ink4a levels in islets, although other cell types in the pancreas respond to glucoincretin to increase proliferation.

Discussion

As GLP-1 analogs have been approved by the US Food and Drug Administration (FDA) and are currently being prescribed to patients with type 2 diabetes to improve glycemic control, it is important to understand their molecular mechanism of action. In this study, we analyze the mitogenic pathways activated by glucoincretins and their effect on β-cell proliferation. Several previous studies have shown that GLP-1 functions via the Irs2-PI3-kinase pathway to regulate the growth and survival of pancreatic β-cells (4, 5, 16). What was not clear was how incretin hormone signaling to the PI3-kinase pathway impinges on the cell cycle machinery to regulate β-cell proliferation. In this study, we show that glucoincretins act through Irs2-PI3-kinase pathway to promote degradation of cell cycle inhibitor, p27, via the SCF ubiquitin ligase complex containing Skp2. Interestingly, the Irs2-PI3-kinase pathway is also used by insulin and IGF family to mediate cell growth. This suggests a possibility that various mitogenic signals utilize a common mechanism of Irs-PI3-kinase signaling, to cause Skp2-mediated p27 degradation.

We also demonstrate that reduction of endogenous levels of p27, mediated by an up-regulation of Skp2 in response to glucoincretin signaling, is a requirement for β-cell mass expansion, as the Skp2^−/− mice are unable to expand their β-cell mass in response to glucoincretins. Skp2 also acts as a binding partner of Cyclin A in cancer cells and stabilizes it from inhibition by p27 via competitive binding (28). Although it is possible that Cyclin A2 could also be affected by the absence of Skp2, several lines of evidence suggest that Cyclin A2 and Skp2 are likely in distinct pathways. First, double knockouts of Skp2 and p27 completely rescued the phenotype of skp2-null mice and β-cell replication as we demonstrated in our previous study (14). This indicates that in β-cells, p27 was the primary target of Skp2 for protein degradation to regulate β-cell replication. Second, unlike p27, which acts at the G₁/S transition (29), cyclin A2 is most abundant in S/G₂ phase and acts primarily at the G₂/M transition, and thus these two factors are separated in cell cycle phases (30). Third, direct protein interactions of cyclin A2 with Skp2 complex were only observed in cancer cells and may not necessarily occur during a normal cell cycle. Finally, the observation of Hussain and co-workers (17) that GLP1 functions through cyclinA2 by transcriptional regulation is on a different time scale than the rapid protein degradation during progression of the cell cycle. Thus, although Cyclin A2 can also play a role in GLP1-induced proliferation in the pancreas (17), it is likely to be a distinct pathway that is separated in time from the Skp2-mediated p27 degradation. We also show that the db/db mice have very low endogenous levels of Skp2, resulting in accumulation of p27 and low proliferation in the db/db islets, leading to a failure in adaptive expansion. Surprisingly, these mice are able to up-regulate Skp2 levels in response to a glucoincretin treatment, leading to reduced p27 levels and induction of β-cell proliferation. This is an interesting observation in terms of glucoincretins acting differently in diabetic animal models.

Our work also highlights that although different pancreatic compartments respond similarly to glucoincretin treatment by reducing the p27 levels, the endocrine and ductal compartments respond to the reduction of p27 differently. β-Cell replication is dependent on the balance between the cyclin D2-Cdk4 complex that forms in response to mitotic signals, and cyclin kinase inhibitors (CKI) that block the activity of the cyclin E-Cdk2 complex. Two groups of CKI have been described (31). These include the Ink4 family, members of which specifically inhibit cyclin D-Cdk4/6 activity, and the CIP/KIP (CDK interacting protein/kinase inhibitory protein) family, that includes p21, p27, and p57, which exhibit promiscuous CDK-inhibitory activity. A member of the Ink4a family, p16^Ink4a, accumulates in the β-cells with age, indicating that high levels of p16^Ink4a in older β-cells shift the balance, and mitotic stimuli that lead to changes in levels of other CKI would have minimal effect (22). This is indeed the case for pancreatic β-cells, as β-cells from old mice exhibit high levels of p16^Ink4a, and are resistant to reenter the cell cycle (3, 23). We show that GLP-1 induced degradation of p27 is insufficient to promote β-cell replication in older mice that display high levels of p16^Ink4a in their islets. Data from our work and others (20) suggest that the high endogenous p16 ^Ink4a levels in adult human islets may also account for the observations that human islets do not proliferate in response to glucoincretins, even though they are able to induce Skp2 and reduce p27 in response to such treatments.

GLP-1 receptors are expressed in many cell types within the pancreas, including ductal, acini, and β cells (24, 25). Unlike pancreatic β cells, ductal cells do not display the age-dependent increase in p16^Ink4a and thus are capable of responding to GLP-1 even in aged mice to increase proliferation. Recent studies in rats treated with exendin-4 or sitagliptin, which stabilizes GLP-1, have demonstrated increased ductal proliferation, ductal metaplasia, and chronic pancreatitis (25, 32). Moreover, increased ductal proliferation is also strongly associated with degradation of p27 levels (33). Incretins have long been considered to enhance glucose-mediated insulin secretion; however, they also have the potential to activate cell cycle in nonendocrine pancreatic cells types. It remains to be tested whether PI3-kinase inhibitor could be used to block the effects of glucoincretins on cell cycle proliferation while maintaining enhancement of glucose-mediated insulin secretion.

Materials and Methods

Mice.

Skp2^−/− mice between 7 and 8 wk of age were used in this study and were maintained on a C57BL/6J/CD1 mixed background and genotyped by PCR as previous described, and Skp2^+/− littermates were used as control because no phenotypes were observed (14). Young (4 wk of age) Lepr^−/− (db/db) mice were purchased from The Jackson Laboratory (Bar Harbor, ME). All mice were maintained ad libitum on a standard diet and kept under a 12-h light, 12-h dark cycle. All animal protocols were approved by Chancellor's Animal Research Committee at UCLA.

Cell culture and human islets culture.

Isolated human islets were obtained from ABCC Islet Cell Resource (three donors, between 26 and 67 yr of age; purity, ∼80–90% upon arrival). Human islets were hand picked and cultured in CMRL medium with 10% fetal calf serum and 100 U/ml Pen-Strep (Invitrogen, Carlsbad, CA) at 37 C for 1–2 d before treatment with GLP-1 (10 nmol/liter; Sigma-Aldrich, St. Louis, MO) for 24 or 48 h as indicated. Min6 cells were maintained in DMEM (Invitrogen) with 10% fetal calf serum, 50 μm β-mercaptoethanol, and 100 U/ml Pen-Strep at 37 C under 5% CO₂.

Drug treatment.

Skp2^−/− and control mice (7–8 wk of age) or young (4 wk of age) Lepr^−/− (db/db) mice were injected ip with exendin-4 (10 nmol/kg body weight; Sigma-Aldrich) or vehicle control (PBS) daily for 7 d. Mice were killed and pancreata were collected for histological analysis.

Immunohistochemistry.

Pancreatic tissue was processed as previously described (14). In brief, the pancreas was dissected and fixed in 4% formaldehyde before being embedded in paraffin. Sections (5 μm) were deparaffinized and rehydrated, followed by antigen retrieval by using Antigen Unmasking Buffer (Vector Laboratories, Inc., Burlingame, CA), permeabilized in 0.4% Triton X-100/TBS. Slides were blocked with 3% IgG-free BSA (Jackson ImmunoResearch Laboratories, West Grove, PA), followed by antimouse insulin (DAKO Corp., Carpinteria, CA), Ki67 (BD Pharmingen, Franklin Lakes, NJ), Mucin-1, p27, p21, p16 (Santa Cruz Biotechnology, Inc., Santa Cruz, CA) antibody. Fluorescein isothiocyanate- or Cy3-conjugated antimouse antibodies (Jackson ImmunoResearch Laboratories) were used as a secondary antibody. In situ cell death detection assay (TUNEL) was performed followed by manufacturer's instruction (Roche, Indianapolis, IN). Slides were mounted with Vectashield with 4′,6-diamidino-2-phenylindole (DAPI) (Vector Laboratories), and images were obtained using a Leica DM 6000 microscope (Leica Corp., Deerfield, IL) with Openlab software.

β-Cell mass.

β-Cell mass was measured as previously described (14). In brief, four to six sections from each pancreas were stained with antimouse insulin antibody and scanned by a Leica DM6000 microscope. Montage images were made by ImageJ software. The cross-sectional areas of pancreas and β-cells were determined by ImagePro software. β-Cell mass per pancreas was estimated as the product of the relative cross-sectional area of β-cells per total tissue and the weight of the pancreas and calculated by examining pancreata from at least three animals for each genotype.

Immunoblotting.

Lysates from human islets or Min6 cells were extracted and quantified by Qubit assay (Invitrogen), and equal amount of proteins were resolved by SDS-PAGE, followed by transfer to polyvinylidene difluoride membrane for immunoblotting. The indicated proteins were detected by incubating specific antibodies against Skp2, p16, p27 (Santa Cruz), Irs2 (Cell Signaling Technology, Inc., Danvers, MA) and β-Tubulin (Sigma-Aldrich). Protein levels were normalized to the protein levels of housekeeping gene β-Tubulin. Quantifications were done by ImageJ and ImagePro software.

siRNA and transfection.

Knockdown of Irs2 expression was achieved by gene-specific siRNA. Irs2 siRNA (Dharmacon, Lafayette, CO) was designed corresponding to the target sequences 5′-AATAGCTGCAAGAGCGATGAC-3′, and scrambled siRNA targeting firefly luciferase (5′-CTGACGCGGAATACTTCGA-3′) was used as a control. Min6 cells and human islets were transfected by using Lipofectamine-2000 (Invitrogen).

RNA isolation, RT-PCR, and real-time PCR.

RNA was isolated from cultured Min6 cells or islets using TRI Reagent (Molecular Research Center, Cincinnati, OH). cDNA was synthesized by Superscript III Reverse transcriptase (Invitrogen) with oligo dT priming. Taq PCR Master Mix Kit (QIAGEN, Chatsworth, CA) was used for PCR with the following primers: Irs2 forward, AGTAAACGGAGGTGGCTACA; Irs reverse, 5′-AAGCTGCTGAGAAGTCAGGT; Tubulin forward, 5′-GTTGGCCAGGCTGGTGTCCAG-3′; Tubulin reverse, 5′-CTGTGATGAGCTGCTCAGGGTGG-3′. Real-time RT-PCR were performed using the 7900HT Fast Real-Time PCR System (Applied Biosystems, Foster City, CA). The expression levels of each transcript were normalized to the housekeeping gene Cyclophilin. Data shown are the averages from three experiments, each performed in triplicate.