Abstract
Although extended-spectrum-β-lactamase (ESBL)-producing aeromonads have been increasingly reported in recent years, most of them were isolates from case reports or environmental isolates. To investigate the prevalence of ESBL producers among Aeromonas blood isolates and the genes encoding ESBLs, consecutive nonduplicate Aeromonas blood isolates collected at a medical center in southern Taiwan from March 2004 to December 2008 were studied. The ESBL phenotypes were examined by clavulanate combination disk test and the cefepime-clavulanate ESBL Etest. The presence of ESBL-encoding genes, including blaTEM, blaPER, blaCTX-M, and blaSHV genes, was evaluated by PCR and sequence analysis. The results showed that 4 (2.6%) of 156 Aeromonas blood isolates, 1 Aeromonas hydrophila isolate and 3 Aeromonas caviae isolates, expressed an ESBL-producing phenotype. The ESBL gene in two A. caviae isolates was blaPER-3, which was located in both chromosomes and plasmids, as demonstrated by Southern hybridization. Of four patients with ESBL-producing Aeromonas bacteremia, two presented with catheter-related phlebitis and the other two with primary bacteremia. Three patients had been treated with initial noncarbapenem β-lactams for 5 to 10 days, and all survived. In conclusion, ESBL producers exist among Aeromonas blood isolates, and clinical suspicion of ESBL production should be raised in treating infections due to cefotaxime-resistant Aeromonas isolates.
INTRODUCTION
Aeromonads, oxidase-producing Gram-negative rods, are aquatic microorganisms and have been implicated in a variety of human diseases (11). Three well-known principal classes of β-lactamases recognized in aeromonads are class C cephalosporinases, class D penicillinases, and class B metallo-β-lactamases (MBL) (11), whereas production of extended-spectrum β-lactamases (ESBLs) has received little attention. ESBLs belong to the class A β-lactamases according to Ambler's classification (1a). They confer resistance to all penicillins, older and newer cephalosporins, and monobactams but not to cephamycins or carbapenems, and they are inactivated by β-lactamase inhibitors such as clavulanate. ESBL-producing aeromonads have been increasingly reported in recent years. The earliest report of a clinical case, in 2003, described a fecal A. caviae strain harboring ESBL blaTEM-24 from an aged patient with intestinal ischemia (16). Later on, ESBL-producing environmental isolates were reported, including isolates carrying blaPER-1 from sludge in Switzerland (24), isolates carrying blaPER-1, blaPER-6, blaSHV-12, blaVEB-1a, blaTLA-2, or blaGES-7 from the Seine River (8, 15), and Aeromonas hydrophila isolates from an urban river in China (15). However, no study focused on the prevalence and clinical manifestations of infections caused by ESBL-producing aeromonads. The aim of this study was to investigate the prevalence of ESBL producers among Aeromonas blood isolates, to investigate the genes encoding ESBLs, and to describe the clinical features of infected patients. A literature review in search of clinical cases was also conducted, with the hope of better understanding the current status of ESBLs among clinical Aeromonas isolates.
MATERIALS AND METHODS
Bacterial isolates.
Aeromonas blood isolates identified in the clinical microbiology laboratory of National Cheng Kung University Hospital (NCKUH), a university-affiliated medical center in southern Taiwan, from March 2004 to December 2008 were collected and stored at −70°C until use. For each patient, if multiple isolates of the same species with identical antimicrobial susceptibility profiles were obtained, only the first was taken into account. The genus Aeromonas was identified by the positive oxidase test, fermentation of d-glucose, motility, the absence of growth in 6.5% sodium chloride, and resistance to the vibriostatic agent O/129 (150 μg), and the identification was confirmed by the API 20E system (BioMérieux, Marcy-l'Etoile, France). Identification of Aeromonas species was based on the sequence analysis of the partial rpoB gene by PCR with the primers Pasrpob-L (5′-GCAGTGAAAGARTTCTTTGGTTC-3′) and Rpob-R (5′ GTTGCATGTTNGNACCCAT 3′) under the conditions previously described (12). The sequences of amplified DNA products were compared with reference sequences available at the GenBank database using a BLAST search (http://www.ncbi.nlm.nih.gov/BLAST/).
Antimicrobial susceptibility tests.
The ESBL phenotype was examined by tests proposed for the detection of ESBLs in Enterobacteriaceae by the Clinical and Laboratory Standards Institute (CLSI) (3). Aeromonas isolates that demonstrated a diameter of inhibition zone of ceftazidime (30 μg) of ≤22 mm or of cefotaxime (30 μg) of ≤27 mm by the disk diffusion method—i.e., reduced susceptibility to expanded-spectrum cephalosporins—were examined by a phenotypic confirmatory test, i.e. the ceftazidime-clavulanate and cefotaxime-clavulanate combination disk test (CDT), and the cefepime-clavulanate ESBL Etest (AB Biodisk, Solna, Sweden). The presence of ESBL was determined by a ≥5-mm increase in zone diameters for ceftazidime/clavulanate, cefotaxime/clavulanate, or cefepime/clavulanate compared with those for ceftazidime, cefotaxime, or cefepime alone by CDT. Either a cefepime MIC reduction by ≥3 2-fold dilutions with clavulanate or a rounded phantom inhibition zone below the cefepime gradients with no ellipse visible around the cefepime end was also indicative of the presence of ESBL activity (30). The MICs of doxycycline, imipenem, ertapenem, piperacillin-tazobactam, cefotaxime, ceftazidime, and levofloxacin for ESBL-producing isolates were determined by Etest, and the results were interpreted following CLSI recommendations for A. hydrophila complex (4). Genetic relatedness of ESBL producers of the same species was examined by arbitrarily primed PCR with primers ERIC-1R (5′-ATGTAAGCTCCTGGGGATTCAC-3′) and ERIC-2R (5′-AGTAAGTGACTGGGGTGAGCG-3′) (25).
Detection of ESBL genes by PCR.
For all phenotypically confirmed ESBL-producing Aeromonas isolates, PCR amplification, cloning, and DNA sequence analyses were conducted to determine the ESBL genotypes, including blaTEM, blaPER, blaCTX-M, and blaSHV genes, as well as the presence of the MBL blaCphA gene and the AmpC β-lactamase blaMOX gene by using previously described PCR primers and conditions (5, 17–19, 28, 34) (Table 1). The sequences of amplified DNA products were compared with the GenBank database to identify the types of β-lactamase genes.
Table 1.
PCR primers used to detect genes encoding ESBLs, MBL (blaCphA), and AmpC-β-lactamase (blaMOX) among four ESBL-producing Aeromonas blood isolates
| β-Lactamase(s) targeted | Primer name | Primer sequence (5′-3′) | Reference or source |
|---|---|---|---|
| blaTEM | TEM-2A(F) | CCCCTATTTGTTTATTTTTCT | 34 |
| TEM-1B(R) | GACAGTTACCAATGCTTAAT | ||
| blaSHV | SHV-3A(F) | CCGGGTTATTCTTATTTGTC | 19 |
| SHV-2B(R) | TAGCGTTGCCAGTGCTCGAT | ||
| blaPER | PER-A(F) | ATGAATGTCATTATAAAAGC | 18 |
| PER-B(R) | TTAATTTGGGCTTAGGGCAGAA | ||
| blaCTX-M group 1 (blaCTX-M-1, blaCTX-M-3, blaCTX-M-151) | MultiCTXMGp1(F) | TTAGGAARTGTGCCGCTGYA | 5 |
| MultiCTXMGp1-2(R) | CGATATCGTTGGTGGTRCCAT | ||
| blaCTX-M group 2 (blaCTX-M-2) | MultiCTXMGp2(F) | CGTTAACGGCACGATGAC | 5 |
| MultiCTXMGp1-2(R) | CGATATCGTTGGTGGTRCCAT | ||
| blaCTX-M group 9 (blaCTX-M-9, blaCTX-M-14) | MultiCTXMGp9(F) | TCAAGCCTGCCGATCTGGT | 5 |
| MultiCTXMGp9(R) | TGATTCTCGCCGCTGAAG | ||
| blaCTX-M-13 | CTXM-13U(F) | GGTTAAAAAATCACTGCGTC | 28 |
| CTXM-13L(R) | TTGGTGACGATTTTAGCCGC | ||
| blaCphA | CPHA(F) | GCTTAGAGCTCCTAAGGAGCAAGATGAAAGGTTGG | 17 |
| CPHA(R) | GCATAGGTACCTTATGACTGGGGTGCGGCCTTG | ||
| blaMOX | MOX(F) | CAACGACAATCCATCCTGTG | This study |
| MOX(R) | CCTATGCTGGGGTTGGAGTA |
Localization of the blaPER-3 gene.
The location of the blaPER-3 gene was analyzed by using the S1 nuclease technique as described previously (22). Southern hybridization was performed with a digoxigenin (DIG)-labeled blaPER-3 gene specific probe, obtained by PCR amplification with the primers PER-A(F) and PER-R1 (5′-CTCGTCTCCCTGATACGCTTTC-3′) using a DIG system (DIG DNA labeling and detection kit; Roche Diagnostics, Germany) according to the manufacturer's instructions (29).
Patients and literature review.
Medical records of patients with ESBL-producing Aeromonas bacteremia were reviewed to collect the clinical data. The severity of acute illness at the onset of Aeromonas bacteremia was assessed within 1 day after admission by the Pittsburgh bacteremia score, a previously validated scoring system that was based on mental status, body temperature, blood pressure, requirement for mechanical ventilation, and recent cardiac arrest (2). Critical illness was defined as a Pittsburgh bacteremia score of ≥4 points. An English-language literature review was also conducted to find clinical cases of patients with ESBL-producing Aeromonas infections by querying the PubMed database between April 1993 and April 2011 with the keywords “Aeromonas” and “extended-spectrum beta-lactamase”.
RESULTS
Isolates with the ESBL phenotype.
During the study period, 156 consecutive nonduplicate Aeromonas blood isolates were collected. Fifty-five (35%) Aeromonas blood isolates with reduced susceptibility to expanded-spectrum cephalosporins were examined for the ESBL phenotype by the CDT and ESBL Etest. By CDT with ceftazidime, cefotaxime, and cefepime with and without clavulanate, a ≥5-mm increase in zone diameter was demonstrated in isolates of A. hydrophila A2-970201 (from patient A), Aeromonas caviae A2-970915 (patient B), A. caviae A2-971106 (patient C), and A. caviae A2-960104 (patient D). By ESBL Etest, the same four isolates demonstrated a MIC reduction by ≥3 2-fold dilutions with clavulanate. Overall, four isolates (2.6%) of 156 blood isolates, one A. hydrophila isolate and three A. caviae isolates, expressed ESBL phenotypes. Arbitrarily primed PCR of three A. caviae isolates showed three distinct gel patterns, suggestive of genetically unrelated strains. By Etest, all four ESBL producers were susceptible to imipenem, ertapenem, and levofloxacin and resistant to cefotaxime and ceftazidime. Two isolates were susceptible to cefepime, and three were susceptible to piperacillin-tazobactam. A profile of the antimicrobial susceptibility of these isolates is shown in Table 2.
Table 2.
Profiles of antimicrobial susceptibility and the genes encoding ESBLs, MBL, and AmpC β-lactamases in ESBL-producing Aeromonas blood isolates
| Parametera | Resultb for: |
||||
|---|---|---|---|---|---|
| A. hydrophila (A2-970201) | A. caviae (A2-970915) | A. caviae (A2-971106) | A. caviae (A2-960104) | ESBL-producing K. pneumoniae (ATCC 700603)c | |
| Disk diffusion, zone diam (mm) | |||||
| Cefotaxime/cefotaxime-clavulanate (Δ) | 14/19 (5) | 7/30 (23) | 7/27 (20) | 17/23 (6) | 22/28 (6) |
| Ceftazidime/ceftazidime-clavulanate (Δ) | 12/25 (13) | 7/29 (22) | 7/26 (19) | 15/23 (8) | 14/26 (12) |
| Cefepime/cefepime-clavulanate (Δ) | 22/30 (8) | 17/29 (12) | 9/24 (15) | 18/24 (6) | 23/28 (5) |
| MIC by Etest (μg/ml) | |||||
| Cefepime/cefepime-clavulanate | 6/<0.064 | >16/<0.064 | >16/<0.064 | 6/0.125 | <0.25/0.064 |
| Cefepime | 6 (S) | 24 (I) | >256 (R) | 6 (S) | 1 |
| Doxycycline | 2 | 8 | 12 | 1.5 | 16 |
| Imipenem | 0.25 (S) | 0.19 (S) | 0.25 (S) | 0.25 (S) | 0.19 |
| Ertapenem | 0.032 (S) | 0.012 (S) | 0.047 (S) | 0.25 (S) | 0.032 |
| Piperacillin-tazobactam | 2 (S) | 16 (S) | 24 (I) | 12 (S) | 4 |
| Cefotaxime | 24 (R) | >256 (R) | >256 (R) | 32 (R) | 3 |
| Ceftazidime | 48 (R) | >256 (R) | >256 (R) | 48 (R) | 12 |
| Levofloxacin | 0.125 (S) | 0.75 (S) | 2 (S) | 0.38 (S) | 0.38 |
| Detection of genes with specific primers | |||||
| ESBL genes | |||||
| blaPER | − | blaPER-3 | blaPER-3 | − | − |
| blaTEM | −d | −d | −d | − | − |
| blaSHVc | − | − | − | − | − |
| blaCTX-Me | − | − | − | − | − |
| MBL gene, blaCphA | + | − | − | − | − |
| AmpC β-lactamase gene, blaMOX | + | − | + | + | − |
Δ, increase of zone diameter (mm).
S, susceptible; I, intermediate; R, resistant.
Klebsiella pneumoniae ATCC 700603 harboring the blaSHV-18 gene was used as a quality control strain.
The blaTEM-116 gene, whose product is not an ESBL, was found.
Two clinical strains of K. pneumoniae harboring the blaCTM- 9 gene and the blaCTM-13 gene were used as quality control strains.
Detection of ESBL genes.
Two A. caviae isolates, A2-970915 and A2-971106, carried the blaPER gene, which was 100% (927/927 nucleotides) identical to the complete sequence of the A. caviae ESBL blaPER-3 gene (GenBank accession number AY740681). Three isolates, A2-970201, A2-970915, and A2-971106, possessed the blaTEM-116 gene, with 99.2% to 100% identity to the A. hydrophila blaTEM-116 gene (GenBank accession no. FJ767900). None of the four ESBL-producing isolates had blaCTX-M or blaSHV genes. The genes responsible for the ESBL phenotype in isolates A2-970201 and A2-960104 were not identified.
Other genes encoding β-lactamases, including the blaCphA gene in A. hydrophila A2-970201 and the blaMOX-6-like gene (96% to 99% identical to A. caviae blaMOX-6; GenBank accession no. GQ152601) in A. hydrophila A2-970201, A. caviae A2-971106, and A. caviae A2-960104, were found (Table 2).
Localization of the blaPER-3 gene.
The result of Southern hybridization for determining the localization of blaPER-3 gene in two A. caviae isolates demonstrated that the blaPER-3 gene was localized on both chromosomes and plasmids of these two isolates (Fig. 1).
Fig. 1.

The localization of the blaPER-3 gene was determined by genomic mapping with S1 nuclease digestion by pulsed-field gel electrophoresis (A) and hybridizations with probes for the blaPER-3 gene (B). The genomic DNA of A. caviae A2-970915 and A. caviae A2-971106 was undigested (lanes 1 and 5) or was digested with S1 nuclease (lanes 2 and 4). Lane 3, Lambda ladder PFG marker (New England BioLabs). ←, linearized chromosomes; ★, plasmids.
Patients and literature review.
Clinical details of four patients with ESBL-producing Aeromonas bacteremia are shown in Table 3. They developed Aeromonas bacteremia at 5 to 19 days after admission, and three (patients B, C, and D) did not receive antibiotics in the preceding 1 month. Two patients presented with catheter-related phlebitis, and two patients with cancers of the digestive tract presented with primary bacteremia; the Pittsburgh bacteremia scores of all four patients were less than 4. Three patients (B, C, and D) had been empirically treated with penicillin derivatives or cephalosporin for 5 to 10 days, and all four survived for at least 2 weeks after the onset of bacteremia.
Table 3.
Clinical features of patients with ESBL-producing Aeromonas infections in the present study and the literature
| Patient | Species | Age/genderb | Coexisting condition | Specimen for culture | Clinical diagnosis | Acquisition of infections | Pittsburgh bacteremia score | Treatmenta | Outcome at 2 weeks |
|---|---|---|---|---|---|---|---|---|---|
| Present study | |||||||||
| A (A2-970201) | A. hydrophila | 70/F | Post-lumbar spine surgery for degenerative disease | Blood | Bacteremia, hand phlebitis | Hospital, probably phlebitis | 1 | NA, due to hospital transfer | Survived |
| B (A2-970915) | A. caviae | 55/M | Tongue cancer with lung metastasis | Blood | Primary bacteremia | Hospital, unknown route of entry | 1 | TZP (d1-5), IPM (d6-10) | Survived |
| C (A2-971106) | A. caviae | 52/M | Esophageal cancer | Blood | Primary bacteremia (polymicrobialc) | Hospital, unknown route of entry | 1 | AMC (d1-3), CTX (d4-7), ETP (d8-14) | Survived |
| D (A2-960104) | A. caviae | 65/F | Aplastic anemia | Blood | Bacteremia, hand phlebitis | Hospital, probably phlebitis | 1 | FEP (d1-3), CAZ (d4-10), LVX (d4-17) | Survived |
| Reported in the literature | |||||||||
| 2003 (16) | A. caviae | 76/M | NAd | Feces | Intestinal ischemia | NA | NA | NA | NA |
| 2004 (7) | A. hydrophila | 87/F | Rheumatoid polyarthritis | Wound | Necrotizing fasciitis | NA | NA | Disease progressed with AMC, CRO, MET | NA |
| 2005 (26) | A. hydrophila | 3/M | Blood | Bacteremia, pneumonia | Community, ingestion of nonpotable water | NA | Disease progressed with CTX, OXA, VAN, SAM, and KLA, improved with IPM | Survived | |
| 2010 (35) | A. caviae | 68/M | Lung cancer | Sputum | Pneumonia | Community | NA | CPZ, CIP (d1-5), IMP (d5-8) | Died |
Abbreviations of antibiotics: IPM, imipenem; AMC, amoxicilin/clavulanate; CTX, cefotaxime; ETP, ertapenem; CAZ, ceftazidime; LVX, levofloxacin; TZP, piperacillin-tazobactam; CIP, ciprofloxacin; CPZ, cefoperazone; MET, metronidazole; FEP, cefepime; CRO, ceftriaxone; OXA, oxacillin; VAN, vancomycin; KLA, clarithromycin. NA, not available. d, days. D1 was defined as the day of bacteremia onset. “D1-5” represented the period from the day of bacteremia onset to the fifth day after bacteremia onset.
Age in years; F, female; M, male.
Co-pathogens isolated from blood: Escherichia coli, Acinetobacter baumannii, Enterococcus faecium, Streptococcus angiosus, coagulase-negative staphylococci.
NA, not available.
A literature review found four clinical cases, including a pediatric patient with A. hydrophila sepsis and pneumonia (26), an aged patient with necrotizing fasciitis caused by an A. hydrophila isolate harboring blaTEM-24 (7), an aged patient with intestinal ischemia with a fecal isolate of A. caviae harboring blaTEM-24 (16), and an aged patient with pneumonia caused by an A. caviae isolate harboring blaCTX-M-3 (35) (Table 3). Among three published cases with known clinical courses, the clinical conditions of two patients with pneumonia and one patient with necrotizing fasciitis deteriorated with initial noncarbapenem antimicrobial therapy.
DISCUSSION
To date, though there is no standard method for detection of ESBLs among aeromonads, most studies have adopted clavulanate-based synergy tests (7, 26), such as those recommended for phenotypic confirmation of ESBL-producing Enterobacteriaceae by CLSI (3). However, using expanded-spectrum cephalosporins as ESBL substrates, antagonism by clavulanate on ESBL may be masked by the coexistence of AmpC β-lactamases. Aeromonas hydrophila and A. caviae isolates have been reported to possess chromosomal AmpC β-lactamase genes (11), as noted in our three isolates. Therefore, the synergy test with cefepime, a novel cephalosporin not hydrolyzed by AmpC β-lactamases, was also applied in this study. The results of different methods for detection of the ESBL phenotype—i.e., CDT using ceftazidime, cefotaxime, and cefepime with and without clavulanate and the cefepime-clavulanate ESBL Etest—were concordant, with all detecting the same four ESBL producers. However, the limited number of ESBL isolates in this study makes it uncertain that the performance of a ceftazidime- or cefotaxime-based combination disk method would be identical to that of the cefepime-based synergy test. Although more investigations are warranted, the cefepime-based synergy test may be helpful in screening the ESBL phenotype among aeromonads carrying AmpC β-lactamases.
Among four ESBL producers, two A. caviae isolates and one A. hydrophila isolate harbored the blaTEM-116 gene. Studies demonstrated that none of the environmental Aeromonas isolates (1) or clinical Klebsiella pneumoniae isolates carrying the blaTEM-116 gene expressed ESBL phenotypes (14), and therefore the blaTEM-116 gene is not thought to be associated with ESBL activity. The blaPER-3 gene was first identified in an A. caviae isolate in France and was found to be located within the class 1 integron In39 (31). Its product is the ESBL PER-3, and it is considered to be responsible for the ESBL activity in two A. caviae isolates in the present study. We further demonstrated that the blaPER-3 gene was located in both chromosome and plasmids of the two isolates. So far, this is the second report of blaPER-3 ESBL among aeromonads in the literature. The original acquisition of the blaPER-3 gene in A. caviae is undefined, but the blaPER-3 gene is closely related to the blaPER-1 gene, with 99% identity (9). Although ESBLs of the PER type were not the most common ESBLs identified, the spread of Enterobacteriaceae carrying the PER-1 ESBL gene as a chromosomal insert has been recently reported in Europe (23). Emergence of blaPER-1 ESBLs was also noted among ESBL-producing Acinetobacter baumannii and Pseudomonas aeruginosa isolates in Europe and Asia (6, 32). Further, the horizontal transfer of mobile genetic elements, such as plasmids and integrons, was found to be attributable to an increasing incidence of multidrug resistance among environmental Aeromonas isolates (10). Therefore, it is possible that the blaPER gene was horizontally transferred by mobile genetic elements between aeromonads and coexistent waterborne bacteria in aquatic environments or between coexistent flora or pathogens in human beings.
As with Aeromonas infections described previously (11, 33), the clinical spectrum of patients with ESBL-producing Aeromonas infections in the present study and the literature included primary bacteremia, catheter-related infections, necrotizing fasciitis, pneumonia, and gastroenteritis. These infections occurred in both community and nosocomial settings. It is generally believed that patients acquire aeromonads from oral consumption of or direct mucocutaneous contact with contaminated water or seafood (11), whereas the risk factors associated with acquisition of ESBL-producing Aeromonas infections are not known due to their rarity. Prior administration of antibiotics is one of the well-known risk factors for infections caused by other ESBL-producing Enterobacteriaceae (20). However, most of our patients did not receive prior antibiotics, which made the association of prior exposure of antibiotics with development of ESBL-producing Aeromonas infections not evident. Further clinical investigations involving more patients are warranted to identify the risk factors for ESBL-producing Aeromonas infections, as well as surveillance of water from both hospitals and communities and suspicious foods to explore the possible sources of infections.
Although clinical studies have shown that survival was better with carbapenem treatment than with a cephalosporin among patients with bacteremia caused by ESBL-producing K. pneumoniae or Enterobacter cloacae (13, 21), the optimal antimicrobial therapy for ESBL-producing Aeromonas infections is not standardized. Among three published cases, the clinical conditions of two patients with pneumonia and one patient with necrotizing fasciitis deteriorated with initial noncarbapenem antimicrobial therapy (7, 26, 35). In contrast, our three patients, not critically ill as defined by their Pittsburgh bacteremia scores, remained stable with empirical noncarbapenem β-lactam agents, and all survived. The causes contributing to the poor outcome of previously published cases were not known. The difference in severity of illness at the time of antibiotic initiation, carriage and expression of toxins of each disease-causing aeromonad, or bacterial loads in clinical diseases might be the possible reasons. Theoretically carbapenems, not hydrolyzed by ESBLs, would work better than penicillins or cephalosporins against ESBL producers. However, antibacterial activity of carbapenems may be hampered by the production of blaCphA MBLs in A. hydrophila, A. veronii, and A. jandaei isolates, which is not easily detected by in vitro susceptibility tests unless a large inoculum is used (27). It is too early to conclude the appropriateness of antimicrobial therapy from the clinical experiences of limited cases. Perhaps to avoid the complexity of β-lactamase production in clinical Aeromonas isolates, a fluoroquinolone could be the reasonable choice for invasive Aeromonas infections.
In conclusion, of 156 Aeromonas blood isolates, 4 (2.6%) exhibited the ESBL phenotype, and two A. caviae isolates possessed the blaPER-3 genes, which were located in both chromosomes and plasmids. The complexity of β-lactamase production increases among clinical Aeromonas isolates, and clinical use of β-lactam agents for invasive Aeromonas infections should be undertaken with caution.
ACKNOWLEDGMENTS
This study was supported by grants from the National Science Council, Taiwan (NSC 96-2628-B-006-004-MY3 and NSC 98-2320-B-006-029), National Cheng Kung University Hospital, Tainan, Taiwan (NCKUH-9803030), Department of Health, Executive Yuan (DOH100-TD-B-111-002), and National Health Research Institutes, Taiwan (id-100-pp-17).
We thank Pei-Chen Wu for the laboratory work.
Footnotes
Published ahead of print on 3 October 2011.
REFERENCES
- 1. Balsalobre L. C., et al. 2010. Presence of blaTEM-116 gene in environmental isolates of Aeromonas hydrophila and Aeromonas jandaei from Brazil. Braz. J. Microbiol. 41: 718–719 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 1a. Bush K., Jacoby G. A., Medeiros A. A. 1995. A functional classification scheme for beta-lactamases and its correlation with molecular structure. Antimicrob. Agents Chemother. 39: 1211–1233 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2. Chow J. W., Yu V. L. 1999. Combination antibiotic therapy versus monotherapy for gram-negative bacteraemia: a commentary. Int. J. Antimicrob. Agents 11: 7–12 [DOI] [PubMed] [Google Scholar]
- 3. CLSI 2009. Performance standards for antimicrobial susceptibility testing; nineteenth informational supplement. CLSI document M100-S19 Clinical and Laboratory Standards Institute, Wayne, PA [Google Scholar]
- 4. CLSI 2010. Methods for antimicrobial dilution and disk susceptibility testing of infrequently isolated or fastidious bacteria; approved guideline, 2nd ed. CLSI document M45-A2 Clinical and Laboratory Standards Institute, Wayne, PA [Google Scholar]
- 5. Dallenne C., Da Costa A., Decre D., Favier C., Arlet G. 2010. Development of a set of multiplex PCR assays for the detection of genes encoding important beta-lactamases in Enterobacteriaceae. J. Antimicrob. Chemother. 65: 490–495 [DOI] [PubMed] [Google Scholar]
- 6. Empel J., et al. 2007. Outbreak of Pseudomonas aeruginosa infections with PER-1 extended-spectrum beta-lactamase in Warsaw, Poland: further evidence for an international clonal complex. J. Clin. Microbiol. 45: 2829–2834 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7. Fosse T., et al. 2004. Aeromonas hydrophila with plasmid-borne class A extended-spectrum beta-lactamase TEM-24 and three chromosomal class B, C, and D β-lactamases, isolated from a patient with necrotizing fasciitis. Antimicrob. Agents Chemother. 48: 2342–2343 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8. Girlich D., Poirel L., Nordmann P. 2011. A diversity of clavulanic acid-inhibited extended-spectrum β-lactamases in Aeromonas spp. from the Seine River, Paris, France. Antimicrob. Agents Chemother. 55: 1256–1261 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9. Girlich D., Poirel L., Nordmann P. 2010. PER-6, an extended-spectrum β-lactamase from Aeromonas allosaccharophila. Antimicrob. Agents Chemother. 54: 1619–1622 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10. Jacobs L., Chenia H. Y. 2007. Characterization of integrons and tetracycline resistance determinants in Aeromonas spp. isolated from South African aquaculture systems. Int. J. Food Microbiol. 114: 295–306 [DOI] [PubMed] [Google Scholar]
- 11. Janda J. M., Abbott S. L. 2010. The genus Aeromonas: taxonomy, pathogenicity, and infection. Clin. Microbiol. Rev. 23: 35–73 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12. Kupfer M., Kuhnert P., Korczak B. M., Peduzzi R., Demarta A. 2006. Genetic relationships of Aeromonas strains inferred from 16S rRNA, gyrB and rpoB gene sequences. Int. J. Syst. Evol. Microbiol. 56: 2743–2751 [DOI] [PubMed] [Google Scholar]
- 13. Lee C. C., et al. 2010. Bacteremia due to extended-spectrum β-lactamase-producing Enterobacter cloacae: role of carbapenem therapy. Antimicrob. Agents Chemother. 54: 3551–3556 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14. Lin T. L., et al. 2006. Extended-spectrum β-lactamase genes of Klebsiella pneumoniae strains in Taiwan: recharacterization of shv-27, shv-41, and tem-116. Microb. Drug Resist. 12: 12–15 [DOI] [PubMed] [Google Scholar]
- 15. Lu S. Y., et al. 2010. High diversity of extended-spectrum β-lactamase-producing bacteria in an urban river sediment habitat. Appl. Environ. Microbiol. 76: 5972–5976 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16. Marchandin H., et al. 2003. Extended-spectrum β-lactamase TEM-24 in an Aeromonas clinical strain: acquisition from the prevalent Enterobacter aerogenes clone in France. Antimicrob. Agents Chemother. 47: 3994–3995 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17. Massidda O., Rossolini G. M., Satta G. 1991. The Aeromonas hydrophila cphA gene: molecular heterogeneity among class B metallo-β-lactamases. J. Bacteriol. 173: 4611–4617 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18. Nordmann P., Naas T. 1994. Sequence analysis of PER-1 extended-spectrum β-lactamase from Pseudomonas aeruginosa and comparison with class A β-lactamases. Antimicrob. Agents Chemother. 38: 104–114 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19. Nuesch-Inderbinen M. T., Hachler H., Kayser F. H. 1996. Detection of genes coding for extended-spectrum SHVβ-lactamases in clinical isolates by a molecular genetic method, and comparison with the E test. Eur. J. Clin. Microbiol. Infect. Dis. 15: 398–402 [DOI] [PubMed] [Google Scholar]
- 20. Paterson D. L., Bonomo R. A. 2005. Extended-spectrum β-lactamases: a clinical update. Clin. Microbiol. Rev. 18: 657–686 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21. Paterson D. L., et al. 2004. International prospective study of Klebsiella pneumoniae bacteremia: implications of extended-spectrum β-lactamase production in nosocomial infections. Ann. Intern. Med. 140: 26–32 [DOI] [PubMed] [Google Scholar]
- 22. Patzer J. A., Walsh T. R., Weeks J., Dzierzanowska D., Toleman M. A. 2009. Emergence and persistence of integron structures harbouring VIM genes in the Children's Memorial Health Institute, Warsaw, Poland, 1998–2006. J. Antimicrob. Chemother. 63: 269–273 [DOI] [PubMed] [Google Scholar]
- 23. Perilli M., et al. 2007. Spread of Enterobacteriaceae carrying the PER-1 extended-spectrum β-lactamase gene as a chromosomal insert: a report from Italy. J. Antimicrob. Chemother. 59: 323–324 [DOI] [PubMed] [Google Scholar]
- 24. Picao R. C., et al. 2008. Expanded-spectrum β-lactamase PER-1 in an environmental Aeromonas media isolate from Switzerland. Antimicrob. Agents Chemother. 52: 3461–3462 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25. Rice L. B., Bonomo R. A. 1996. Genetic and biochemical mechanisms of bacterial resistance to antimicrobial agents, p. 453–501 In Lorian V. (ed.), Antibiotics in laboratory medicine, 4th ed. Williams & Wilkins, Baltimore, MD [Google Scholar]
- 26. Rodriguez C. N., et al. 2005. Sepsis due to extended-spectrum β-lactamase-producing Aeromonas hydrophila in a pediatric patient with diarrhea and pneumonia. Clin. Infect. Dis. 41: 421–422 [DOI] [PubMed] [Google Scholar]
- 27. Rossolini G. M., et al. 1995. Distribution of cphA or related carbapenemase-encoding genes and production of carbapenemase activity in members of the genus Aeromonas. Antimicrob. Agents Chemother. 39: 346–349 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28. Saladin M., et al. 2002. Diversity of CTX-M β-lactamases and their promoter regions from Enterobacteriaceae isolated in three Parisian hospitals. FEMS Microbiol. Lett. 209: 161–168 [DOI] [PubMed] [Google Scholar]
- 29. Sambrook J., Russell D. W. 2001. Molecular cloning: a laboratory manual, 3rd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY [Google Scholar]
- 30. Sturenburg E., Sobottka I., Noor D., Laufs R., Mack D. 2004. Evaluation of a new cefepime-clavulanate ESBL Etest to detect extended-spectrum β-lactamases in an Enterobacteriaceae strain collection. J. Antimicrob. Chemother. 54: 134–138 [DOI] [PubMed] [Google Scholar]
- 31. Toleman M. A., Bennett P. M., Walsh T. R. 2006. ISCR elements: novel gene-capturing systems of the 21st century? Microbiol. Mol. Biol. Rev. 70: 296–316 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32. Wang H., et al. 2007. Molecular epidemiology of clinical isolates of carbapenem-resistant Acinetobacter spp. from Chinese hospitals. Antimicrob. Agents Chemother. 51: 4022–4028 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33. Wu C. J., et al. 2007. Clinical significance and distribution of putative virulence markers of 116 consecutive clinical Aeromonas isolates in southern Taiwan. J. Infect. 54: 151–158 [DOI] [PubMed] [Google Scholar]
- 34. Yan J. J., Wu S. M., Tsai S. H., Wu J. J., Su I. J. 2000. Prevalence of SHV-12 among clinical isolates of Klebsiella pneumoniae producing extended-spectrum β-lactamases and identification of a novel AmpC enzyme (CMY-8) in southern Taiwan. Antimicrob. Agents Chemother. 44: 1438–1442 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35. Ye Y., Xu X. H., Li J. B. 2010. Emergence of CTX-M-3, TEM-1 and a new plasmid-mediated MOX-4 AmpC in a multiresistant Aeromonas caviae isolate from a patient with pneumonia. J. Med. Microbiol. 59: 843–847 [DOI] [PubMed] [Google Scholar]
