ATP: a mediator for HCl-induced TRPV1 activation in esophageal mucosa

Jie Ma; Annamaria Altomare; Florian Rieder; Jose Behar; Piero Biancani; Karen M Harnett

doi:10.1152/ajpgi.00336.2011

. 2011 Sep 29;301(6):G1075–G1082. doi: 10.1152/ajpgi.00336.2011

ATP: a mediator for HCl-induced TRPV1 activation in esophageal mucosa

Jie Ma ^1,², Annamaria Altomare ^1,³, Florian Rieder ⁴, Jose Behar ¹, Piero Biancani ¹, Karen M Harnett ^1,^✉

PMCID: PMC3233789 PMID: 21960521

Abstract

In esophageal mucosa, HCl causes TRPV1-mediated release of calcitonin gene-related peptide (CGRP) and substance P (SP) from submucosal neurons and of platelet-activating factor (PAF) from epithelial cells. CGRP and SP release was unaffected by PAF antagonists but reduced by the purinergic antagonist suramin. ATP caused CGRP and SP release from esophageal mucosa, confirming a role of ATP in the release. The human esophageal epithelial cell line HET-1A was used to identify epithelial cells as the site of ATP release. HCl caused ATP release from HET-1A, which was reduced by the TRPV1 antagonist 5-iodoresiniferatoxin. Real-time PCR demonstrated the presence of mRNA for several P2X and P2Y purinergic receptors in epithelial cells. HCl also increased activity of lyso-PAF acetyl-CoA transferase (lyso-PAF AT), the enzyme responsible for production of PAF. The increase was blocked by suramin. ATP caused a similar increase, confirming ATP as a mediator for the TRPV1-induced increase in enzyme activity. Repeated exposure of HET-1A cells to HCl over 2 days caused upregulation of mRNA and protein expression for lyso-PAF AT. Suramin blocked this response. Repeated exposure to ATP caused a similar mRNA increase, confirming ATP as a mediator for upregulation of the enzyme. Thus, HCl-induced activation of TRPV1 causes ATP release from esophageal epithelial cells that causes release of CGRP and SP from esophageal submucosal neurons and activation of lyso-PAF AT, the enzyme responsible for the production of PAF in epithelial cells. Repeated application of HCl or of ATP causes upregulation of lyso-PAF AT in epithelial cells.

Keywords: purinergic receptors, vanilloid receptors, platelet-activating factor, calcitonin gene-related peptide, substance P

esophagitis was thought to develop from a chemical injury starting at the luminal surface of the squamous epithelium, progressing through epithelium and lamina propria into the submucosa and resulting in acid-induced death of surface cells and stimulation of a proliferative response in the basal cells (20). Epithelial cells were viewed as bystanders in the process of inflammation, functioning primarily as a protective barrier to infiltration of noxious chemicals and bacteria into the underlying tissue. Recent evidence, however, in the urinary bladder (5) and in the esophagus suggests that these cells function as primary transducers of physical and chemical stimuli and communicate with underlying cells, including nerves (14), smooth muscle (11, 12), and even inflammatory cells (26).

We propose that acid-induced inflammation of the esophagus begins with activation of acid-sensitive vanilloid receptors (TRPV1) in the mucosa. TRPV1 activation induces synthesis and release of the sensory neurotransmitters calcitonin gene-related peptide (CGRP) and substance P (SP) from submucosal neurons and of the lipid inflammatory mediator platelet-activating factor (PAF) by epithelial cells (14). Acid-induced release of PAF from epithelial cells induces production of inflammatory mediators in the circular muscle layer, such as interleukin-6, H₂O₂, interleukin-1β, and PAF. These mediators decrease muscle contraction and, possibly, initiate a self-sustaining cycle (11, 12) of motor abnormalities, leading to enhanced exposure of the mucosa to acid, which further increases inflammation. In addition, both PAF and SP are important inflammatory mediators released by esophageal mucosa in response to acid that attract and activate peripheral blood leukocytes, thus promoting immune cell infiltration and activity (26).

In human esophageal epithelial cells, we have previously reported the pathway from capsaicin-induced activation of TRPV1 to production of PAF. We demonstrated that, in these cells, PAF production is directly linked to TRPV1 activation, resulting in increased intracellular Ca²⁺, activation of a p38-dependent transduction pathway, and production of PAF (27). The production of SP and CGRP in the mucosa, however, was not affected by the PAF receptor antagonist CV-3988, indicating that production of SP and CGRP by submucosal neurons does not depend on PAF release from epithelial cells (14).

ATP is a neurotransmitter in the central and peripheral nervous systems and is also involved in peripheral inflammation and transmission of the sensation of pain (2). Recently, the regulated release of ATP from nonneuronal sources has been shown to play a role in the activation of sensory nerve terminals (2). In the gut, intrinsic sensory nerves have cell bodies in the myenteric and submucosal plexi. They have projections to the mucosa and other enteric ganglia and are called intrinsic primary afferent neurons (18) or intrinsic sensory neurons (2). The epithelial cells lining the intestinal lumen have a life span of only a few days. Because of the short life span, the intrinsic sensory nerve terminals make very few specialized contacts with intestinal epithelial cells (2). To compensate for lack of direct contact with sensory neurons, epithelial cells may release sensory mediators during noxious stimuli, but little is known about the molecular basis for how the epithelial cells sense the primary stimulus and transduce it into release of a mediator. Burnstock (7, 8) has proposed that stretch stimuli in tubular organs may release ATP from epithelial cells, that then activates sensory nerve terminals. For example, epithelial cells in the bladder release ATP on distension, and the reflex can be blocked by P2 receptor antagonists or when the P2X3 receptor is knocked out (5, 7, 15, 43).

In the present investigation, we show that ATP is released by esophageal epithelial cells in response to HCl-induced TRPV1 activation and mediates release of neurotransmitters, such as SP and CGRP, and inflammatory mediators, such as PAF. In addition, repeated application of ATP causes upregulation of lyso-PAF acetyl-CoA transferase (lyso-PAF AT), the enzyme responsible for the production of PAF.

METHODS

Tissue preparation.

Experimental procedures were approved by the Animal Welfare Committee of Rhode Island Hospital. Adult rabbits weighing between 3.0 and 4.5 kg were used in this study. Animals were initially anesthetized with ketamine (Aveco, Fort Dodge, IA) and then killed with an overdose of phenobarbital (Schering, Kennilworth, NJ). The chest and abdomen were opened with a midline incision exposing the esophagus and stomach. The esophagus and stomach were removed together and separated immediately above the lower esophageal sphincter. The esophagus was pinned on a wax block, and the muscle layer was opened along the long axis and removed by sharp microdissection at the level of the submucosa, leaving the mucosa intact as a tube and taking care to keep the submucosa in its entirety with the mucosa preparation. The separation between mucosa and circular muscle was as close to the inner layer of the circular muscle as could be surgically achieved under the dissecting microscope. This procedure has been described in detail previously (13). The esophageal mucosal tube consisted of epithelial cells, lamina propria, muscularis mucosae, and submucosa, including submucosal and lamina propria neurons (14), with the epithelial layer on the inside. The esophageal mucosa tube was divided in two parts, and each part was tied at both ends. One was filled with Krebs buffer (0.5 ml/cm of tube) and used as a control; one was filled with the same volume of Krebs buffer equilibrated with HCl to pH 4.8–5.0. To assess the role of purinergic receptors, one sac was filled with pH 4.8–5.0 Krebs buffer with 10⁻⁴ M suramin. In previous work (13), we assessed epithelial cell viability after exposure of the mucosal sac preparation to acidic solutions of different pH by examining the percentage of cells excluding trypan blue and by measuring lactate dehydrogenase released in the supernatant as an index of cell death. Production of cytokines was highest at pH between 5.8 and 4.8 and declined when the pH was lowered to 4, most likely reflecting tissue damage or necrosis. Thus, in this rabbit model, we used pH 5.

Acid-filled and control sacs were kept in Krebs buffer with 95% O₂, 5% CO₂ at 37°C, for 3 h, using 1 ml of Krebs buffer/100 mg of mucosa. The pH of the supernatant remained at 7.0–7.4 and needed no adjustment. After 3 h, the supernatant surrounding the tubes was collected and analyzed. This experimental preparation has been described in detail previously (13).

To check if ATP may directly cause release of CGRP and SP from the mucosa, the esophageal mucosa was cut into strips, and some strips were pretreated with 10 U/ml apyrase to metabolize endogenous extracellular ATP and then rinsed and incubated in 10⁻⁴ M adenosine 5′-O-(3-thiotriphosphate) (ATPγS) for 10 min (47). The supernatant was collected and analyzed for the concentration of CGRP and SP.

Measurement of CGRP and SP.

The mucosal sac supernatant was frozen in at −80°C for later use. The concentration of CGRP and SP present in the mucosal sac supernatant was measured using enzyme immunoassay kits from Cayman Chemical (Ann Arbor, MI). Before measurement of CGRP and SP, the mucosal sac supernatant was diluted to 1:4 with EIA buffer provided by the immunoassay kits.

HCl-induced ATP release in HET-1A cells.

The HET-1A cell line was originally obtained from normal human esophageal autopsy tissue. It has been shown to retain epithelial morphology; it stains positively for cytokeratins and has remained nontumorigenic (40). Human esophageal squamous HET-1A cells (ATCC, Manassas, VA) were cultured in the bronchial epithelial cell medium (BEGM BulletKit; Lonza, Walkersville, MD) containing a basal medium (BEBM) plus additives (BEGM SingleQuots; Lonza) in wells precoated with a mixture of 0.01 mg/ml fibronectin and 0.03 mg/ml vitrogen 100 (Cohesion, Palo Alto, CA). The cells were cultured at 37°C in a 5% CO₂-humidified atmosphere. The cells were exposed to pH 5.0 for 5 min with or without 5-iodoresiniferatoxin (IRTX). When IRTX was used, cells were pretreated with the antagonist (10⁻⁶ M) for 20 min before exposure to HCl. Cell viability, as tested at the end of each experimental protocol by examining trypan blue exclusion, remained >98%.

ATP released by HET-1A cells was measured using the ATP light Luminescence ATP Detection Assay System from PerkinElmer (Waltham, MA). The medium was then used to measure ATP, according to the manufacturer's instructions.

Real-time PCR for purinergic receptors.

Total RNA from HET-1A cells was isolated by an RNeasy Mini Kit (Qiagen, Valencia, CA). To eliminate DNA contamination, 1 μg of total RNA was treated by DNase I according to the product manual. RNA was reversely transcribed and subjected to real-time PCR by using the GeneAmp Gold RNA PCR Reagent Kit and Power SYBR Green PCR Master Mix (Applied Biosystems, Foster City, CA). The StepOnePlus Real-Time PCR System (Applied Biosystems) with StepOne Software (version 2.1) was used for the real-time PCR assay. Melting curve (dissociation curve) was run after the real-time PCR to ensure that the desired amplicon was detected. 28S rRNA was used as the normalizer (the endogenous control), and the comparative C_T method was used to analyze the real-time PCR data. The PCR specificity was examined by 2% agarose gel using 10 μl from each reaction after the PCR was finished. Primers used for the purinergic receptors are shown in Table 1.

Table 1.

Primers for real-time PCR of purinergic receptors

		Primer
P2X1	Sense	5′-`ATCTGTGTGGATGGCAAACT`-3′
	Antisense	5′-`GTGCACGTAGGTGGTGTGTA`-3′
P2X2	Sense	5′-`CAGGTTTGCCAAATACTACAAGATCA`-3′
	Antisense	5′-`AACTTCCCGGCCTGTCCAT`-3′
P2X3	Sense	5′-`CCTCGGTCTTTGTCATCATC`-3′
	Antisense	5′-`GTTTCCACTGTGTCCACCTC`-3′
P2X4	Sense	5′-`CTCACCATGAACCAGACACA`-3′
	Antisense	5′-`GACAGACCCGTTGAAAGCTA`-3′
P2X5	Sense	5′-`TCCTGAAATCATGCCACTTT`-3′
	Antisense	5′-`CGGAGGAGACAGACTTTGAA`-3′
P2X6	Sense	5′-`CACTGCCGCTATGAACCACAA`-3′
	Antisense	5′-`CGAAGGTCCCTCCAGCCTT`-3′
P2X7	Sense	5′-`CTGTGAAGTCTCTGCCTGGT`-3′
	Antisense	5′-`GGGACACTGTGGATTCTGAG`-3′
P2Y1	Sense	5′-`CTGTGCAATGCCTTAGGACT`-3′
	Antisense	5′-`TACTTGGAGGCTATGCCTTG`-3′
P2Y2	Sense	5′-`GCCAGTGTGAGGCTGTAACT`-3′
	Antisense	5′-`AGCCAACTGGCTTTACAGTG`-3′
P2Y4	Sense	5′-`ATCACCCGCACCATTTACTA`-3′
	Antisense	5′-`ATATTTGTCCCCAGTGAGCA`-3′
P2Y6	Sense	5′-`GTCTACCGCGAGAACTTCAA`-3′
	Antisense	5′-`TGATCACCTTGGGCATAGTT`-3′
P2Y10	Sense	5′-`AACAACAAGTCCTGCTTTGC`-3′
	Antisense	5′-`AAGACTGCAGCACACATGAA`-3′
P2Y11	Sense	5′-`ACAGAGCGTATAGCCTGGTG`-3′
	Antisense	5′-`ATGTGGTAGGGCACATAGGA`-3′
P2Y12	Sense	5′-`AACTGGGAACAGGACCACTG`-3′
	Antisense	5′-`TAAATGGCCTGGTGGTCTTC`-3′
P2Y13	Sense	5′-`ACCCCTCATAGCCTTTGACA`-3′
	Antisense	5′-`GATCGTATTTGGCAGGGAGA`-3′
P2Y14	Sense	5′-`TGAATCCTGCTCTCAGAACC`-3′
	Antisense	5′-`AGGCTCATCACAAAGTCAGC`-3′

Open in a new tab

Western blot analysis.

For lyso-PAF AT protein assay, cells, incubated in 1.2 mM Ca²⁺ concentration BEBM, were treated for 12 min with HCl (pH 5) alone or after 20 min pretreatment with the nonselective purinergic antagonist suramin (10⁻⁴ M) for seven times in 48 h. For the p38 phosphorylation assay, cells were treated with ATP (10⁻⁴ M) for 10 min, alone or in the presence of the vanilloid receptor antagonist 5′-IRTX (3 × 10⁻⁶ M) after a 20-min pretreatment. Cells were then lysed in Triton X lysis buffer containing 50 mM Tris·HCl, pH 7.5, 100 mM NaCl, 50 mM NaF, 5 mM EDTA, 1% (vol/vol) Triton X-100, 40 mM β-glycerol phosphate, 40 mM p-nitrophenyl phosphate, 200 μM sodium orthovanadate, 100 μM phenylmethylsulfonyl fluoride, 1 μg/ml leupeptin, 1 μg/ml pepstatin A, and 1 μg/ml aprotinin. The suspension was centrifuged at 15,000 g for 5 min, and the protein concentration in the supernatant was determined. Western blot was performed as described previously (31). Briefly, after the supernatants were subjected to SDS-PAGE, the separated proteins were electrophoretically transferred to a Polyvinylidene Fluoride membrane (PerkinElmer) at 100 volts for 60 min. The membranes were blocked in 5% nonfat dry milk and then incubated with a lyso-PAF AT antibody (1:1,000) (Novus Biologicals, Littleton, CO) or incubated with anti-phosphorylated p38 mitogen-activated protein kinase (MAPK) antibody (1:1,000) (Cell Signaling, Danvers, MA) followed by 60 min incubation in horseradish peroxidase-conjugated secondary antibody (1:3,000) (Cell Signaling). Detection was achieved with an enhanced chemiluminescence agent (Amersham, Piscataway, NJ). After the phosphorylated p38 MAPK and lyso-PAF AT were detected, the membranes were incubated in stripping buffer (100 mM 2-mercaptoethanol, 2% SDS, and 62.6 mM Tris·HCl, pH 6.7) at 50°C for 30 min, washed three times (10 min each), and then reprobed by using anti-p38 MAPK antibody (1:1,000) (Cell Signaling) or GAPDH antibody (1:1,000) (Santa Cruz Biotechnology, Santa Cruz, CA), respectively. Data are normalized to total p38 and reported as relative optical density.

Lyso-PAF AT activity.

To examine changes in activity of lyso-PAF AT, the enzyme responsible for the production of PAF, the cells were exposed to pH 5.0 (45 min) with or without 20 min pretreatment with suramin (10⁻⁴ M). To directly test the effect of ATP, cells were exposed to 100 μM ATPγS (45 min).

Cells were scraped from the wells in 200 μl of ice-cold homogenization buffer containing 0.25 M sucrose, 10 mM EDTA, 5 mM mercaptoethanol, 50 mM NaF, 10⁻⁵ M phenylmethylsulfonyl fluoride, 1 μg/ml aprotinin, and 50 mM Tris·HCl (pH7.4) and homogenized by sonication (4 × 20 s at 1-min intervals). The homogenates were centrifuged (4°C, 600 g) for 10 min. The supernatants were collected for the lyso-PAF AT activity assay, and the protein concentration in the supernatants was measured by the Bradford (6) method. The activity of the lyso-PAF AT was measured by a method described by Nomikos et al. (33). Briefly, supernatants containing 10 μg of protein were incubated for 30 min at 37°C with 4 nmol of lyso-PAF and 40 nmol of [³H]acetyl-CoA (100 Bq/nmol) in a final volume of 200 μl of 50 mM Tris·HCl buffer (pH 7.4) containing 0.25 mg/ml BSA and 1 mM dithiothreitol. After incubation, 4 μl of 100 mg/ml BSA were added, and the reaction was stopped by addition of 64 μl of 40% cold trichloroacetic acid solution. The reaction mixtures were kept in ice for 30 min and centrifuged at 10,000 g for 2 min. The supernatants were discarded, the pellets containing the [³H]PAF bound to the denatured BSA were dissolved in EcoLume scintillation cocktail (MP Biomedicals, Solon, OH), and the radioactivity was determined by liquid scintillation counting. Matching controls were run in the absence of lyso-PAF to subtract the radioactivity of the endogenously produced [³H]PAF.

Lyso-PAF AT mRNA.

To examine changes in mRNA, the cells were exposed to pH 5.0 medium for 12-min episodes, seven times in 48 h, and then used to determine RNA by real-time PCR and protein expression by Western blot analysis. HCl (2N) was added to tissue culture media to bring the solution to pH 5.0. Cells were exposed for 12 min to this acidified media at 8:30 A.M., 11:30 A.M., and 2:30 P.M. on day 1 and day 2. On day 3, cells were exposed at 8:30 A.M. for 12 min, the nonacidified culture media was readded to the cells, and after 1 h the cells were harvested for examination of acid-induced mRNA changes. Alternatively, cells were exposed to 10⁻⁴ M ATPγS for seven times in 48 h using the same exposure protocol. In some experiments, cells were pretreated with either the TRPV1 receptor antagonist IRTX (3 × 10⁻⁶ M) or the purinergic receptor antagonist suramin (10⁻⁶ M) for 20 min before each exposure to acid. mRNA was isolated as described for purinergic receptors.

Primers for real-time lyso-PAF AT PCR are shown in Table 2.

Table 2.

Primers for real-time PCR of lyso-PAF AT

		Primer
Lyso-PAF AT	Sense	5′-`ATTGACTTCCGAGAGTATGTGA`-3′
	Antisense	5′-`GCTTAAATGCCACCTGGATGA`-3′

Open in a new tab

Lyso-PAF AT, lyso-platelet-activating factor acetyl-CoA transferase.

RESULTS

Three hour exposure of rabbit esophageal mucosa to HCl-acidified Krebs (pH 5) resulted in release of CGRP and SP in the culture supernatant (Fig. 1). We have previously shown that the release was inhibited by the neurotoxin tetrodotoxin, indicating release from submucosal neurons present in the preparation (14). Figure 1 shows that the release is also inhibited by the purinergic receptor antagonist suramin, suggesting that production and release of ATP, diffusing to submucosal neurons, mediates release of the neurotransmitters CGRP and SP. ATP-induced release of CGRP and SP is confirmed in Fig. 2, indicating that 10 min exposure to ATP results in release of the two neurotransmitters. It is noteworthy that, in Fig. 2, the scales for CGRP and SP are different, indicating a greater ATP-dependent release of CGRP than of SP. This is consistent with Fig. 1 indicating that suramin has a greater effect on HCl-induced release of CGRP than of SP.

Fig. 2. — Ten minutes exposure of esophageal mucosa to ATP results in release of CGRP and SP (*P < 0.05). It is noteworthy that the scales for CGRP and SP are different, indicating a greater ATP-dependent release of CGRP than of SP. This is consistent with Fig. 1 indicating that suramin has a greater effect on HCl-induced release of CGRP than of SP. Data represent means ± SE of mucosal tissue from 3 animals.

To identify the cell type responsible for ATP release, the human esophageal epithelial cell line HET-1A was exposed to HCl-acidified media (pH 5) for 5 min. Figure 3 demonstrates HCl-induced release of ATP from the epithelial cells. Inhibition of ATP release by the vanilloid receptor antagonist IRTX indicates that HCl-induced activation of TRPV1 receptors mediates the ATP release. The presence of TRPV1 mRNA and protein in these cells has been demonstrated previously (27).

Fig. 3. — HCl induced significant release of ATP from epithelial cells (*P < 0.05) compared with control. ATP release was abolished by preexposure to the vanilloid receptor antagonist 5-iodoresiniferatoxin (IRTX, 10⁻⁶ M, 20 min, #P < 0.05), indicating that HCl-induced activation of TRPV1 receptors mediates the ATP release. Data represent means ± SE of 3 experiments.

To examine whether ATP may also act as an autocrine substance affecting the epithelial cells themselves, we examined the expression of purinergic receptors in the HET-1A cells. Real-time PCR demonstrated the selective presence of mRNA for several P2X and P2Y purinergic receptors (Fig. 4), supporting a possible autocrine role for ATP in these cells.

Fig. 4. — Real-time PCR demonstrates that HET-1A cells contain mRNA for the purinergic receptors P2X4, P2X5, and P2Y14, in order of relative expression, and of other purinergic receptors at lower levels. Data represent means ± SE of 3 experiments.

We have previously demonstrated that epithelial cells release PAF in response to TRPV1 activation (14, 27). To demonstrate whether ATP may mediate this response, we examined the activity of lyso-PAF AT, the enzyme responsible for the production of PAF. We have previously shown that the activity of the enzyme is increased by activation of TRPV1 receptors by the selective TRPV1 agonist capsaicin (27). Figure 5A indicates that 45 min exposure to HCl-acidified media (pH 5) similarly increases lyso-PAF AT activity and that the increase was blocked by the purinergic antagonist suramin, indicating TRPV1- and ATP-mediated increase in activity of the enzyme. Figure 5B confirms that ATP directly causes an increase in lyso-PAF AT activity, confirming ATP as a mediator of HCl-induced production of PAF.

Fig. 5. — A: 45 min exposure to HCl-acidified media (pH 5) similarly increases lyso-platelet-activating factor acetyl-CoA transferase (lyso-PAF AT) activity (*P < 0.001), and the increase was blocked by 20 min pretreatment with the purinergic antagonist suramin (10⁻⁴ M; #P < 0.001), indicating TRPV1- and ATP-mediated increase in activity of the enzyme. B: data confirm that 100 μM 5′-O-(3-thiotriphosphate) (ATPγS) (45 min) directly causes an increase in lyso-PAF AT activity (*P < 0.01), confirming ATP as a mediator of HCl-induced production of PAF. Data represent means ± SE of 3 experiments.

ATP has been found to potentiate the TRPV1 currents evoked by capsaicin or protons (42). We have previously demonstrated that PAF production in HET-1A cells was mediated by TRPV1 activation, resulting in an increase in cytosolic Ca²⁺, calmodulin-dependent kinase II activation, and p38 activation that caused activation of lyso-PAF AT and production of PAF. To investigate a possible site of interaction between TRPV1 and ATP, we have examined whether ATP-induced phosphorylation of p38 may depend on TRPV1 activation. Figure 6 shows that ATP-induced p38 phosphorylation was inhibited by the TRPV1 antagonist IRTX, indicating that ATP depends on TRPV1 activation to phosphorylate p38. Thus it appears that TRPV1-induced ATP release, in turn, activates/potentiates TRPV1 itself to induce p38 phosphorylation and activation of lyso-PAF AT.

Fig. 6. — ATP-induced phosphorylation of p38 depends on TRPV1 activation. ATP (10⁻⁴ M ATPγS, 10 min) caused a significant (*P < 0.01) increase in p38 phosphorylation that was significantly (#P < 0.01) inhibited by the TRPV1 antagonist IRTX (3 × 10⁻⁶ M), indicating that ATP depends on TRPV1 activation to phosphorylate p38. Thus TRPV1-induced ATP release, in turn, activates/potentiates TRPV1 itself to induce p38 phosphorylation. Data represent means ± SE of 3 experiments.

In addition, repeated exposure to low pH over 2 days (seven 12-min episodes at pH 5) enhanced the expression of lyso-PAF AT mRNA and protein, thus increasing the potential for PAF production in response to low pH (Fig. 7). The increase in lyso-PAF AT mRNA and protein was blocked by suramin, indicating that ATP may contribute to the HCl-induced increase. A role of ATP in the increase was confirmed in Fig. 8, indicating that repeated direct exposure to ATP over 2 days results in an increase in lyso-PAF AT mRNA, potentially resulting in increased production of PAF.

Fig. 7. — Repeated exposure to pH 5 (7 × 12-min episodes over 2 days) induced enhanced expression of lyso-PAF AT mRNA (*left*) and protein (*right*) (*P < 0.05) compared with control. The increase in lyso-PAF AT mRNA and protein was blocked by suramin (10⁻⁶ M, #P < 0.05), indicating that ATP contributes to the HCl-induced increase. Data represent means ± SE of 3 experiments.

Fig. 8. — Repeated direct exposure to ATP (7 × 12-min episodes, 10⁻⁴ M ATPγS over 2 days) resulted in a significant increase in lyso-PAF AT mRNA (*P < 0.05). Data represent means ±_SE of 3 experiments.

DISCUSSION

ATP-dependent release of CGRP and SP.

TRPV1 receptors are present in epithelial cells and activated by acid. TRPV1 activation in epithelial cells causes production of PAF and causes release of CGRP and SP from submucosal neurons present in esophageal submucosa (14). The finding that PAF produced by epithelial cells does not affect release of CGRP and SP from submucosal neurons (14), however, suggests that a different mediator, possibly produced by epithelial cells, may induce release of these sensory neurotransmitters from submucosal neurons.

ATP is a neurotransmitter in the central and peripheral nervous systems that is also involved in peripheral inflammation and transmission of pain (2). Intercellular signaling mediated by purines is present early in evolution and may be important for cell-to-cell communication (28). For instance, in skin keratinocytes, detection of ambient temperatures implies that temperature information is transmitted to adjacent sensory neurons (16, 25, 36), but electron microscopic studies have not identified synapse-like structures between keratinocytes and sensory nerve endings (10); ATP has been demonstrated as a messenger molecule for TRPV3-mediated thermotransduction in skin between keratinocytes and sensory nerve endings (28).

Regulated release of ATP from nonneuronal sources plays a role in the activation of sensory nerve terminals in the enteric nervous system (2). In the guinea pig ileum, ATP released from epithelial cells lining the gut lumen can act as a sensory mediator (3) and activate purinergic receptors in submucosal neurons. In the esophagus, ATP released from esophageal keratinocytes may act in different ways on nerve endings that innervate the esophagus. ATP may reach and activate purinergic receptors expressed in intraganglionic laminar endings (23, 37, 45), since they are in intestine (3). Alternatively, vagal and spinal mucosal afferents may detect released ATP because they abut on and penetrate the esophageal epithelium with small branches (17, 30, 45).

In the rat bladder, the TRPV1 agonist capsaicin and acid activate TRPV1 and induce ATP release from mucosa (38). We therefore examined whether ATP released from the esophageal epithelium in response to TRPV1 may be a mediator for the release of CGRP and SP and for other effects.

We demonstrate that, in esophageal mucosa, HCl-induced release of CGRP and SP is inhibited by the ATP antagonist suramin, suggesting ATP-mediated release of these neurotransmitters. Suramin almost completely inhibits HCl-induced CGRP release, bringing its levels back to control. The effect of suramin on SP release however, is partial, suggesting that ATP contributes to SP release. The role of ATP in release of CGRP and SP is confirmed by release of CGRP and SP when ATP is applied directly to esophageal mucosa. It is noteworthy that 10 min exposure of esophageal mucosa to ATP causes a significant release of the neurotransmitters and that only 5 min exposure of epithelial cells to HCl is sufficient to cause a significant release of ATP. Thus, even though we have demonstrated significant release of CGRP and SP after 3 h exposure of mucosa to HCl, it is likely that release of the neurotransmitters may in fact occur in minutes, rather than hours.

TRPV1-mediated release of ATP in epithelial cells.

To identify esophageal epithelial cells as a source of ATP, the human esophageal epithelial cell line HET-1A was exposed to HCl. The HET-1A cell line retains epithelial morphology, stains positively for cytokeratins, and is nontumorigenic (40). We previously demonstrated (27) that HET-1A cells contain TRPV1 receptors that are linked to increased cytosolic Ca²⁺ and produce PAF in response to the selective TRPV1 agonist capsaicin, confirming that TRPV1 receptors are present not only in submucosal neurons, as previously demonstrated (4, 29), but also in the epithelial cells themselves (14), in agreement with recent data by Akiba et al. (1).

The intracellular pathways activated by TRPV1 in epithelial cells result in production of PAF, through TRPV1-induced Ca²⁺ influx and activation of the calmodulin-dependent kinase II inducing phosphorylation of p38 and activation of lyso-PAF AT, the enzyme responsible for the production of PAF (27). ATP similarly induces p38 phosphorylation that is inhibited by the TRPV1 antagonist IRTX. Interaction between TRPV1 and ATP has been demonstrated, and a cytosolic ankyrin repeat domain of TRPV1 has been described in neurons and has been identified as a multiligand-binding site important in regulating channel sensitivity. The structure of TRPV1-ankyrin repeat domain reveals a binding site that accommodates ATP and sensitizes the channel, generating larger currents in response to capsaicin application. ATP has been found to potentiate the TRPV1 currents evoked by capsaicin or protons through metabotropic P2Y1 receptor (42). In the current study, we show that ATP-induced p38 phosphorylation was inhibited by the TRPV1 antagonist IRTX, indicating that ATP depends on TRPV1 activation to phosphorylate p38. Thus it appears that TRPV1-mediated ATP release in turn activates/potentiates TRPV1 to stimulate p38 phosphorylation and activation of lyso-PAF AT, suggesting that ATP mediates, or at least contributes to, PAF production, but the exact site of action of ATP in this pathway remains to be demonstrated.

HET-1A cells express several vanilloid receptors, including TRPV1-TRPV6. TRPV1 and TRPV4, however, are expressed at the highest mRNA levels (data not shown). HCl exposure of epithelial cells induced production of ATP that was completely blocked by IRTX, demonstrating TRPV1-dependent production of ATP. It is interesting that both TRPV1 and TRPV4 (30) activation in esophageal epithelial cells causes release of ATP. TRPV4 has been suggested as a heat mediator (19, 30, 46), and TRPV1 is heat sensitive (9), perhaps explaining why acid reflux in the esophageal epithelium is identified as “heartburn.”

ATP release in response to vanilloid receptor stimulation has been demonstrated. ATP is released by urothelial cells in response to HCl-induced TRPV1 receptor activation (38) as well as by stretch-induced TRPV4 activation (32). ATP is released in keratinocytes in response to heat-induced activation of TRPV3 (28) and in esophageal keratinocytes in response to the TRPV4 agonist GSK-1016790A (30). In the present investigation, we show that, in esophageal epithelial cells, ATP is released in response to HCl-induced TRPV1 activation, since it is completely inhibited by the TRPV1 antagonist IRTX. In HET-1A cells, we have demonstrated capsaicin-induced increase in cytosolic Ca²⁺ (27). Thus TRPV1-induced ATP release may depend on Ca²⁺-dependent activation of a vesicular nucleotide transporter (21, 39, 41), since TRPV1 increases cytosolic Ca²⁺ either by causing Ca²⁺ influx or Ca²⁺ release from the endoplasmic reticulum (22, 35).

Response to short-term and repeated HCl or ATP exposure.

ATP acts at G protein-coupled P2Y receptors (44) and at ligand-gated P2X receptors/ion channels (24, 34). Real-time PCR demonstrated the presence of high levels of mRNA for several P2X and P2Y purinergic receptors in the epithelial cells. A Western blot confirmed protein expression of these receptors (data not shown) in HET-1A cells, a finding consistent with ATP acting as an autocrine substance.

In esophageal mucosa, ATP has a dual effect: it acts on neighboring submucosal neurons, inducing SP and CGRP (particularly CGRP) release, and it acts on the epithelial cells themselves, causing activation of lyso-PAF AT after a relatively short time.

In addition, by acting through purinergic receptors, ATP mediates signaling in pathophysiological processes, including nociception (7). ATP released from epithelial cells may affect sensory pathways beyond the submucosal plexus (2) by acting on sensory nerve terminals extending to the mucosa (8).

When TRPV1 activation is repeated over time, ATP induces changes in mRNA, resulting in upregulation of lyso-PAF AT with potential increased production of the inflammatory mediator PAF. Repeated TRPV1 activation may produce other mRNA changes, resulting in increased production of other inflammation-related agents, such as cytokines and chemokines. The effects of repeated TRPV1 activation are mediated, at least in part, through ATP-induced activation of purinergic receptors, since upregulation of lyso-PAF AT is inhibited by the purinergic inhibitor suramin. ATP involvement is confirmed by direct application of ATP, inducing the same upregulation.

Thus HCl-induced activation of TRPV1 receptors causes effects occurring within minutes, such as release of ATP, that may contribute to pain transmission and, when repeated over time, results in mRNA changes, such as upregulation of lyso-PAF AT mRNA and, possibly, other inflammatory mediators.

GRANTS

This work was supported by National Institute of Diabetes and Digestive and Kidney Diseases Grant RO1 DK-57030

DISCLOSURES

None

ACKNOWLEDGMENTS

We acknowledge Dr. Claudio Fiocchi's intellectual contribution to the manuscript.

REFERENCES

1. Akiba Y, Mizumori M, Kuo M, Ham M, Guth PH, Engel E, Kaunitz JD. CO2 chemosensing in rat oesophagus. Gut 57: 1654–1664, 2008 [DOI] [PMC free article] [PubMed] [Google Scholar]
2. Bertrand PP. ATP and sensory transduction in the enteric nervous system. Neuroscientist 9: 243–260, 2003 [DOI] [PubMed] [Google Scholar]
3. Bertrand PP, Bornstein JC. ATP as a putative sensory mediator: activation of intrinsic sensory neurons of the myenteric plexus via P2X receptors. J Neurosci 22: 4767–4775, 2002 [DOI] [PMC free article] [PubMed] [Google Scholar]
4. Bhat YM, Bielefeldt K. Capsaicin receptor (TRPV1) and non-erosive reflux disease. Eur J Gastroenterol Hepatol 18: 263–270, 2006 [DOI] [PubMed] [Google Scholar]
5. Birder LA. Urothelial signaling. Auton Neurosci 153: 33–40, 2010 [DOI] [PMC free article] [PubMed] [Google Scholar]
6. Bradford MM. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Annal Biochem 72: 248–254, 1976 [DOI] [PubMed] [Google Scholar]
7. Burnstock G. Purine-mediated signalling in pain and visceral perception. Trends Pharmacol Sci 22: 182–188, 2001 [DOI] [PubMed] [Google Scholar]
8. Burnstock G. Purines and sensory nerves. Handb Exp Pharmacol 333–392, 2009 [DOI] [PubMed] [Google Scholar]
9. Caterina MJ, Schumacher MA, Tominaga M, Rosen TA, Levine JD, Julius D. The capsaicin receptor: a heat-activated ion channel in the pain pathway. Nature 389: 816–824, 1997 [DOI] [PubMed] [Google Scholar]
10. Chateau Y, Misery L. Connections between nerve endings and epidermal cells: are they synapses? Exp Dermatol 13: 2–4, 2004 [DOI] [PubMed] [Google Scholar]
11. Cheng L, Cao W, Behar J, Fiocchi C, Biancani P, Harnett KM. Acid-induced release of platelet-activating factor by human esophageal mucosa induces inflammatory mediators in circular smooth muscle. J Pharmacol Exp Ther 319: 117–126, 2006 [DOI] [PubMed] [Google Scholar]
12. Cheng L, Cao W, Fiocchi C, Behar J, Biancani P, Harnett KM. HCl-induced inflammatory mediators in cat esophageal mucosa and inflammatory mediators in esophageal circular muscle in an in vitro model of esophagitis. Am J Physiol Gastrointest Liver Physiol 290: G1307–G1317, 2006 [DOI] [PubMed] [Google Scholar]
13. Cheng L, Cao W, Fiocchi C, Behar J, Biancani P, Harnett KM. In vitro model of acute esophagitis in the cat. Am J Physiol Gastrointest Liver Physiol 289: G860–G869, 2005 [DOI] [PubMed] [Google Scholar]
14. Cheng L, de la Monte S, Ma J, Hong J, Tong M, Cao W, Behar J, Biancani P, Harnett KM. HCl-activated neural and epithelial vanilloid receptors (TRPV1) in cat esophageal mucosa. Am J Physiol Gastrointest Liver Physiol 297: G135–G143, 2009 [DOI] [PMC free article] [PubMed] [Google Scholar]
15. Deuchars J. Knockout mice highlight the promise of purines. Trends Neurosci 24: 5–6, 2001 [DOI] [PubMed] [Google Scholar]
16. Dhaka A, Viswanath V, Patapoutian A. Trp ion channels and temperature sensation. Annu Rev Neurosci 29: 135–161, 2006 [DOI] [PubMed] [Google Scholar]
17. Dutsch M, Eichhorn U, Worl J, Wank M, Berthoud HR, Neuhuber WL. Vagal and spinal afferent innervation of the rat esophagus: a combined retrograde tracing and immunocytochemical study with special emphasis on calcium-binding proteins. J Comp Neurol 398: 289–307, 1998 [PubMed] [Google Scholar]
18. Furness JB, Kunze WA, Bertrand PP, Clerc N, Bornstein JC. Intrinsic primary afferent neurons of the intestine. Prog Neurobiol 54: 1–18, 1998 [DOI] [PubMed] [Google Scholar]
19. Guler AD, Lee H, Iida T, Shimizu I, Tominaga M, Caterina M. Heat-evoked activation of the ion channel, TRPV4. J Neurosci 22: 6408–6414, 2002 [DOI] [PMC free article] [PubMed] [Google Scholar]
20. Ismail-Beigi F, Horton PF, Pope CE., 2nd Histological consequences of gastroesophageal reflux in man. Gastroenterology 58: 163–174, 1970 [PubMed] [Google Scholar]
21. Iwatsuki K, Ichikawa R, Hiasa M, Moriyama Y, Torii K, Uneyama H. Identification of the vesicular nucleotide transporter (VNUT) in taste cells. Biochem Biophys Res Commun 388: 1–5, 2009 [DOI] [PubMed] [Google Scholar]
22. Karai LJ, Russell JT, Iadarola MJ, Olah Z. Vanilloid receptor 1 regulates multiple calcium compartments and contributes to Ca2+-induced Ca2+ release in sensory neurons. J Biol Chem 279: 16377–16387, 2004 [DOI] [PubMed] [Google Scholar]
23. Kestler C, Neuhuber WL, Raab M. Distribution of P2X(3) receptor immunoreactivity in myenteric ganglia of the mouse esophagus. Histochem Cell Biol 131: 13–27, 2009 [DOI] [PubMed] [Google Scholar]
24. Khakh BS, Burnstock G, Kennedy C, King BF, North RA, Seguela P, Voigt M, Humphrey PP. International union of pharmacology. XXIV. Current status of the nomenclature and properties of P2X receptors and their subunits. Pharmacol Rev 53: 107–118, 2001 [PubMed] [Google Scholar]
25. Lee H, Caterina MJ. TRPV channels as thermosensory receptors in epithelial cells. Pflugers Arch 451: 160–167, 2005 [DOI] [PubMed] [Google Scholar]
26. Ma J, Altomare A, de la Monte S, Tong M, Rieder F, Fiocchi C, Behar J, Shindou H, Biancani P, Harnett KM. HCl-induced inflammatory mediators in esophageal mucosa increase migration and production of H2O2 by peripheral blood leukocytes. Am J Physiol Gastrointest Liver Physiol 299: G791–G798, 2010 [DOI] [PMC free article] [PubMed] [Google Scholar]
27. Ma J, Harnett KM, Behar J, Biancani P, Cao W. Signaling in TRPV1-induced platelet activating factor (PAF) in human esophageal epithelial cells. Am J Physiol Gastrointest Liver Physiol 298: G233–G240, 2010 [DOI] [PMC free article] [PubMed] [Google Scholar]
28. Mandadi S, Sokabe T, Shibasaki K, Katanosaka K, Mizuno A, Moqrich A, Patapoutian A, Fukumi-Tominaga T, Mizumura K, Tominaga M. TRPV3 in keratinocytes transmits temperature information to sensory neurons via ATP. Pflugers Arch 458: 1093–1102, 2009 [DOI] [PMC free article] [PubMed] [Google Scholar]
29. Matthews PJ, Aziz Q, Facer P, Davis JB, Thompson DG, Anand P. Increased capsaicin receptor TRPV1 nerve fibres in the inflamed human oesophagus. Eur J Gastroenterol Hepatol 16: 897–902, 2004 [DOI] [PubMed] [Google Scholar]
30. Mihara H, Boudaka A, Sugiyama T, Moriyama Y, Tominaga M. Transient receptor potential vanilloid 4 (TRPV4)-dependent calcium influx and ATP release in mouse oesophageal keratinocytes. J Physiol 589: 3471–3482, 2011 [DOI] [PMC free article] [PubMed] [Google Scholar]
31. Mizushima T, Obata K, Yamanaka H, Dai Y, Fukuoka T, Tokunaga A, Mashimo T, Noguchi K. Activation of p38 MAPK in primary afferent neurons by noxious stimulation and its involvement in the development of thermal hyperalgesia. Pain 113: 51–60, 2005 [DOI] [PubMed] [Google Scholar]
32. Mochizuki T, Sokabe T, Araki I, Fujishita K, Shibasaki K, Uchida K, Naruse K, Koizumi S, Takeda M, Tominaga M. The TRPV4 cation channel mediates stretch-evoked Ca2+ influx and ATP release in primary urothelial cell cultures. J Biol Chem 284: 21257–21264, 2009 [DOI] [PMC free article] [PubMed] [Google Scholar]
33. Nomikos TN, Iatrou C, Demopoulos CA. Acetyl-CoA:1-O-alkyl-sn-glycero-3-phosphocholine acetyltransferase (lyso-PAF AT) activity in cortical and medullary human renal tissue. Eur J Biochem 270: 2992–3000, 2003 [DOI] [PubMed] [Google Scholar]
34. North RA. Molecular physiology of P2X receptors. Physiol Rev 82: 1013–1067, 2002 [DOI] [PubMed] [Google Scholar]
35. Olah Z, Szabo T, Karai L, Hough C, Fields RD, Caudle RM, Blumberg PM, Iadarola MJ. Ligand-induced dynamic membrane changes and cell deletion conferred by vanilloid receptor 1. J Biol Chem 276: 11021–11030, 2001 [DOI] [PubMed] [Google Scholar]
36. Patapoutian A, Peier AM, Story GM, Viswanath V. ThermoTRP channels and beyond: mechanisms of temperature sensation. Nat Rev Neurosci 4: 529–539, 2003 [DOI] [PubMed] [Google Scholar]
37. Raab M, Neuhuber WL. Number and distribution of intraganglionic laminar endings in the mouse esophagus as demonstrated with two different immunohistochemical markers. J Histochem Cytochem 53: 1023–1031, 2005 [DOI] [PubMed] [Google Scholar]
38. Sadananda P, Shang F, Liu L, Mansfield KJ, Burcher E. Release of ATP from rat urinary bladder mucosa: role of acid, vanilloids and stretch. Br J Pharmacol 158: 1655–1662, 2009 [DOI] [PMC free article] [PubMed] [Google Scholar]
39. Sawada K, Echigo N, Juge N, Miyaji T, Otsuka M, Omote H, Yamamoto A, Moriyama Y. Identification of a vesicular nucleotide transporter. Proc Natl Acad Sci USA 105: 5683–5686, 2008 [DOI] [PMC free article] [PubMed] [Google Scholar]
40. Stoner GD, Kaighn ME, Reddel RR, Resau JH, Bowman D, Naito Z, Matsukura N, You M, Galati AJ, Harris CC. Establishment and characterization of SV-40 T-antigen immortalized human esophageal epithelial cells. Cancer Res 51: 365–371, 1991 [PubMed] [Google Scholar]
41. Tokunaga A, Tsukimoto M, Harada H, Moriyama Y, Kojima S. Involvement of SLC17A9-dependent vesicular exocytosis in the mechanism of ATP release during T cell activation. J Biol Chem 285: 17406–17416, 2010 [DOI] [PMC free article] [PubMed] [Google Scholar]
42. Tominaga M, Wada M, Masu M. Potentiation of capsaicin receptor activity by metabotropic ATP receptors as a possible mechanism for ATP-evoked pain and hyperalgesia. Proc Natl Acad Sci USA 98: 6951–6956, 2001 [DOI] [PMC free article] [PubMed] [Google Scholar]
43. Vlaskovska M, Kasakov L, Rong W, Bodin P, Bardini M, Cockayne DA, Ford AP, Burnstock G. P2X3 knock-out mice reveal a major sensory role for urothelially released ATP. J Neurosci 21: 5670–5677, 2001 [DOI] [PMC free article] [PubMed] [Google Scholar]
44. vonKugelgen I, Wetter A. Molecular pharmacology of P2Y-receptors. Naunyn Schmiedebergs Arch Pharmacol 362: 310–323, 2000 [DOI] [PubMed] [Google Scholar]
45. Wank M, Neuhuber WL. Local differences in vagal afferent innervation of the rat esophagus are reflected by neurochemical differences at the level of the sensory ganglia and by different brainstem projections. J Comp Neurol 435: 41–59, 2001 [DOI] [PubMed] [Google Scholar]
46. Watanabe H, Vriens J, Suh SH, Benham CD, Droogmans G, Nilius B. Heat-evoked activation of TRPV4 channels in a HEK293 cell expression system and in native mouse aorta endothelial cells. J Biol Chem 277: 47044–47051, 2002 [DOI] [PubMed] [Google Scholar]
47. Zimmermann K, Reeh PW, Averbeck B. ATP can enhance the proton-induced CGRP release through P2Y receptors and secondary PGE(2) release in isolated rat dura mater. Pain 97: 259–265, 2002 [DOI] [PubMed] [Google Scholar]

[B1] 1. Akiba Y, Mizumori M, Kuo M, Ham M, Guth PH, Engel E, Kaunitz JD. CO2 chemosensing in rat oesophagus. Gut 57: 1654–1664, 2008 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B2] 2. Bertrand PP. ATP and sensory transduction in the enteric nervous system. Neuroscientist 9: 243–260, 2003 [DOI] [PubMed] [Google Scholar]

[B3] 3. Bertrand PP, Bornstein JC. ATP as a putative sensory mediator: activation of intrinsic sensory neurons of the myenteric plexus via P2X receptors. J Neurosci 22: 4767–4775, 2002 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B4] 4. Bhat YM, Bielefeldt K. Capsaicin receptor (TRPV1) and non-erosive reflux disease. Eur J Gastroenterol Hepatol 18: 263–270, 2006 [DOI] [PubMed] [Google Scholar]

[B5] 5. Birder LA. Urothelial signaling. Auton Neurosci 153: 33–40, 2010 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B6] 6. Bradford MM. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Annal Biochem 72: 248–254, 1976 [DOI] [PubMed] [Google Scholar]

[B7] 7. Burnstock G. Purine-mediated signalling in pain and visceral perception. Trends Pharmacol Sci 22: 182–188, 2001 [DOI] [PubMed] [Google Scholar]

[B8] 8. Burnstock G. Purines and sensory nerves. Handb Exp Pharmacol 333–392, 2009 [DOI] [PubMed] [Google Scholar]

[B9] 9. Caterina MJ, Schumacher MA, Tominaga M, Rosen TA, Levine JD, Julius D. The capsaicin receptor: a heat-activated ion channel in the pain pathway. Nature 389: 816–824, 1997 [DOI] [PubMed] [Google Scholar]

[B10] 10. Chateau Y, Misery L. Connections between nerve endings and epidermal cells: are they synapses? Exp Dermatol 13: 2–4, 2004 [DOI] [PubMed] [Google Scholar]

[B11] 11. Cheng L, Cao W, Behar J, Fiocchi C, Biancani P, Harnett KM. Acid-induced release of platelet-activating factor by human esophageal mucosa induces inflammatory mediators in circular smooth muscle. J Pharmacol Exp Ther 319: 117–126, 2006 [DOI] [PubMed] [Google Scholar]

[B12] 12. Cheng L, Cao W, Fiocchi C, Behar J, Biancani P, Harnett KM. HCl-induced inflammatory mediators in cat esophageal mucosa and inflammatory mediators in esophageal circular muscle in an in vitro model of esophagitis. Am J Physiol Gastrointest Liver Physiol 290: G1307–G1317, 2006 [DOI] [PubMed] [Google Scholar]

[B13] 13. Cheng L, Cao W, Fiocchi C, Behar J, Biancani P, Harnett KM. In vitro model of acute esophagitis in the cat. Am J Physiol Gastrointest Liver Physiol 289: G860–G869, 2005 [DOI] [PubMed] [Google Scholar]

[B14] 14. Cheng L, de la Monte S, Ma J, Hong J, Tong M, Cao W, Behar J, Biancani P, Harnett KM. HCl-activated neural and epithelial vanilloid receptors (TRPV1) in cat esophageal mucosa. Am J Physiol Gastrointest Liver Physiol 297: G135–G143, 2009 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B15] 15. Deuchars J. Knockout mice highlight the promise of purines. Trends Neurosci 24: 5–6, 2001 [DOI] [PubMed] [Google Scholar]

[B16] 16. Dhaka A, Viswanath V, Patapoutian A. Trp ion channels and temperature sensation. Annu Rev Neurosci 29: 135–161, 2006 [DOI] [PubMed] [Google Scholar]

[B17] 17. Dutsch M, Eichhorn U, Worl J, Wank M, Berthoud HR, Neuhuber WL. Vagal and spinal afferent innervation of the rat esophagus: a combined retrograde tracing and immunocytochemical study with special emphasis on calcium-binding proteins. J Comp Neurol 398: 289–307, 1998 [PubMed] [Google Scholar]

[B18] 18. Furness JB, Kunze WA, Bertrand PP, Clerc N, Bornstein JC. Intrinsic primary afferent neurons of the intestine. Prog Neurobiol 54: 1–18, 1998 [DOI] [PubMed] [Google Scholar]

[B19] 19. Guler AD, Lee H, Iida T, Shimizu I, Tominaga M, Caterina M. Heat-evoked activation of the ion channel, TRPV4. J Neurosci 22: 6408–6414, 2002 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B20] 20. Ismail-Beigi F, Horton PF, Pope CE., 2nd Histological consequences of gastroesophageal reflux in man. Gastroenterology 58: 163–174, 1970 [PubMed] [Google Scholar]

[B21] 21. Iwatsuki K, Ichikawa R, Hiasa M, Moriyama Y, Torii K, Uneyama H. Identification of the vesicular nucleotide transporter (VNUT) in taste cells. Biochem Biophys Res Commun 388: 1–5, 2009 [DOI] [PubMed] [Google Scholar]

[B22] 22. Karai LJ, Russell JT, Iadarola MJ, Olah Z. Vanilloid receptor 1 regulates multiple calcium compartments and contributes to Ca2+-induced Ca2+ release in sensory neurons. J Biol Chem 279: 16377–16387, 2004 [DOI] [PubMed] [Google Scholar]

[B23] 23. Kestler C, Neuhuber WL, Raab M. Distribution of P2X(3) receptor immunoreactivity in myenteric ganglia of the mouse esophagus. Histochem Cell Biol 131: 13–27, 2009 [DOI] [PubMed] [Google Scholar]

[B24] 24. Khakh BS, Burnstock G, Kennedy C, King BF, North RA, Seguela P, Voigt M, Humphrey PP. International union of pharmacology. XXIV. Current status of the nomenclature and properties of P2X receptors and their subunits. Pharmacol Rev 53: 107–118, 2001 [PubMed] [Google Scholar]

[B25] 25. Lee H, Caterina MJ. TRPV channels as thermosensory receptors in epithelial cells. Pflugers Arch 451: 160–167, 2005 [DOI] [PubMed] [Google Scholar]

[B26] 26. Ma J, Altomare A, de la Monte S, Tong M, Rieder F, Fiocchi C, Behar J, Shindou H, Biancani P, Harnett KM. HCl-induced inflammatory mediators in esophageal mucosa increase migration and production of H2O2 by peripheral blood leukocytes. Am J Physiol Gastrointest Liver Physiol 299: G791–G798, 2010 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B27] 27. Ma J, Harnett KM, Behar J, Biancani P, Cao W. Signaling in TRPV1-induced platelet activating factor (PAF) in human esophageal epithelial cells. Am J Physiol Gastrointest Liver Physiol 298: G233–G240, 2010 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B28] 28. Mandadi S, Sokabe T, Shibasaki K, Katanosaka K, Mizuno A, Moqrich A, Patapoutian A, Fukumi-Tominaga T, Mizumura K, Tominaga M. TRPV3 in keratinocytes transmits temperature information to sensory neurons via ATP. Pflugers Arch 458: 1093–1102, 2009 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B29] 29. Matthews PJ, Aziz Q, Facer P, Davis JB, Thompson DG, Anand P. Increased capsaicin receptor TRPV1 nerve fibres in the inflamed human oesophagus. Eur J Gastroenterol Hepatol 16: 897–902, 2004 [DOI] [PubMed] [Google Scholar]

[B30] 30. Mihara H, Boudaka A, Sugiyama T, Moriyama Y, Tominaga M. Transient receptor potential vanilloid 4 (TRPV4)-dependent calcium influx and ATP release in mouse oesophageal keratinocytes. J Physiol 589: 3471–3482, 2011 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B31] 31. Mizushima T, Obata K, Yamanaka H, Dai Y, Fukuoka T, Tokunaga A, Mashimo T, Noguchi K. Activation of p38 MAPK in primary afferent neurons by noxious stimulation and its involvement in the development of thermal hyperalgesia. Pain 113: 51–60, 2005 [DOI] [PubMed] [Google Scholar]

[B32] 32. Mochizuki T, Sokabe T, Araki I, Fujishita K, Shibasaki K, Uchida K, Naruse K, Koizumi S, Takeda M, Tominaga M. The TRPV4 cation channel mediates stretch-evoked Ca2+ influx and ATP release in primary urothelial cell cultures. J Biol Chem 284: 21257–21264, 2009 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B33] 33. Nomikos TN, Iatrou C, Demopoulos CA. Acetyl-CoA:1-O-alkyl-sn-glycero-3-phosphocholine acetyltransferase (lyso-PAF AT) activity in cortical and medullary human renal tissue. Eur J Biochem 270: 2992–3000, 2003 [DOI] [PubMed] [Google Scholar]

[B34] 34. North RA. Molecular physiology of P2X receptors. Physiol Rev 82: 1013–1067, 2002 [DOI] [PubMed] [Google Scholar]

[B35] 35. Olah Z, Szabo T, Karai L, Hough C, Fields RD, Caudle RM, Blumberg PM, Iadarola MJ. Ligand-induced dynamic membrane changes and cell deletion conferred by vanilloid receptor 1. J Biol Chem 276: 11021–11030, 2001 [DOI] [PubMed] [Google Scholar]

[B36] 36. Patapoutian A, Peier AM, Story GM, Viswanath V. ThermoTRP channels and beyond: mechanisms of temperature sensation. Nat Rev Neurosci 4: 529–539, 2003 [DOI] [PubMed] [Google Scholar]

[B37] 37. Raab M, Neuhuber WL. Number and distribution of intraganglionic laminar endings in the mouse esophagus as demonstrated with two different immunohistochemical markers. J Histochem Cytochem 53: 1023–1031, 2005 [DOI] [PubMed] [Google Scholar]

[B38] 38. Sadananda P, Shang F, Liu L, Mansfield KJ, Burcher E. Release of ATP from rat urinary bladder mucosa: role of acid, vanilloids and stretch. Br J Pharmacol 158: 1655–1662, 2009 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B39] 39. Sawada K, Echigo N, Juge N, Miyaji T, Otsuka M, Omote H, Yamamoto A, Moriyama Y. Identification of a vesicular nucleotide transporter. Proc Natl Acad Sci USA 105: 5683–5686, 2008 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B40] 40. Stoner GD, Kaighn ME, Reddel RR, Resau JH, Bowman D, Naito Z, Matsukura N, You M, Galati AJ, Harris CC. Establishment and characterization of SV-40 T-antigen immortalized human esophageal epithelial cells. Cancer Res 51: 365–371, 1991 [PubMed] [Google Scholar]

[B41] 41. Tokunaga A, Tsukimoto M, Harada H, Moriyama Y, Kojima S. Involvement of SLC17A9-dependent vesicular exocytosis in the mechanism of ATP release during T cell activation. J Biol Chem 285: 17406–17416, 2010 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B42] 42. Tominaga M, Wada M, Masu M. Potentiation of capsaicin receptor activity by metabotropic ATP receptors as a possible mechanism for ATP-evoked pain and hyperalgesia. Proc Natl Acad Sci USA 98: 6951–6956, 2001 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B43] 43. Vlaskovska M, Kasakov L, Rong W, Bodin P, Bardini M, Cockayne DA, Ford AP, Burnstock G. P2X3 knock-out mice reveal a major sensory role for urothelially released ATP. J Neurosci 21: 5670–5677, 2001 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B44] 44. vonKugelgen I, Wetter A. Molecular pharmacology of P2Y-receptors. Naunyn Schmiedebergs Arch Pharmacol 362: 310–323, 2000 [DOI] [PubMed] [Google Scholar]

[B45] 45. Wank M, Neuhuber WL. Local differences in vagal afferent innervation of the rat esophagus are reflected by neurochemical differences at the level of the sensory ganglia and by different brainstem projections. J Comp Neurol 435: 41–59, 2001 [DOI] [PubMed] [Google Scholar]

[B46] 46. Watanabe H, Vriens J, Suh SH, Benham CD, Droogmans G, Nilius B. Heat-evoked activation of TRPV4 channels in a HEK293 cell expression system and in native mouse aorta endothelial cells. J Biol Chem 277: 47044–47051, 2002 [DOI] [PubMed] [Google Scholar]

[B47] 47. Zimmermann K, Reeh PW, Averbeck B. ATP can enhance the proton-induced CGRP release through P2Y receptors and secondary PGE(2) release in isolated rat dura mater. Pain 97: 259–265, 2002 [DOI] [PubMed] [Google Scholar]

PERMALINK

ATP: a mediator for HCl-induced TRPV1 activation in esophageal mucosa

Jie Ma

Annamaria Altomare

Florian Rieder

Jose Behar

Piero Biancani

Karen M Harnett

Abstract

METHODS

Tissue preparation.

Measurement of CGRP and SP.

HCl-induced ATP release in HET-1A cells.

Real-time PCR for purinergic receptors.

Table 1.

Western blot analysis.

Lyso-PAF AT activity.

Lyso-PAF AT mRNA.

Table 2.

RESULTS

Fig. 1.

Fig. 2.

Fig. 3.

Fig. 4.

Fig. 5.

Fig. 6.

Fig. 7.

Fig. 8.

DISCUSSION

ATP-dependent release of CGRP and SP.

TRPV1-mediated release of ATP in epithelial cells.

Response to short-term and repeated HCl or ATP exposure.

GRANTS

DISCLOSURES

ACKNOWLEDGMENTS

REFERENCES

ACTIONS

PERMALINK

RESOURCES

Similar articles

Cited by other articles

Links to NCBI Databases