Skip to main content
PMC home page
PLOS ONE logoLink to PLOS ONE
. 2011 Dec 12;6(12):e28781. doi: 10.1371/journal.pone.0028781

Distribution and Regulation of the Mobile Genetic Element-Encoded Phenol-Soluble Modulin PSM-mec in Methicillin-Resistant Staphylococcus aureus

Som S Chatterjee 1, Liang Chen 2, Hwang-Soo Joo 1, Gordon Y C Cheung 1, Barry N Kreiswirth 2, Michael Otto 1,*
Editor: Malcolm James Horsburgh3
PMCID: PMC3236207  PMID: 22174895

Abstract

The phenol-soluble modulin PSM-mec is the only known staphylococcal toxin that is encoded on a mobile antibiotic resistance determinant, namely the staphylococcal cassette chromosome (SCC) element mec encoding resistance to methicillin. Here we show that the psm-mec gene is found frequently among methicillin-resistant Staphylococcus aureus (MRSA) strains of SCCmec types II, III, and VIII, and is a conserved part of the class A mec gene complex. Controlled expression of AgrA versus RNAIII in agr mutants of all 3 psm-mec-positive SCCmec types demonstrated that expression of psm-mec, which is highly variable, is controlled by AgrA in an RNAIII-independent manner. Furthermore, psm-mec isogenic deletion mutants showed only minor changes in PSMα peptide production and unchanged (or, as previously described, diminished) virulence compared to the corresponding wild-type strains in a mouse model of skin infection. This indicates that the recently reported regulatory impact of the psm-mec locus on MRSA virulence, which is opposite to that of the PSM-mec peptide and likely mediated by a regulatory RNA, is minor when analyzed in the original strain background. Our study gives new insight in the distribution, regulation, and role in virulence of the PSM-mec peptide and the psm-mec gene locus.

Introduction

Staphylococcus aureus is a significant human pathogen causing a series of acute and chronic, and frequently life-threatening diseases [1]. Widespread resistance to antibiotics severely complicates management of S. aureus infections [2]. S. aureus strains that are resistant to methicillin (methicillin-resistant S. aureus, MRSA) in particular are widespread in the hospital setting and have recently also caused a global epidemic of community-associated infections [3]. The molecular determinants that carry methicillin resistance are located on mobile genetic elements (MGEs) called staphylococcal cassette chromosome mec (SCCmec), which range in size from 21 to 67 kb. SCCmec elements contain genes involved in methicillin resistance and recombination, in addition to accessory elements such as transposons, integrated plasmids, and genes encoding resistance to heavy metals [4].

The virulence potential of S. aureus varies significantly among different strains as a result of the presence or absence of MGEs that contain genes coding for toxins and other virulence determinants [5]. In contrast, a series of core genome-encoded toxins such as alpha-toxin are present in virtually all S. aureus strains. Among those, phenol-soluble modulins (PSMs) have recently emerged as crucial virulence determinants that promote pro-inflammatory processes and lyse neutrophils and other human cell types [6],[7]. In addition, some PSMs facilitate biofilm structuring and dispersal [8].

We have recently discovered a novel PSM peptide, PSM-mec, which is encoded on SCCmec elements, representing the first toxin gene of S. aureus co-localized on MGEs with antibiotic resistance determinants [9]. According to published MRSA genome sequences, the psm-mec gene is found predominantly within SCCmec elements of types II and III [9]. However, a broad-scale analysis of the distribution of psm-mec in SCCmec elements of MRSA strains has not been performed yet.

Many toxins in S. aureus are under control of the Agr global virulence regulator [10]. Until recently, it was believed that all Agr targets are regulated via a regulatory RNA, RNAIII [11]. However, we have shown in a recent study that selected genes are controlled by the Agr system independently of RNAIII [12]. Genes coding for PSMs are the prototypes of such genes that are controlled by the AgrA DNA-binding protein in an RNAIII-independent fashion [12]. Like other PSMs, PSM-mec is under strict control by Agr, as evidenced by complete lack of production in agr deletion mutants [9]. However, it has remained unclear whether the psm-mec gene is under RNAIII- or AgrA-dependent control.

Previously, we demonstrated that in a strain that produces high relative amounts of PSM-mec compared to other PSMs, psm-mec significantly increases lysis of neutrophils and erythrocytes, and increases virulence in a mouse model of skin infection [9]. Furthermore, Kaito et al. recently showed that the psm-mec locus also has a regulatory function, presumably via a psm-mec-associated regulatory RNA, whose impact on virulence is opposite to that mediated by the PSM-mec peptide [13]. This was demonstrated using plasmid-based expression of the psm-mec gene with or without an altered start codon. While this method allows conclusions on a regulatory function of psm-mec, an understanding of the role of psm-mec in virulence can only be gained using manipulation of the genome of the original strain background. However, the result of deleting the psm-mec gene in strains other than those of SCCmec type II has not been evaluated.

Here, we analyzed a collection of 29 MRSA strains containing the most commonly isolated SCCmec and sequence types (STs) to analyze the distribution and location of the psm-mec gene in MRSA strains in detail. Furthermore, we investigated whether the psm-mec gene is under control of AgrA or RNAIII and to what extent deletion of psm-mec impacts virulence in strains of different SCCmec types.

Results

We first analyzed an MRSA strain collection containing all major SCCmec types for presence and location of the psm-mec gene. Characteristics of the analyzed MRSA strains, including clonal complex (CC), ST, spa type, and SCCmec type are shown in Table 1. We used two analytical PCR assays to determine whether the psm-mec gene is present and whether its location is conserved: the first PCR fragment amplified the psm-mec gene itself, while the second PCR tested for the connection between psm-mec and the adjacent mecI gene. Our results demonstrated presence of psm-mec in SCCmec types II, III, and VIII, i.e. those types that have a class A mec gene complex (containing the core genes of the SCCmec element in the order IS431-mecA-mecR1-mecI) [4], [14] (Fig. 1), while it was absent from types I, IV, V, and VI. Importantly, all tested type II, III, and VIII strains contained psm-mec, and the psm-mec gene was always connected to the mecI gene. Meanwhile, strain BK16991, possessing a truncated SCCmec III element (ϕSCCmec 16991) that carries a class A mec complex but lacks the ccr gene complex [14], was also positive for psm-mec (Tab. 1). Furthermore, production of PSM-mec peptide occurred only in strains positive for psm-mec and the psm-mec/mecI connection (Tab. 1). This indicates that psm-mec and its location are conserved features of the class A mec gene complex.

Table 1. Distribution of the psm-mec gene and PSM-mec peptide production in MRSA strains.

Strain Geographic origin CC ST spa types spa motif SCCmec type psm-mec gene psm-mec – mecI link PSM-mec peptide
NCTC10442 United Kingdom 8 250 1 YHGFMBQBLO I
NRS35 France 8 572 4 YHFGFMBQBLO I
NRS36 France 8 247 4 YHFGFMBQBLO I
NRS39 Scotland 8 247 40 YFGFMBQBLO I
Mu3 Japan 5 5 2 TJMBMDMGMK II + +
NRS74 United States 5 105 2 TJMBMDMGMK II + +
NRS382 United States 5 5 2 TJMBMDMGMK II + + +
NRS383 United States 30 36-likeb 16 WGKAKAOMQQQ II + + +
NRS22 United States 45 45 10 A2AKEEEMBKB II + + +
NRS27 United States 45 45 15 A2AKEEMBKB II + + +
85/2082 Japan 8 239 3 WGKAOMQ III + + +
BK1406 United States 8 239 3 WGKAOMQ III + + +
BK16704 Romania 8 239 351 WGKAQQ IIIa + + +
BK16691 Romania 8 239 351 WGKAQQ ϕSCCmec 16991 a + + +
NRS387 United States 5 5 29 TJMBMDMGGMK IV
NRS119 United States 8 507 7 YHGCMBQBLO IV
NRS386 United States 8 72 49 UJGFMGGM IV
NRS385 United States 8 8 7 YHGCMBQBLO IV
NRS271 United Kingdom 22 22 382 TJJEJNF2MNF2MOMOKR IV
NRS241 United States 59 59 17 ZDMDMNKB IV
NRS255 France 80 80 70 UJGBBPB IV
BK19489 United States 88 78 868 UFKBBPB IV
NRS265 Switzerland 88 88 876 UGFMEBBPB IV
BK23603 United States 8 8 664 YC2BQBLO V
WIS Australia 45 45 6 A2AKBEKBKB V
HTO826 France 152 377 207 UJ2GMKKPNSG V
HDE288 Portugal 5 5 45 TJMBDMGMK VI
BK20781 United States 8 8 1 YHGFMBQBLO VIII + + +
BK23684 Canada 8 8 544 YHGFC2BQBLO VIII + + +
Open in a new tab

aϕSCCmec 16991 is a truncated SCCmec III element, with a 24-kb deletion encompassing the right chromosomal junction downstream of the class A mec element; BK16704 possesses an SCCmec 3A.1.4 structure, with a dcs gene locus located at the J3 region of SCCmec element [19].

bsingle locus variant of ST36, with the MLST allelic profile 2-2-52-2-3-3-2.

Figure 1. Conserved location of the psm-mec gene in the class A mec gene complex.

Figure 1

Open in a new tab

The class A mec gene complex contains the core genes of the SCCmec element in the order IS431-mecA-mecR-mecI. Downstream of mecI, the psm-mec gene is encoded in opposite direction as a conserved part of this complex.

Expression of psm genes can vary considerably, with functionality of the Agr system having a strong effect on PSM production [7], [15]. Analysis of the presence of the psm-mec gene alone therefore only allows a preliminary assessment of the potential of a given strain to produce the PSM-mec peptide. Furthermore, our previous results indicated that the extent to which PSM-mec contributes to virulence is influenced to a large extent by the relative level of production compared to that of other PSMs [9]. Therefore, we first determined concentrations of all PSM peptides in culture filtrates of every MRSA strain of our collection that was positive for the psm-mec gene (Fig. 2). Absence of PSM-mec production in psm-mec-positive strains occurred in two strains (Mu3 and NRS74). Both these strains lacked production of any PSM peptide, indicating that this phenotype is due to Agr being non-functional. In strains with production of PSM-mec, concentrations relative to those of other PSMs varied. Strains BK16691 and BK23684 for example showed moderate absolute, but high relative production of PSM-mec compared to other PSMs, similar to strain MSA890 (SCCmec type II), in which PSM-mec has been shown in a mouse skin infection model to contribute significantly to virulence [9].

Figure 2. PSM production in psm-mec-positive MRSA strains.

Figure 2

Open in a new tab

All MRSA strains that were determined to be psm-mec-positive in this study were analyzed for production of all S. aureus PSM peptides (α1, α2, α3, α4, β1, β2, δ-toxin, mec) by RP-HPLC/MS. Production levels are shown for all peptides except for β1 and β2, for which production levels were in general very low. The previously analyzed MRSA strain MSA3407 is shown as reference.

PSM-mec concentration was strongly correlated with concentrations of AgrA-controlled PSMα peptides (PSMα1, p = 0.0002; PSMα2, p = 0.0008; PSMα3, p = 0.014; PSMα4, p = 0.0048; Pearson's correlation test) and the RNAIII-embedded δ-toxin (p<0.0001). Correlation with production of PSMβ peptides was not or barely significant, likely owing to the low level of PSMβ peptide concentration under the investigated conditions. Finally, there was no apparent correlation between SCCmec type and level of PSM production.

As the correlation analysis did not allow a clear distinction of whether expression of the psm-mec gene is under control of AgrA or RNAIII, we constitutively expressed agrA or RNAIII from plasmids in an agr-negative strain background, using the naturally agr-dysfunctional, psm-mec-positive MRSA strain N315 [9], [16]. Furthermore, we produced agr mutations in strain BK23684 (SCCmec type VIII,) and strain BK1406 (SCCmec type III). We then determined expression of psm-mec on the transcript and protein levels. These analyses clearly showed that psm-mec is under transcriptional control by the DNA-binding AgrA response regulator in all 3 strains, while RNAIII had no influence on psm-mec expression (Fig. 3A,B). Despite its unusual location on an MGE, the psm-mec gene is thus regulated in the same fashion as the other psm operons, psmα and psmβ [12]. Interestingly, the putative psm-mec promoter region does not contain sequences with strong homology to those of the psmα, psmβ, or agr P2 and P3 promoter regions. This finding is in keeping with our previous analysis of those promoters [12], which showed only little conservation of AgrA binding consensus sequences, underlining that AgrA-regulated genes cannot be identified based on sequence analysis alone.

Figure 3. Mechanism of Agr-dependent regulation of psm-mec.

Figure 3

Open in a new tab

Expression of psm-mec on the protein (A) and transcript (B) levels was analyzed in the psm-mec-positive, Agr-dysfunctional MRSA strains N315 (SCCmec type II), BK1406agr (SCCmec type III), and BK23684agr (SCCmec type VIII), in which the agrA gene or RNAIII were constitutively over-expressed using plasmid pTXΔ (in strain N315) or expressed using induction with 0.5% xylose in a pKX background (in the other 2 strains). Control, containing the empty plasmid pTXΔ16 or pKX16, respectively. (A) Protein level analysis. (B) Transcript level analysis. Relative expression of the psm-mec transcript is shown, relative to expression of the housekeeping gene gyrB. N.S., not significant; ***, p<0.0001; One-way analysis of variance with Dunnett post tests compared to the control sample.

Recently, Kaito et al. demonstrated a regulatory effect of the psm-mec RNA when over-expressed on a plasmid in hosts without SCCmec or with SCCmec type IV not harboring psm-mec [13]. Furthermore, under those circumstances the psm-mec transcript down-regulated expression of the cytolytic PSMα3 peptide and led to decreased virulence at least in part for that reason [13]. Of note, this report replaced, or added to, a previous hypothesis by the same authors, attributing that regulatory effect to a putative gene named fudoh [17], which overlaps with almost the entire psm-mec gene. Given the clear evidence for psm-mec expression [9], “fudoh” very likely is a pseudogene. In contrast, in our previous study, deletion of psm-mec in an SCCmec type II strain with high relative production of PSM-mec compared to other PSMs (MSA890) resulted in increased virulence and hemolysis, while in an SCCmec type II strain with lower relative production of PSM-mec (Sanger 252), virulence was not significantly changed [9]. Furthermore, we demonstrated a function of the PSM-mec peptide in cytolysis, indicating an important role in promoting disease [9]. To gain further insight into the role of the psm-mec locus in its different original strain backgrounds, we here analyzed two strains of SCCmec types not previously included in our analyses: one strain each of SCCmec type III and VIII (BK1406, BK23684), with moderate to high relative production of PSM-mec. We did not detect a significant change in virulence upon deletion of the psm-mec locus (Fig. 4). Additionally, we investigated in those 4 psm-mec deletion strains, containing examples of all SCCmec types in which psm-mec occurs, whether the genomic deletion of the psm-mec locus led to a change in the production of PSM peptides. We found only minor and inconsistent changes in PSM production of psm-mec deletion versus the corresponding wild-type strains (Fig. 5).

Figure 4. Mouse abscess model.

Figure 4

Open in a new tab

Isogenic psm-mec deletion mutants of strains BK1406 (SCCmec type III) and BK23684 (SCCmec type VIII) were compared to their corresponding wild-type strains in a mouse abscess model that was performed as previously described for strain MSA890 and its psm-mec deletion mutant [9]. Abscesses formed by strain BK1406 usually presented with open lesions, whereas those formed by strain BK23684 did not. There were no significant differences (using t-tests) between corresponding wild-type and psm-mec deletion mutant strain abscess sizes.

Figure 5. Impact of the psm-mec locus on the production of genome-encoded PSMs.

Figure 5

Open in a new tab

Four MRSA strains of 3 different SCCmec types and their isogenic psm-mec deletion mutants were analyzed for production of all S. aureus PSM peptides (α1, α2, α3, α4, β1, β2, δ-toxin, mec) by RP-HPLC/MS. Production levels are shown for all peptides except for β1 and β2, for which production levels were in general very low.

Discussion

The staphylococcal PSM-mec toxin is unique in its link to an antibiotic resistance element. This coupling allows simultaneous acquisition by S. aureus strains of key antibiotic resistance together with virulence determinants, significantly facilitating the spread of antibiotic resistance and virulence among the S. aureus population [9], [18]. The present study was undertaken because, despite the immense importance of such a mechanism for public health, we lack knowledge about distribution and location of the psm-mec gene.

Results from the present study show that the MGE-encoded psm-mec gene is widely distributed among MRSA strains and its expression is highly variable. The psm-mec gene is linked to the class A mec gene complex present in SCCmec types II, III, and VIII, with a conserved location next to the mecI gene. The fact that the psm-mec gene was always found among strains harboring SCCmec elements of types II, III, and VIII at the same location indicates that it is an original part of these elements, representing a possible marker for analytical purposes.

RNAIII-independent regulation via the Agr system has only recently been discovered, and the psmα and psmβ operons are the only genetic elements for which a direct binding of and regulation by the AgrA response regulator has been shown on a molecular level [12]. These findings indicated that PSMs represent evolutionarily early parts of the Agr regulon, while other targets of Agr regulation likely were added later, via evolution of the regulatory RNAIII and its connection to the Agr system. This raised the interesting question whether psm-mec is under the same, direct regulation of AgrA despite its location on an MGE. We demonstrate here that psm-mec shares with the other, core-genome encoded psm genes the characteristic Agr-dependent, but RNAIII-independent regulation. Thus, based on this similarity, it is tempting to speculate that core genome-encoded psm genes and psm-mec have a common origin.

Finally, we analyzed the contribution of psm-mec to virulence in SCCmec type III and VIII strains. We do not believe that the type of SCCmec element impacts the contribution of psm-mec to virulence, as the region around psm-mec is well conserved in SCCmec elements of class A. Rather, these experiments were performed to gain insight into the role of the psm-mec locus in additional strains. Our previous results on the cytolytic role of the PSM-mec toxin [9] and those by Kaito et al. [13] who found a regulatory effect of the psm-mec locus, including on genome-encoded PSMs, indicate that the contribution to virulence of the RNA and the peptide it encodes are opposite. However, the results by Kaito et al. were based entirely on plasmid-based over-expression in strains not naturally harboring psm-mec, prompting us to investigate the role of the psm-mec locus deletion by allelic replacement strategies, which are not influenced by plasmid copy effects and allow conclusions on the role of the locus in its natural strain background. In the 4 clinical strains that we investigated in our previous and the present study, absence of psm-mec either did not significantly alter virulence in a mouse skin infection model, or virulence was decreased. Furthermore, there were only very minor effects of the psm-mec deletion on the expression of other PSM peptides. Notably, this included the strongly cytolytic PSMα3, whose production was reported as decreased upon plasmid-based expression of psm-mec by Kaito et al. [13]. These findings suggest that the virulence-promoting effect of the PSM-mec peptide balances or supersedes the reported virulence-diminishing effect of the psm-mec RNA, depending on the strain background. In the future, a thorough analysis of the roles of psm-mec on the RNA and peptide levels will have to be accomplished using manipulations of psm-mec-containing clinical strains on the genome that allow a distinction between the roles of the psm-mec transcript and its product.

Methods

Ethics statement

Animal studies were carried out in strict accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health. The protocol was approved by the Animal Care and Use Committee (IUCAC number ASP LHBP 1E), National Institute of Allergy and Infectious Diseases.

Bacterial strains, typing, and growth conditions

The bacterial strains used in the present study are shown in Table 1. In addition, we used strains N315 and MSA3407, which were analyzed in our previous study on psm-mec [9]. SCCmec and spa typing were performed as previously described [14], [19]. All bacteria were grown in tryptic soy broth (TSB). For xylose induction experiments, glucose-free TSB was used. Antibiotics were added at appropriate concentrations (chloramphenicol, 10 µg/ml, tetracycline 12.5 µg/ml).

Production of psm-mec and agr mutants

Isogenic deletion mutants of the psm-mec locus in strains BK1406 and BK23684 were produced using allelic replacement with plasmid pKOR1 as described [9], [20]. Mutations in agr were produced by phage transduction from strain RN6911 (in strain BK23684), or by selection for a spontaneous agr mutation using a hemolysis screen for strain BK1406. The latter was necessary as a directed mutagenesis procedure via allelic replacement was not possible in any of the SCCmec type III strains in our collection, as they all carried a series of antibiotic resistances. The mutation in BK1406agr was mapped to base 739 (C to A), causing an amino acid substitution at the 247th position of AgrC (proline to threonine). Mutants in the agr locus were complemented with plasmids pTXΔRNAIII, pTXΔagrA [12] or a newly constructed pKXagrA. The plasmid pKXagrA contains kanamycin instead of tetracycline resistance and was constructed using the same primers as pTXΔagrA (for all oligonucleotides, see Table 2).

Table 2. Oligonucleotides used in this study.

Name Sequence
For psm-mec analytical PCR
Psmmec-for ATGGATTTCACTGGTGTTATTACAAGC
Psmmec-rev TTAACCGAAAGCCTGAATGCAAGTCTTG
For mecI link analytical PCR
Psmmec-for ATGGATTTCACTGGTGTTATTACAAGC
mecI-rev TACAAATGCAAAAGGACTGGAGTCC
For RT-PCR
psmmecRTfor TGCATATGGATTTCACTGGTGTTA
psmmecRTrev ATTTAATCAAGACTTGCATTCAG
psmmecRTprobe CGTTGAATATTTCCTCTGTTTTTTAGTTG
Open in a new tab

Analysis of PSM-mec production

Production of PSM-mec was analyzed by reversed-phase high pressure liquid chromatography/electrospray mass spectrometry (RP-HPLC/ESI-MS) of culture filtrates as described [7], [9].

Quantitative real-time PCR

Quantitative real-time PCR (qRT-PCR) was performed as described [21], using the house-keeping gene gyrB as control.

Animal skin infection model

The mouse skin infection (abscess) model was performed as described previously [22].

Statistics

Statistical analysis was performed using graph Pad Prism Version 5.04.

Footnotes

Competing Interests: The authors have declared that no competing interests exist.

Funding: This work was supported by the Intramural Research Program of the National Institute of Allergy and Infectious Diseases (NIAID), The National Institutes of Health (NIH). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

References

  • 1.Lowy FD. Staphylococcus aureus infections. N Engl J Med. 1998;339:520–532. doi: 10.1056/NEJM199808203390806. [DOI] [PubMed] [Google Scholar]
  • 2.Lowy FD. Antimicrobial resistance: the example of Staphylococcus aureus. J Clin Invest. 2003;111:1265–1273. doi: 10.1172/JCI18535. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.DeLeo FR, Otto M, Kreiswirth BN, Chambers HF. Community-associated meticillin-resistant Staphylococcus aureus. Lancet. 2010;375:1557–68. doi: 10.1016/S0140-6736(09)61999-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Hiramatsu K, Cui L, Kuroda M, Ito T. The emergence and evolution of methicillin-resistant Staphylococcus aureus. Trends Microbiol. 2001;9:486–493. doi: 10.1016/s0966-842x(01)02175-8. [DOI] [PubMed] [Google Scholar]
  • 5.Novick RP, Schlievert P, Ruzin A. Pathogenicity and resistance islands of staphylococci. Microbes Infect. 2001;3:585–594. doi: 10.1016/s1286-4579(01)01414-9. [DOI] [PubMed] [Google Scholar]
  • 6.Kretschmer D, Gleske A, Rautenberg M, Wang R, Koberle M, et al. Human formyl peptide receptor 2 (FPR2/ALX) senses highly pathogenic Staphylococcus aureus. Cell Host Microbe. 2010;7:463–73. doi: 10.1016/j.chom.2010.05.012. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Wang R, Braughton KR, Kretschmer D, Bach TH, Queck SY, et al. Identification of novel cytolytic peptides as key virulence determinants for community-associated MRSA. Nat Med. 2007;13:1510–1514. doi: 10.1038/nm1656. [DOI] [PubMed] [Google Scholar]
  • 8.Wang R, Khan BA, Cheung GY, Bach TH, Jameson-Lee M, et al. Staphylococcus epidermidis surfactant peptides promote biofilm maturation and dissemination of biofilm-associated infection in mice. J Clin Invest. 2011;121:238–248. doi: 10.1172/JCI42520. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Queck SY, Khan BA, Wang R, Bach TH, Kretschmer D, et al. Mobile genetic element-encoded cytolysin connects virulence to methicillin resistance in MRSA. PLoS Pathog. 2009;5:e1000533. doi: 10.1371/journal.ppat.1000533. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Peng HL, Novick RP, Kreiswirth B, Kornblum J, Schlievert P. Cloning, characterization, and sequencing of an accessory gene regulator (agr) in Staphylococcus aureus. J Bacteriol. 1988;170:4365–4372. doi: 10.1128/jb.170.9.4365-4372.1988. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Novick RP, Ross HF, Projan SJ, Kornblum J, Kreiswirth B, et al. Synthesis of staphylococcal virulence factors is controlled by a regulatory RNA molecule. Embo J. 1993;12:3967–3975. doi: 10.1002/j.1460-2075.1993.tb06074.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Queck SY, Jameson-Lee M, Villaruz AE, Bach TH, Khan BA, et al. RNAIII-Independent Target Gene Control by the agr Quorum-Sensing System: Insight into the Evolution of Virulence Regulation in Staphylococcus aureus. Mol Cell. 2008;32:150–158. doi: 10.1016/j.molcel.2008.08.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Kaito C, Saito Y, Nagano G, Ikuo M, Omae Y, et al. Transcription and translation products of the cytolysin gene psm-mec on the mobile genetic element SCCmec regulate Staphylococcus aureus virulence. PLoS Pathogens. 2011;7:e1001267. doi: 10.1371/journal.ppat.1001267. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Chen L, Mediavilla JR, Oliveira DC, Willey BM, de Lencastre H, et al. Multiplex real-time PCR for rapid Staphylococcal cassette chromosome mec typing. J Clin Microbiol. 2009;47:3692–3706. doi: 10.1128/JCM.00766-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Cheung GY, Rigby K, Wang R, Queck SY, Braughton KR, et al. Staphylococcus epidermidis strategies to avoid killing by human neutrophils. PLoS Pathogens. 2010;6:e1001133. doi: 10.1371/journal.ppat.1001133. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Kuroda M, Ohta T, Uchiyama I, Baba T, Yuzawa H, et al. Whole genome sequencing of meticillin-resistant Staphylococcus aureus. Lancet. 2001;357:1225–1240. doi: 10.1016/s0140-6736(00)04403-2. [DOI] [PubMed] [Google Scholar]
  • 17.Kaito C, Omae Y, Matsumoto Y, Nagata M, Yamaguchi H, et al. A novel gene, fudoh, in the SCCmec region suppresses the colony spreading ability and virulence of Staphylococcus aureus. PLoS ONE. 2008;3:e3921. doi: 10.1371/journal.pone.0003921. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Otto M. Staphylococcus aureus toxin gene hitchhikes on a transferable antibiotic resistance element. Virulence. 2010;1:49–51. doi: 10.4161/viru.1.1.10453. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Chen L, Mediavilla JR, Smyth DS, Chavda KD, Ionescu R, et al. Identification of a novel transposon (Tn6072) and a truncated staphylococcal cassette chromosome mec element in methicillin-resistant Staphylococcus aureus ST239. Antimicrob Agents Chemother. 2010;54:3347–3354. doi: 10.1128/AAC.00001-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Bae T, Schneewind O. Allelic replacement in Staphylococcus aureus with inducible counter-selection. Plasmid. 2006;55:58–63. doi: 10.1016/j.plasmid.2005.05.005. [DOI] [PubMed] [Google Scholar]
  • 21.Li M, Cha DJ, Lai Y, Villaruz AE, Sturdevant DE, et al. The antimicrobial peptide-sensing system aps of Staphylococcus aureus. Mol Microbiol. 2007;66:1136–1147. doi: 10.1111/j.1365-2958.2007.05986.x. [DOI] [PubMed] [Google Scholar]
  • 22.Cheung GY, Wang R, Khan BA, Sturdevant DE, Otto M. Role of the accessory gene regulator agr in community-associated methicillin-resistant Staphylococcus aureus pathogenesis. Infect Immun. 2011;79:1927–1935. doi: 10.1128/IAI.00046-11. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from PLoS ONE are provided here courtesy of PLOS

RESOURCES