Abstract
Background. The ratio of CA-MRSA in children with impetigo has been increasing in Japan. Methods. Antimicrobial susceptibilities of 136 S. aureus isolates from children with impetigo were studied. Furthermore, molecular epidemiological analysis and virulence gene analysis were performed. Results. Of the 136 S. aureus isolates, 122 (89.7%) were MSSA and 14 (10.3%) were MRSA. Of the 14 MRSA strains, 11 belonged to CC89 (ST89, ST91, and ST2117) and carried diverse types of SCCmec: type II (IIb: 3 strains; unknown subtype: 4 strains), type IVa (2 strains), and unknown type (2 strains). The remaining three strains exhibited CC8 (ST-8)-SCCmec type VIa, CC121 (ST121)-SCCmec type V, and CC5 (ST5)-nontypeable SCCmec element, respectively. None were lukS-PV-lukF-PV gene positive. Gentamicin- and clarithromycin-resistant strains were frequently found in both MRSA and MSSA. Conclusions. PVL-negative CC89-SCCmec type II strains are the most predominant strains among the CA-MRSA strains circulating in the community in Japan.
1. Introduction
Staphylococcus aureus (S. aureus) is an etiologic agent for a wide range of illnesses from localized skin infections such as impetigo, furuncles, and cellulitis to life-threatening diseases such as pneumonia, meningitis, osteomyelitis, necrotizing fasciitis, endocarditis, toxic shock syndrome, and bacteremia [1]. Hospital-associated methicillin-resistant S. aureus (HA-MRSA) first appeared in 1961 shortly after the introduction of methicillin under the selective pressure of antibiotics [2, 3]. Since then, numerous MRSA clones have emerged and become a major cause of nosocomial infections throughout the world [4–6]. MRSA produces penicillin-binding protein 2′ (PBP2′) with a low affinity for β-lactam antibiotics. PBP2′ is encoded by the mecA gene, which is located on a large mobile genetic DNA element, the staphylococcal cassette chromosome mec (SCCmec) [7, 8]. Early MRSA clones were HA-MRSA isolated from patients with compromised immune systems under medical procedures. However, in 1993, community-associated MRSA (CA-MRSA) emerged in patients without risk factors in Western Australia [9]. CA-MRSA clones, which are distinct from HA-MRSA clones, have evolved differently in separate geographical areas and have spread in communities [10]. The incidence of infections due to CA-MRSA, including infections in children with no identifiable risk factors, has increased worldwide as a community pathogen [11, 12]. There are several types of CA-MRSA clones including ST1 (USA400) in Asia, Europe, and the US, ST8 (USA 300) in Europe and the US, ST30 in Australia, Europe, and South America, ST59 in Asia and the US, and ST80 (European clone) in Asia, Europe, and the Middle East. However, recent studies have shown that CA-MRSA strains are spreading into hospitals and are replacing traditional HA-MRSA strains [13, 14]. Therefore, distinction between the traditional HA-MRSA and CA-MRSA strains based on epidemiologic definitions has become difficult, and distinction based on the molecular typing is unclear [4, 15].
S. aureus is both a commensal organism and a pathogen. S. aureus colonized in the anterior nares, skin, and gastrointestinal tract plays an important role in transmission among individuals and in development of infection [16]. Hisata et al. and Ozaki et al. reported that the prevalences of nasal carriage of S. aureus in healthy Japanese children were 28.2% and 40.4%, respectively, and that the ratios of MRSA strains among the S. aureus isolates were 15.1% and 9.1%, respectively [17, 18]. Impetigo is a highly contagious infection of the superficial epidermis and is commonly caused by exfoliative toxins (ETs) of S. aureus [19]. The ratio of MRSA among S. aureus isolates from patients with impetigo between 1994 and 2000 was below 20% in Japan [20]. However, the ratio of MRSA has recently increased to 20 ~ 50% in Japan [21–24].
The characteristics of CA-MRSA strains in Japan are different from those reported in other countries. Although highly virulent CA-MRSA strains carrying Panton-Valentine leukocidin (PVL) genes have been spreading widely in the world, PVL-negative CA-MRSA has been disseminated in Japan [15, 17, 18, 23, 25]. The aim of this study was to investigate the molecular epidemiology by multilocus sequence typing (MLST) and staphylococcal cassette chromosome mec (SCCmec) typing and the antimicrobial susceptibilities of S. aureus isolates from children with impetigo.
2. Materials and Methods
2.1. Bacterial Strains
Samples were isolated from skin swabs taken from pediatric outpatients with impetigo. A total of 136 S. aureus isolates were collected from 136 different patients (69 males and 67 females; mean age: 3.8 years; SD: 2.3 years) with impetigo at private offices of 25 practicing pediatricians and 10 hospitals between June 2009 and June 2010 in Hokkaido, the northernmost island of Japan. All samples were collected after obtaining informed consent from the children's parents. MRSA strains were identified by polymerase chain reaction (PCR) for the mecA gene and by the detection of penicillin-binding protein 2′ (Denka Seiken, Co., Tokyo, Japan).
2.2. Molecular Typing and Virulence Gene Analysis
PCR primers used for molecular typing and virulence gene analysis in this study are listed in Table 1. The presence of genes encoding PVL (lukS-PV-lukF-PV), toxic shock syndrome toxin 1 (TSST-1) (tst), and 2 ETs (ETA, ETB) (eta, etb) was examined by the PCR method using previously reported primers [26]. MRSA isolates were characterized by MLST as specific sequence types (STs) and clonal complexes (CCs) based on the DNA sequences at 7 defined loci. MLST was performed as described by Enright et al. [27]. MLST is based on sequence analysis of PCR products from seven S. aureus housekeeping genes, that is, arcC, aroE, glpF, gmk, pta, tpi, and yqiL. Each sequence was submitted to the MLST database website (http://www.mlst.net/) for the assignment of the allelic profile and ST. Different sequences are assigned distinct alleles of each housekeeping gene, and each isolate is defined by alleles of the seven genes. The ST data were further analyzed using eBURST (http://eburst.mlst.net/) to determine the CC. SCCmec typing was performed by the multiplex PCR method described by Kondo et al. SCCmec types (I to VI) were determined on the basis of the class (classes A, B, and C) of mec gene complex and the type (types 1, 2, 3, 4, and 5) of ccr gene complex [26]. Subtyping of SCCmec types II and IV was performed on the basis of different J1 regions by PCR using published primers [28].
Table 1.
List of primers.
| Gene | Primer name | Size of product (bp) | Primer sequence (5′→3′) | Reference |
|---|---|---|---|---|
| (1) Detection of virulence gene | [26] | |||
| lukS-PV-lukF-PV | luk-PV-1 | ATCATTAGGTAAAATGTCTGGACATGATCCA | ||
| luk-PV-2 | 433 | GCATCAASTGTATTGGATAGCAAAAGC | ||
| tst | TST-1 | TTCACTATTTGTAAAAGTGTCAGACCCACT | ||
| TST-2 | 180 | TACTAATGAATTTTTTTATCGTAAGCCCTT | ||
| eta | mpETA-1 | ACTGTAGGAGCTAGTGCATTTGT | ||
| mpETA-3 | 190 | TGGATACTTTTGTCTATCTTTTTCATCAAC | ||
| etb | mpETB-1 | CAGATAAAGAGCTTTATACACACATTAC | ||
| mpETB-2 | 621 | AGTGAACTTATCTTTCTATTGAAAAACACTC | ||
| (2) SCCmec typing | [28] | |||
| (i) ccr gene complex type with mecA | ||||
| mecA | mA1 | TGCTATCCACCCTCAAACAGG | ||
| mA2 | 286 | AACGTTGTAACCACCCCAAGA | ||
| Type 1 | α1 | AACCTATATCATCAATCAGTACGT | ||
| βc | 695 | ATTGCCTTGATAATAGCCITCT | ||
| Type 2 | α2 | TAAAGGCATCAATGCACAAACACT | ||
| βc | 937 | ATTGCCTTGATAATAGCCITCT | ||
| Type 3 | α3 | AGCTCAAAAGCAAGCAATAGAAT | ||
| βc | 1,791 | ATTGCCTTGATAATAGCCITCT | ||
| Type 4 | α4.2 | GTATCAATGCACCAGAACTT | ||
| β4.2 | 1,287 | TTGCGACTCTCTTGGCGTTT | ||
| type 5 | γF | CGTCTATTACAAGATGTTAAGGATAAT | ||
| γR | 518 | CCTTTATAGACTGGATTATTCAAAATAT | ||
| (ii) mec gene complex class | ||||
| mecA | ml6 | CATAACTTCCCATTCTGCAGATG | ||
| mA7 | 1,963 | ATATACCAAACCCGACAACTACA | ||
| mecB | IS7 | ATGCTTAATGATAGCATCCGAATG | ||
| mA7 | 2,827 | ATATACCAAACCCGACAACTACA | ||
| mecC (C2) | mA7 | ATATACCAAACCCGACAACTACA | ||
| IS2(iS-2) | 804 | TGAGGTTATTCAGATATTTCGATGT | ||
| (iii) SCCmec type II subtyping | ||||
| IIa (II.1) | kdpB2 | TAAACTGTGTCACACGATCCAT | ||
| kdpB1 | 287 | GATTACTTCAGAACCAGGTCAT | ||
| IIb (II.2) | 2b3 | GCTCTAAAAGTTGGATATGCG | ||
| 2b4 | 1,518 | TGGATTGAATCGACTAGAATCG | ||
| IIE (II.3) | 4b3 | AACCAACAGTGGTTACAGCTT | ||
| 4b4 | 726 | CGGATTTTAGACTCATCACCAT | ||
| II.4 | II4-3 | GTACCGCTGAATATTGATAGTGAT | ||
| II4-1 | 2,003 | ACTCTAATCCTAATCACCGAAC | ||
| (iv) SCCmec type IV subtyping | ||||
| IVa (IV.1) | 4al | TTTGAATGCCCTCCATGAATAAAAT | ||
| 4a3 | 458 | AGAAAAGATAGAAGTTCGAAAGA | ||
| IVb (IV.2) | 4b3 | AACCAACAGTGGTTACAGCTT | ||
| 4b4 | 726 | CGGATTTTAGACTCATCACCAT | ||
| IVc (IV.3) | 4c5 | ATCCATTTCTCAGGAGTTAG | ||
| 4c4 | 259 | AGGAAATCGATGTCATTATAA | ||
| IVd (IV.4) | 4d3 | AATTCACCCGTACCTGAGAA | ||
| 4d4 | 1,242 | AGAATGTGGTTATAAGATAGCTA | ||
| (3) Multilocus sequence typing (MLST) | [27] | |||
| carbamate kinase (arcC) | arcC-Up | TTGATTCACCAGCGCGTATTGTC | ||
| arcC-Dn | 456 | AGGTATCTGCTTCAATCAGCG | ||
| Shikimate dehydrogenase (aroE) | aroE-Up | ATCGGAAATCCTATTTCACATTC | ||
| aroE-Dn | 456 | GGTGTTGTATTAATAACGATATC | ||
| Glycerol kinase (glpF) | glpF-Up | CTAGGAACTGCAATCTTAATCC | ||
| glpF-Dn | 465 | TGGTAAAATCGCATGTCCAATTC | ||
| Guanylate kinase (gmk) | gmk-Up | ATCGTTTTATCGGGACCATC | ||
| gmk-Dn | 429 | TCATTAACTACAACGTAATCGTA | ||
| Phosphate acetyltransferase (pta) | pta-Up | GTTAAAATCGTATTACCTGAAGG | ||
| pta-Dn | 474 | GACCCTTTTGTTGAAAAGCTTAA | ||
| Triosephosphate isomerase (tpi) | tpi-Up | TCGTTCATTCTGAACGTCGTGAA | ||
| tpi-Dn | 402 | TTTGCACCTTCTAACAATTGTAC | ||
| Acetyl coenzyme A acetyltransferase (yqiL) | yqiL-Up | CAGCATACAGGACACCTATTGGC | ||
| yqiL-Dn | 516 | CGTTGAGGAATCGATACTGGAAC |
2.3. Antimicrobial Susceptibility Testing
For in vitro antimicrobial susceptibility testing, minimal inhibitory concentrations (MICs) of a panel of 12 antimicrobial drugs, that is, oxacillin (MPIPC), ampicillin (ABPC), cefaclor (CCL), cefditoren (CDTR), clarithromycin (CAM), clindamycin (CLDM), fosfomycin (FOM), minocycline (MINO), gentamicin (GM), vancomycin (VCM), nadifloxacin (NDFX), and fucidic acid (FA), were determined using a frozen plate (Eiken Chemical Co., Tokyo, Japan). This plate is based on the broth microdilution method recommended by the Japan Society for Chemotherapy (JSC) [29, 30]. The breakpoints for these antimicrobial agents were determined according to the interpretation criteria of Clinical and Laboratory Standards Institute (CLSI) [31, 32] and JSC [29, 30]. Susceptibilities to antimicrobial drugs for which breakpoints are not determined by CLSI and JSC were defined in this study. A nitrocefin method was used for β-lactamase detection [33].
3. Results
In the bacteriological analysis of the 155 patients with impetigo, S. aureus and Streptococcus pyogenes were isolated from 136 and 6, respectively. Two cases involved two pathogens. No pathogenic organism was isolated from 15 patients. Of the 136 S. aureus cases, 122 (89.7%) were MSSA and 14 (10.3%) were MRSA. The 14 MRSA patients except for two newborns did not have a history of hospitalization during the previous year. Age distribution in the 136 patients was shown in Table 2.
Table 2.
Age distribution in the 136 patients.
| Age (years) | MSSA | MRSA | Total |
|---|---|---|---|
| <1 | 13 | 2 | 15 |
| 1–<2 | 19 | 2 | 21 |
| 2–<3 | 16 | 5 | 21 |
| 3–<4 | 16 | 2 | 18 |
| 4–<5 | 15 | 1 | 16 |
| 5–<6 | 17 | 0 | 17 |
| 6–<7 | 15 | 2 | 17 |
| 7–<12 | 11 | 0 | 11 |
|
| |||
| Total | 122 | 14 | 136 |
The molecular characteristics of the 14 MRSA strains isolated from the patients with impetigo were examined and are summarized in Table 3. Among the 14 strains that carried the mec gene complex, 11 were determined the SCCmec element type. By SCCmec typing, the 14 MRSA strains were defined as SCCmec type II (IIb: 3 strains; IINT: 4 strains), type IVa (3 strains), type V (1 strain), and unknown type (3 strains). Types of ccr gene complex in 3 strains could not be determined.
Table 3.
Molecular characterization of 14 MRSA strains isolated from patients with impetigo.
| Strain | Age | SCCmec typing | MLST | Presence of exotoxin genes | |||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| SCCmec type | ccr | mec | ST | CC | Allelic profile | lukS-PV-lukF-PV | tst | eta | etb | ||
| T-11 | 1 yr | IIb | 2 | A | 2117 | 89 | 1-310-28-18-18-33-50 | − | − | − | + |
| T-33 | 6 yrs 4 mos | IVa | 2 | B | 91 | 89 | 1-26-28-18-18-54-50 | − | − | − | + |
| T-55 | 2 yrs 6 mos | NT | NT | A | 89 | 89 | 1-26-28-18-18-33-50 | − | − | − | + |
| T-64 | 2 yra 6 mos | IINT | 2 | A | 89 | 89 | 1-26-28-18-18-33-50 | − | − | − | + |
| T-71 | 6 yrs 6 mos | IIb | 2 | A | 89 | 89 | 1-26-28-18-18-33-50 | − | − | − | + |
| T-79 | 3 yrs 10 mos | IVa | 2 | B | 91 | 89 | 1-26-28-18-18-54-50 | − | − | − | + |
| T-83 | 3 yrs 11 mos | IINT | 2 | A | 89 | 89 | 1-26-28-18-18-33-50 | − | − | − | + |
| T-114 | 2 yrs 3 mos | NT | NT | A | 89 | 89 | 1-26-28-18-18-33-50 | − | − | − | + |
| T-119 | 2 yrs 2 mos | NT | NT | A | 5 | 5 | 1-4-1-4-12-1-10 | − | + | − | − |
| T-125 | 4 yrs | V | 5 | C2 | 121 | 121 | 6-5-6-2-7-14-5 | − | − | + | − |
| T-132 | 19 ds | IINT | 2 | A | 89 | 89 | 1-26-28-18-18-33-50 | − | − | − | + |
| T-137 | 1 yr 1 mo | IIb | 2 | A | 89 | 89 | 1-26-28-18-18-33-50 | − | − | − | + |
| T-139 | 10 ds | IINT | 2 | A | 89 | 89 | 1-26-28-18-18-33-50 | − | − | − | + |
| T-144 | 2 yrs 1 mo | IVa | 2 | B | 8 | 8 | 3-3-1-1-4-4-3 | − | + | − | − |
NT: nontypeable.
The 14 MRSA strains were comprised of 4 CCs. The four CCs were CC89 (11/14), CC5 (1/14), CC8 (1/14), and CC121 (1/14). ST89, ST91, and ST2117 strains belonged to the same CC89. No PVL-positive strains were identified in the 14 MRSA strains. The MRSA strains belonging to ST5 and ST8 carried TSST-1. Of the 14 MRSA strains, 11 (78.6%) were etb gene positive, and one was eta gene positive. There was no strain carrying both eta and etb genes. The MRSA strains belonging to ST5 and ST8 were both eta gene- and etb gene-negative.
Antimicrobial susceptibilities of the MRSA and MSSA strains to 12 antimicrobial agents are summarized in Table 4. The MICs of 12 antimicrobial agents for 14 individual MRSA strains are shown in Table 5. β-Lactamase was produced by 99 (72.8%) of the 136 S. aureus isolates. Of the 122 MSSA isolates, 85 (69.7%) were β-lactamase producers. All MRSA isolates were β-lactamase-positive. MRSA strains were highly resistant to CCL, CDTR, and CLDM. GM- and CAM-resistant strains were frequently found in both MRSA and MSSA. MINO, NDFX, FA and VCM had significant antimicrobial activity against the S. aureus isolates. The ST5 MRSA strain exhibited resistance to multiple drugs, including MINO and NDFX.
Table 4.
Comparison of antimicrobial susceptibilities of MRSA and MSSA.
| Antimicrobial agent | Resistance breakpoint (μg/mL) | MSSA (n = 122) | MRSA (n = 14) | ||||
|---|---|---|---|---|---|---|---|
| Range (μg/mL) | MIC90 (μg/mL) | Resistance (%) | Range (μg/mL) | MIC90 (μg/mL) | Resistance (%) | ||
| MPIPC | 4 | ≦2 | ≦2 | 0 | 4–>8 | >8 | 100 |
| ABPC | 0.5 | ≦0.12 5–>16 | 16 | 71.3 | 4–>16 | >16 | 100 |
| CCL | 16 | 1–16 | 4 | 1.6 | 4–>16 | >16 | 92.9 |
| CDTR | 2* | 0.5 –2 | 1 | 0.8 | 2–>16 | >16 | 100 |
| CAM | 4 | ≦0.125–>16 | >16 | 67.2 | >16 | >16 | 100 |
| CLDM | 1 | ≦0.125–0.25 | 0.25 | 0 | ≦0.125–>16 | >16 | 71.4 |
| FOM | 8** | 0.25–>16 | 16 | 20.5 | 1–>16 | 8 | 14.3 |
| MINO | 8 | ≦0.125–0.25 | ≦0.125 | 0 | ≦0.125–16 | 0.25 | 7.1 |
| GM | 8 | 0.25–>16 | >16 | 54.1 | 1–>16 | >16 | 92.9 |
| VCM | 4 | ≦0.5–1 | 1 | 0 | 1-2 | 1 | 0 |
| NDFX | 4** | ≦0.125–2 | ≦0.125 | 0 | ≦0.125–>16 | ≦0.125 | 7.1 |
| FA | 2** | ≦0.125–>16 | 0.5 | 0.82 | ≦0.125–1 | 0.5 | 0 |
The breakpoints for these antimicrobial agents were determined according to the interpretation criteria of Clinical and Laboratory Standards Institute (CLSI). Susceptibility to antimicrobial drugs for which breakpoints are not determined by CLSI was according to the interpretation criteria of the Japan Society for Chemotherapy (*) or defined in this study (**).
Table 5.
Antimicrobial susceptibilities of 14 MRSA strains.
| Strain | MIC (μg/mL) of antimicrobial agents | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| MPIPC | ABPC | CCL | CDTR | CAM | CLDM | FOM | MINO | GM | VCM | NDFX | FA | |
| T-11 | >8 | >16 | >16 | >16 | >16 | >16 | 1 | ≦0.125 | >16 | 2 | ≦0.125 | 0.25 |
| T-33 | >8 | 16 | >16 | 4 | >16 | >16 | 2 | ≦0.125 | >16 | 1 | ≦0.125 | 0.25 |
| T-55 | >8 | 16 | >16 | 8 | >16 | >16 | 4 | 0.25 | >16 | 1 | ≦0.125 | 0.25 |
| T-64 | >8 | >16 | >16 | >16 | >16 | >16 | 2 | ≦0.125 | >16 | 1 | ≦0.125 | 0.25 |
| T-71 | >8 | 16 | 16 | 4 | >16 | >16 | 2 | ≦0.125 | >16 | 1 | ≦0.125 | ≦0.125 |
| T-79 | >8 | 16 | >16 | 4 | >16 | ≦0.125 | 4 | ≦0.125 | >16 | 1 | ≦0.125 | 0.25 |
| T-83 | >8 | 16 | >16 | 4 | >16 | >16 | 2 | 0.25 | >16 | 1 | ≦0.125 | ≦0.125 |
| T-114 | >8 | 16 | >16 | 16 | >16 | >16 | 1 | ≦0.125 | >16 | 1 | ≦0.125 | 0.25 |
| T-119 | >8 | >16 | >16 | >16 | >16 | ≦0.125 | >16 | 16 | >16 | 1 | >16 | 0.5 |
| T-125 | 4 | 4 | 4 | 2 | >16 | 0.25 | 4 | ≦0.125 | >16 | 1 | ≦0.125 | 0.25 |
| T-132 | >8 | 16 | >16 | 16 | >16 | >16 | 2 | ≦0.125 | >16 | 1 | ≦0.125 | ≦0.125 |
| T-137 | >8 | >16 | >16 | >16 | >16 | >16 | 2 | ≦0.125 | >16 | 1 | ≦0.125 | 1 |
| T-139 | >8 | 16 | >16 | 16 | >16 | >16 | 2 | ≦0.125 | >16 | 1 | ≦0.125 | 0.25 |
| T-144 | >8 | 16 | >16 | 16 | >16 | ≦0.125 | 8 | ≦0.125 | 1 | 1 | ≦0.125 | 0.25 |
4. Discussion
The rate of CA-MRSA in patients with impetigo has been increasing in Japan. In this study, only 10.3% of the S. aureus isolates from patients with impetigo in Hokkaido, the northernmost island of Japan, were MRSA. The ratio of MRSA strains in Hokkaido is lower than those in other regions in recent studies [21–24]. This ratio of CA-MRSA in patients with impetigo in Hokkaido is similar to that in healthy children previously reported in Japan [17, 18]. However, further continuous surveillance is needed to clarify whether the low ratio of CA-MRSA in Hokkaido is true or due to biases.
HA-MRSA strains usually carry large SCCmec type I, II, or III and are usually multidrug resistant. On the other hand, CA-MRSA strains usually carry smaller SCCmec type IV or V and are usually more susceptible to non-β-lactam antibiotics [11, 34]. In previous studies, SCCmec type IV MRSA strains have been predominantly isolated from patients with impetigo [22, 35, 36]. Noguchi et al. reported that 98.7% of the MRSA strains isolated from patients with impetigo and staphylococcal scalded skin syndrome between 1999 and 2004 in Japan had type IV SCCmec [35]. Takizawa et al. reported that all of the characterized MRSA strains isolated from patients with impetigo in 2003 and 2004 also had type IV SCCmec [22]. Nakaminami et al. examined MRSA strains isolated from patients with impetigo in Japan in 2006 and reported that all isolates with SCCmec were classified into type IV (92.8%) and V (7.2%) [36]. MRSA strains isolated from children with impetigo in China from 2003 to 2007 were classified into type IV (54.5%), type V (18.2%), and VI (9.1%) [37].
However, in very recent studies, MRSA strains isolated from patients with impetigo had diverse SCCmec types, and SCCmec type IIb has been increasing [23, 24]. Type IIb SCCmec was first identified from MRSA strains isolated from healthy Japanese children [17]. Hisata et al. characterized 17 MRSA strains isolated from patients with impetigo at a Japanese hospital from June through August 2002. They found that the 17 MRSA strains carried diverse types of SCCmec: type II (IIb: 4 strains; unknown subtype: 2 strains), type IV (7 strains), and type V (4 strains) [23]. Shi et al. reported that among 26 MRSA strains isolated from patients with impetigo, 57.7% carried type IIa SCCmec element and 42.3% carried type IV SCCmec element [24]. In the present study, the MRSA strains isolated from patients with impetigo also had diverse SCCmec types, and SCCmec type II, including type IIb and IINT, was the predominant type among the CA-MRSA strains.
The role of PVL in the pathogenesis of staphylococcal infections is controversial [38]. However, PVL is responsible at least in part for the increased virulence of CA-MRSA. PVL-positive S. aureus strains are more frequently associated with cellulitis and abscesses than with impetigo [39–41]. In this study, none of the MRSA isolates carried the PVL gene. Although highly virulent CA-MRSA strains carrying PVL genes are known to prevail in the world, the prevalence of PVL-positive strains in Japan is not high [15, 17, 18, 23, 25]. There are three serological forms of ET, ETA, ETB, and ETD, which are linked to human impetigo [19]. The eta gene, encoding ETA, is located on a chromosome, whereas the etb gene, encoding ETB, is present on a plasmid. The eta and etb genes are generally found in S. aureus isolated from patients with impetigo. The etb gene is predominantly found in MRSA strains with mecA. In this context, our data support previous data [21, 23, 24, 35, 36].
MLST is an excellent tool for investigating clonal evolution of MRSA. Six STs (ST5, ST8, ST89, ST91, ST121, and ST2117) were identified, and they were classified into four CCs (CC5, CC8, CC89, and CC121) in the present study. PVL-negative CA-MRSA strains, which belong to ST89 and ST91, have been associated with impetigo in Japanese children [22–24]. In this study, the most common ST in MRSA strains was also ST89 (57.1%), followed by ST91 (14.3%). ST89 and ST91 both belonged to the same CC89. We found that 11 of the 14 MRSA strains belonged to CC89 and carried diverse SCCmec types, IIb, IINT, Iva, and NT. Although one strain belonging to ST5, which has been commonly identified in HA-MRSA with type II SCCmec, was found in our MRSA isolates, it carried a nontypeable SCCmec element. The class of mec gene complex in the strain was class A, indicating that its SCCmec type should be a type other than type I, IV, V, VI, or VII [42]. In a previous study by Hisata et al. ST5 MRSA with SCCmec type IIa, which was indistinguishable from HA-MRSA strains (New York/Japan clone [5]) in Japan, accounted for 22.7% of MRSA strains isolated from healthy children [17]. Our ST5 MRSA strain was resistant to multiple drugs, including MINO and NDFX. Although ST8 MRSA strain with SCCmec type IVa [22, 43] and ST121 MRSA strain with SCCmec type V [44, 45] have been identified in CA-MRSA associated with impetigo, our MRSA strains with the same phenotypes did not carry PVL.
It is generally accepted that bacterial resistance to antimicrobial agents parallels the frequency of use of the agents. Unlike HA-MRSA, CA-MRSA is generally susceptible to non-β-lactam antibiotics, such as aminoglycosides, tetracyclines, and fluoroquinolones. However, S. aureus isolates from patients with impetigo were highly resistant to GM and CAM, reflecting frequent usage of GM ointment for the treatment of skin infections including impetigo and frequent usage of CAM for respiratory infection in Japan [20, 21, 35, 36].
5. Conclusions
This study and a previous study indicated that PVL-negative CC89 strain with a marked divergence in SCCmec types predominated in Japanese communities, suggesting that it might be a Japanese domestic CA-MRSA clone. The existence of multiple types of SCCmec elements suggested that MRSA strains might be emerging locally in the community under the selective pressure of antibiotics. Furthermore, SCCmec II CA-MRSA may at least partially be beginning to replace SCCmec IVa CA-MRSA. Continuous monitoring of MRSA epidemiology using MLST and SCCmec typing and drug resistance trends would show change in the clonal distribution of MRSA, which may be crucial for the effective management of impetigo.
Acknowledgments
The following clinicians participated in this study: Dr. Yasushi Akutsu, Dr. Hideki Arioka, Dr. Yasushi Deguchi, Dr. Shihoko Fujisaki, Dr. Tomoko Hayashi, Dr. Wataru Ikemoto, Dr. Akira Inagawa, Dr. Fumie Inyaku, Dr. Keisaku Imamura, Dr. Syousuke Imai, Dr. Noriyuki Ishii, Dr. Akihito Ishizaka, Dr. Shouichi Kasahara, Dr. Hideaki Kikuta, Dr. Mutsuko Konno, Dr. Kimikazu Kojima, Dr. Shuji Nakata, Dr. Naoko Nagano, Dr. Hitoshi Ochi, Dr. Yasuhisa Odagawa, Dr. Yachio Ohta, Dr. Miho Oshima, Dr. Hideto Otoi, Dr. Masahiko Mizumoto, Dr. Youko Sakata, Dr. Toshiya Satou, Dr. Mutsuo Shibata, Dr. Yoshitaka Shibuya, Dr. Kazunori Shinojima, Dr. Yuichi Taguchi, Dr. Chie Tobise, Dr. Hideaki Tsukazaki, Dr. Susumu Ukae, Dr. Michio Yamamoto, and Dr. Hideatsu Yoshimura. The authors thank Meiji Seika Pharma Co. Ltd. for financial support and molecular analysis and Mr. Stewart Chisholm for proofreading the manuscript. In addition, they thank Mr. Suguru Konishi for performing the statistical analysis.
References
- 1.Archer GL. Staphylococcus aureus: a well-armed pathogen. Clinical Infectious Diseases. 1998;26(5):1179–1181. doi: 10.1086/520289. [DOI] [PubMed] [Google Scholar]
- 2.Jevons MP. "Celbenin"-resistant staphylococci. British Medical Journal. 1961;1(5219):124–125. [PMC free article] [PubMed] [Google Scholar]
- 3.Barrett FF, McGehee RF, Jr., Finland M. Methicillin-resistant Staphylococcus aureus at Boston City Hospital. Bacteriologic and epidemiologic observations. New England Journal of Medicine. 1968;279(9):441–448. doi: 10.1056/NEJM196808292790901. [DOI] [PubMed] [Google Scholar]
- 4.Deurenberg RH, Vink C, Kalenic S, Friedrich AW, Bruggeman CA, Stobberingh EE. The molecular evolution of methicillin-resistant Staphylococcus aureus . Clinical Microbiology and Infection. 2007;13(3):222–235. doi: 10.1111/j.1469-0691.2006.01573.x. [DOI] [PubMed] [Google Scholar]
- 5.Stefani S, Varaldo PE. Epidemiology of methicillin-resistant staphylococci in Europe. Clinical Microbiology and Infection. 2003;9(12):1179–1186. doi: 10.1111/j.1469-0691.2003.00698.x. [DOI] [PubMed] [Google Scholar]
- 6.Gordon RJ, Lowy FD. Pathogenesis of methicillin-resistant Staphylococcus aureus infection. Clinical Infectious Diseases. 2008;46(supplement 5):S350–S359. doi: 10.1086/533591. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Hartman B, Tomasz A. Altered penicillin-binding proteins in methicillin-resistant strains of Staphylococcus aureus . Antimicrobial Agents and Chemotherapy. 1981;19(5):726–735. doi: 10.1128/aac.19.5.726. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Katayama Y, Ito T, Hiramatsu K. A new class of genetic element, staphylococcus cassette chromosome mec, encodes methicillin resistance in Staphylococcus aureus . Antimicrobial Agents and Chemotherapy. 2000;44(6):1549–1555. doi: 10.1128/aac.44.6.1549-1555.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Udo EE, Pearman JW, Grubb WB. Genetic analysis of community isolates of methicillin-resistant Staphylococcus aureus in Western Australia. Journal of Hospital Infection. 1993;25(2):97–108. doi: 10.1016/0195-6701(93)90100-e. [DOI] [PubMed] [Google Scholar]
- 10.Chambers HF. The changing epidemiology of Staphylococcus aureus? Emerging Infectious Diseases. 2001;7(2):178–182. doi: 10.3201/eid0702.010204. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Okuma K, Iwakawa K, Turnidge JD, et al. Dissemination of new methicillin-resistant Staphylococcus aureus clones in the community. Journal of Clinical Microbiology. 2002;40(11):4289–4294. doi: 10.1128/JCM.40.11.4289-4294.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.David MZ, Daum RS. Community-associated methicillin-resistant Staphylococcus aureus: epidemiology and clinical consequences of an emerging epidemic. Clinical Microbiology Reviews. 2010;23(3):616–687. doi: 10.1128/CMR.00081-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Saiman L, O'Keefe M, Graham PL, III, et al. Hospital transmission of community-acquired methicillin-resistant Staphylococcus aureus among postpartum women. Clinical Infectious Diseases. 2003;37(10):1313–1319. doi: 10.1086/379022. [DOI] [PubMed] [Google Scholar]
- 14.Valsesia G, Rossi M, Bertschy S, Pfyffer GE. Emergence of SCCmec type IV and SCCmec type V methicillin-resistant Staphylococcus aureus containing the Panton-Valentine leukocidin genes in a large academic teaching hospital in Central Switzerland: external invaders or persisting circulators? Journal of Clinical Microbiology. 2010;48(3):720–727. doi: 10.1128/JCM.01890-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Motoshima M, Yanagihara K, Morinaga Y, et al. Genetic diagnosis of community-acquired MRSA: a multiplex real-time PCR method for staphylococcal cassette chromosome mec typing and detecting toxin genes. Tohoku Journal of Experimental Medicine. 2010;220(2):165–170. doi: 10.1620/tjem.220.165. [DOI] [PubMed] [Google Scholar]
- 16.Yang ES, Tan J, Eells S, Rieg G, Tagudar G, Miller LG. Body site colonization in patients with community-associated methicillin-resistant Staphylococcus aureus and other types of S. aureus skin infections. Clinical Microbiology and Infection. 2010;16(5):425–431. doi: 10.1111/j.1469-0691.2009.02836.x. [DOI] [PubMed] [Google Scholar]
- 17.Hisata K, Kuwahara-Arai K, Yamanoto M, et al. Dissemination of methicillin-resistant staphylococci among healthy Japanese children. Journal of Clinical Microbiology. 2005;43(7):3364–3372. doi: 10.1128/JCM.43.7.3364-3372.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Ozaki K, Takano M, Higuchi W, et al. Genotypes, intrafamilial transmission, and virulence potential of nasal methicillin-resistant Staphylococcus aureus from children in the community. Journal of Infection and Chemotherapy. 2009;15(2):84–91. doi: 10.1007/s10156-009-0668-x. [DOI] [PubMed] [Google Scholar]
- 19.Bukowski M, Wladyka B, Dubin G. Exfoliative toxins of Staphylococcus aureus . Toxins. 2010;2(5):1148–1165. doi: 10.3390/toxins2051148. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Nishijim S, Ohshima S, Higashida T, Nakaya H, Kurokawa I. Antimicrobial resistance of Staphylococcus aureus isolated from impetigo patients between 1994 and 2000. International Journal of Dermatology. 2003;42(1):23–25. doi: 10.1046/j.1365-4362.2003.01616.x. [DOI] [PubMed] [Google Scholar]
- 21.Yamaguchi T, Yokota Y, Terajima J, et al. Clonal association of Staphylococcus aureus causing bullous impetigo and the emergence of new methicillin-resistant clonal groups in Kansai district in Japan. Journal of Infectious Diseases. 2002;185(10):1511–1516. doi: 10.1086/340212. [DOI] [PubMed] [Google Scholar]
- 22.Takizawa Y, Taneike I, Nakagawa S, et al. A Panton-Valentine leucocidin (PVL)-positive community-acquired methicillin-resistant Staphylococcus aureus (MRSA) strain, another such strain carrying a multiple-drug resistance plasmid, and other more-typical PVL-negative MRSA strains found in Japan. Journal of Clinical Microbiology. 2005;43(7):3356–3363. doi: 10.1128/JCM.43.7.3356-3363.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Hisata K, Ito T, Matsunaga N, et al. Dissemination of multiple MRSA clones among community-associated methicillin-resistant Staphylococcus aureus infections from Japanese children with impetigo. Journal of Infection and Chemotherapy. 2011;17(5):609–621. doi: 10.1007/s10156-011-0223-4. [DOI] [PubMed] [Google Scholar]
- 24.Shi D, Higuchi W, Takano T, et al. Bullous impetigo in children infected with methicillin-resistant Staphylococcus aureus alone or in combination with methicillin-susceptible S. aureus: analysis of genetic characteristics, including assessment of exfoliative toxin gene carriage. Journal of Clinical Microbiology. 2011;49(5):1972–1974. doi: 10.1128/JCM.01742-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Yamamoto T, Dohmae S, Saito K, et al. Molecular characteristics and in vitro susceptibility to antimicrobial agents, including the des-fluoro(6) quinolone DX-619, of Panton-Valentine leucocidin-positive methicillin-resistant Staphylococcus aureus isolates from the community and hospitals. Antimicrobial Agents and Chemotherapy. 2006;50(12):4077–4086. doi: 10.1128/AAC.00847-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Jarraud S, Mougel C, Thioulouse J, et al. Relationships between Staphylococcus aureus genetic background, virulence factors, agr groups (alleles), and human disease. Infection and Immunity. 2002;70(2):631–641. doi: 10.1128/IAI.70.2.631-641.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Enright MC, Day NPJ, Davies CE, Peacock SJ, Spratt BG. Multilocus sequence typing for characterization of methicillin-resistant and methicillin-susceptible clones of Staphylococcus aureus . Journal of Clinical Microbiology. 2000;38(3):1008–1015. doi: 10.1128/jcm.38.3.1008-1015.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Kondo Y, Ito T, Ma XX, et al. Combination of multiplex PCRs for staphylococcal cassette chromosome mec type assignment: rapid identification system for mec, ccr, and major differences in junkyard regions. Antimicrobial Agents and Chemotherapy. 2007;51(1):264–274. doi: 10.1128/AAC.00165-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Japan Society of Chemotherapy. Method for the determination of minimum inhibitory concentration (MIC) of bacteria by microdilution method. Chemotherapy. 1990;38(1):102–105. [Google Scholar]
- 30.Japan Society of Chemotherapy. Method for the determination of minimum inhibitory concentration (MIC) of fastidious bacteria and anaerobic bacteria by microdilution method. Chemotherapy. 1993;41(2):183–189. [Google Scholar]
- 31.Clinical and Laboratory Standards Institute. CLSI Approved Standard. 8th edition. Wayne, Pa, USA: Clinical and Laboratory Standards Institute; 2009. [Google Scholar]
- 32.Clinical and Laboratory Standards Institute. CLSI Nineteenth Informational Supplement, M100-S19. Wayne, Pa, USA: Clinical and Laboratory Standards Institute; 2009. [Google Scholar]
- 33.Livermore DM, Brown DF. Detection of β-lactamase-mediated resistance. Journal of Antimicrobial Chemotherapy. 2001;48(supplement 1):59–64. doi: 10.1093/jac/48.suppl_1.59. [DOI] [PubMed] [Google Scholar]
- 34.Ito T, Okuma K, Ma XX, Yuzawa H, Hiramatsu K. Insights on antibiotic resistance of Staphylococcus aureus from its whole genome: genomic island SCC. Drug Resistance Updates. 2003;6(1):41–52. doi: 10.1016/s1368-7646(03)00003-7. [DOI] [PubMed] [Google Scholar]
- 35.Noguchi N, Nakaminami H, Nishijima S, Kurokawa I, So H, Sasatsu M. Antimicrobial agent of susceptibilities and antiseptic resistance gene distribution among methicillin-resistant Staphylococcus aureus isolates from patients with impetigo and staphylococcal scalded skin syndrome. Journal of Clinical Microbiology. 2006;44(6):2119–2125. doi: 10.1128/JCM.02690-05. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Nakaminami H, Noguchi N, Ikeda M, et al. Molecular epidemiology and antimicrobial susceptibilities of 273 exfoliative toxin-encoding-gene-positive Staphylococcus aureus isolates from patients with impetigo in Japan. Journal of Medical Microbiology. 2008;57(10):1251–1258. doi: 10.1099/jmm.0.2008/002824-0. [DOI] [PubMed] [Google Scholar]
- 37.Liu Y, Kong F, Zhang X, Brown M, Ma L, Yang Y. Antimicrobial susceptibility of Staphylococcus aureus isolated from children with impetigo in China from 2003 to 2007 shows community-associated methicillin-resistant Staphylococcus aureus to be uncommon and heterogeneous. British Journal of Dermatology. 2009;161(6):1347–1350. doi: 10.1111/j.1365-2133.2009.09376.x. [DOI] [PubMed] [Google Scholar]
- 38.Bae I-G, Tonthat GT, Stryjewski ME, et al. Presence of genes encoding the Panton-Valentine leukocidin exotoxin is not the primary determinant of outcome in patients with complicated skin and skin structure infections due to methicillin-resistant Staphylococcus aureus: results of a multinational trial. Journal of Clinical Microbiology. 2009;47(12):3952–3957. doi: 10.1128/JCM.01643-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Lina G, Piémont Y, Godail-Gamot F, et al. Involvement of Panton-Valentine leukocidin-producing Staphylococcus aureus in primary skin infections and pneumonia. Clinical Infectious Diseases. 1999;29(5):1128–1132. doi: 10.1086/313461. [DOI] [PubMed] [Google Scholar]
- 40.Akiyama H, Yamasaki O, Tada J, Arata J. Adherence characteristics and susceptibility to antimicrobial agents of Staphylococcus aureus strains isolated from skin infections and atopic dermatitis. Journal of Dermatological Science. 2000;23(3):155–160. doi: 10.1016/s0923-1811(00)00070-0. [DOI] [PubMed] [Google Scholar]
- 41.Daskalaki M, Rojo P, Marin-Ferrer M, Barrios M, Otero JR, Chaves F. Panton-Valentine leukocidin-positive Staphylococcus aureus skin and soft tissue infections among children in an emergency department in Madrid, Spain. Clinical Microbiology and Infection. 2010;16(1):74–77. doi: 10.1111/j.1469-0691.2009.02830.x. [DOI] [PubMed] [Google Scholar]
- 42.International Working Group on the Classification of Staphylococcal Cassette Chromosome Elements (IWG-SCC) Classification of staphylococcal cassette chromosome mec (SCCmec): guidelines for reporting novel SCCmec elements. Antimicrobial Agents and Chemotherapy. 2009;53(12):4961–4967. doi: 10.1128/AAC.00579-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43.Higuchi W, Mimura S, Kurosawa Y, et al. Emergence of the community-acquired methicillin-resistant Staphylococcus aureus USA300 clone in a Japanese child, demonstrating multiple divergent strains in Japan. Journal of Infection and Chemotherapy. 2010;16(4):292–297. doi: 10.1007/s10156-010-0051-y. [DOI] [PubMed] [Google Scholar]
- 44.Chheng K, Tarquinio S, Wuthiekanun V, et al. Emergence of community-associated methicillin-resistant Staphylococcus aureus associated with pediatric infection in Cambodia. Public Library of Science One. 2009;4(8):p. e6630. doi: 10.1371/journal.pone.0006630. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 45.Yamamoto T, Nishiyama A, Takano T, et al. Community-acquired methicillin-resistant Staphylococcus aureus: community transmission, pathogenesis, and drug resistance. Journal of Infection and Chemotherapy. 2010;16(4):225–254. doi: 10.1007/s10156-010-0045-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
