Skip to main content
American Journal of Cancer Research logoLink to American Journal of Cancer Research
. 2011 Nov 21;2(1):116–129.

Prognostic significance of aberrant gene methylation in gastric cancer

Jing Shi 1,*, Guanjun Zhang 2,*, Demao Yao 3, Wei Liu 1, Na Wang 1, Meiju Ji 1, Nongyue He 4, Bingyin Shi 1, Peng Hou 1
PMCID: PMC3236575  PMID: 22206050

Abstract

Promoter methylation acts as an important alternative to genetic alterations for gene inactivation in gastric carcinogenesis. Although a number of gastric cancer-associated genes have been found to be methylated in gastric cancer, valuable methylation markers for early diagnosis and prognostic evaluation of this cancer remain largely unknown. In the present study, we used methylation-specific PCR (MSP) to analyze promoter methylation of 9 gastric cancer-associated genes, including MLF1, MGMT, p16, RASSF2, hMLH1, HAND1, HRASLS, TM, and FLNc, and their association with clinicopathological characteristics and clinical outcome in a large cohort of gastric cancers. Our data showed that all of these genes were aberrantly methylated in gastric cancer, ranging from 8% to 51%. Moreover, gene methylation was strongly associated with certain clinicopathological characteristics, such as tumor differentiation, lymph node metastasis, and cancer-related death. Of interest, methylation of MGMT, p16, RASSF2, hMLH1, HAND1, and FLNc was closely associated with poor survival in gastric cancer, particularly MGMT, p16, RASSF2 and FLNc. Thus, our findings suggested these epigenetic events may contribute to the initiation and progression of gastric cancer. Importantly, methylation of some genes were closely relevant to poor prognosis in gastric cancer, providing the strong evidences that these hypermethylated genes may be served as valuable biomarkers for prognostic evaluation in this cancer.

Keywords: Gastric cancer, gene methylation, methylation-specific PCR (MSP), early diagnosis, poor prognosis

Introduction

Gastric cancer is the fourth most common cancer and the second most common cause of cancer-related death worldwide with approximately 989,600 new cases and 738,000 deaths per year, accounting for about 8% of new cancers [1]. Although the worldwide incidence of gastric cancer has declined rapidly over the recent few decades due to the recognition of certain risk factors, such as H. pylori, dietary and environmental risks, gastric cancer is still the predominant form of cancer and remains a significant cancer burden in developing world, particularly China [2,3]. Very unfortunately, most of gastric cancer patients are diagnosed at an advanced stage, and the prognosis is poor due to the limited advances in our understanding of the pathogenesis of this disease and the lack of useful diagnostic and prognostic markers [4]. Thus, there is an urgent need to identify the valuable markers for early diagnosis and prognostic evaluation of gastric cancer.

Gastric cancer is thought to arise through the accumulation of multiple genetic and epigenetic alterations, leading to gain-of-function in onco-genes and loss-of-function in tumor suppressor genes [5-7]. However, many evidences show that genetic alterations, particularly gene mutations, are relatively infrequent in gastric cancer [8]. A growing body of evidence now suggests that, in addition to genetic alterations, epigenetic alterations, such as DNA methylation, also play a critical role in the development and progression of human malignancies [9-11]. Aberrant promoter methylation is an important hallmark of cancer cells, and now regarded as one of the major mechanisms to inactivate tumor-related genes, contributing to gastric carcinogenesis [12-14]. However, to date, epigenetic inactivation of genes related tumor initiation and progression has not been well studied in gastric cancer as related to disease outcome.

In the present study, we used methylation-specific PCR (MSP) to evaluate promoter methylation of a panel of gastric cancer-associated genes in a large cohort of clinically well-characterized gastric cancers, including MLF1, MGMT, p16, RASSF2, hMLH1, HAND1, HRASLS, TM, and FLNc. These genes were potentially important in gastric carcinogenesis. Furthermore, we sought to explore the association of gene methylation with clinicopathological characteristics and clinical outcome in gastric cancer.

Material and methods

Patients and tissue samples

This study was approved by the Institutional Review Board and Human Ethics Committee of the First Affiliated Hospital of Xi'an Jiaotong University School of Medicine. A total of 119 paraffin-embedded gastric cancer tissues were randomly obtained from the First Affiliated Hospital of Xi'an Jiaotong University School of Medicine. None of these patients received chemotherapy and radiotherapy before the surgery. Informed consent was obtained from each patient before the surgery. The histologic diagnosis of tumors was made and agreed upon by at least two senior pathologists at Department of Pathology of the Hospital based on World Health Organization (WHO) criteria. The routine ematoxylineosin (H&E) staining was used to identify residual tumor cells at the resection margins. Relevant clinicopathologic features were obtained from the patients’ files or by telephone interviews with the patients or their relatives, and the details were summarized in Table 1.

Table 1.

Clinicopathologic characteristics of gastric cancers

Characteristics No.of patients (%)
Gender
 Male 92(77.3)
 Female 27 (22.7)
Age, years
 Mean 59.20
 SD 12.726
Tumor localization
 gastric cardia 32 (26.9)
 gastric body 33(27.7)
 gastric antrum 54 (45.4)
Tumor size (cm3)
 <3 41 (34.5)
 3-5 41 (34.5)
 >5 37 (31.1)
Differentiation
 well/moderate 54 (45.4)
 poor/undifferentiation 65 (54.6)
Tumor invasion
 T1 12 (10.1)
 T2 24 (20.2)
 T3 82 (68.9)
 T4 1 (0.8)
TNM stage
 I 29 (24.4)
 II 19(16.0)
 III 66(55.5)
 IV 5(4.2)
Residual tumor
 Yes 12 (10.1)
 No 107 (89.9)
Lymph node metastasis (LNM)
 Yes 73 (61.3)
 No 46 (38.7)
No. of LNM
 NO 46 (38.7)
 Nl (1-6) 45(37.8)
 N2 (7-15) 23 (19.3)
 N3 (>16) 5 (4.2)
Survival status
 Dead 56(47.1)
 Alive 63 (52.9)

DNA preparation

Serial sections from each tumor sample were cut at 5 μm, and stained with hematoxylin and eosin (H&E). A tumor representative tissue was marked by a senior pathologist. The other sections (8 μm) were isolated by manual microdis-section under an inverted microscope using the marked H&E section for target tissue identification. DNA was extracted from tissues dissected as previously described [15]. Briefly, the tissues dissected were first treated with xylene for 12 hours at room temperature to remove the paraffin. All tissues were then subjected to digestion with 1% sodium dodecyl sulfate (SDS) and proteinase K at 48°C for 48 to 72 hours with addition of several spiking aliquots of concentrated proteinase K to facilitate digestion. DNA was subsequently isolated from the digested tissues followed by standard phenol-chloroform extraction and ethanol precipitation protocol, and stored at -80°C until use.

Sodium bisulfite treatment

DNA was treated with sodium bisulfite as described previously [16]. Briefly, a final volume of 20 μl of H2O containing 4 μg genomic DNA, 10 μg salmon sperm DNA, and 0.3M NaOH was incubated at 50 °C for 20 min to denature the DNA. The mixture was then incubated for 2-3 h at 70°C in 500 μl of a freshly prepared solution containing 3 M sodium bisulfite (Sigma, Saint Louis, MO) and 10 mM hydroquinone (Sigma, Saint Louis, MO). DNA was subsequently purified with a Wizard DNA Clean-Up System (Promega Corp., Madison, WI) following the instructions of the manufacturer, followed by ethanol precipitation, dry, and resuspension in 100 μl of deionized H2O. After bisulfite treatment, all unmethylated cytosine residues converted to uracil, whereas the methylated cytosine residues remained unchanged. Bisulfited-treated DNA samples were stored at -80°C until use.

Methylation-specific PCR (MSP) assay

MSP assay was performed on bisulfite-treated DNA in a final reaction mixture of 20 μl containing 50 ng of bisulfite-treated DNA, 16.6 mM of ammonium sulfate, 67 mM of Tris (pH 8.8), 2 mM MgCI2, 200 μM each of deoxynucleotide triphosphate mixture (dATP, dCTP, dGTP, and dTTP), 200 nM forward and reverse primers, and 0.5 U of platinum Taq DNA polymerase (Invitrogen Technologies, Inc., CA). The PCR was run in a Thermal cycler (Bio-Rad Laboratories, Inc., CA) as follows: after a 4-min denaturation at 95°C, the reaction was run 35 cycles, each comprising 45 s of denaturing at 95 °C, 45 s of annealing at variable temperatures according to the primers, and 45 s of extension at 72° C, with an extension at 72°C for 5 min as the last step. Normal leukocyte DNA was methylated in vitro with Sss I methylase (New England Biolabs, Beverly, MA) to generate completely methylated DNA as a positive control. The primers used in the present study were presented in Table 2. The PCR products were electrophoresed on a 1.2 % agarose gel and visualized under UV illumination using an ethidium bromide stain.

Table 2.

Methylation-specific PCR (MSP) primers used in the present study

Genes Allele Forward (5'→3') Reverse (5'→3') Length (bp) Annealing temperature (°C)
MLF1 M TCGTTTCGTTTTGGTGAC CTAACCTCCAATACGAACGAC 127 60
U TTTTGTTTTGTTTTGGTGAT AACTAACCTCCAATACAAACAAC 127 57
MGMT M TTTCGACGTTCGTAGGTTTTCGC GCACTCTTCCGAAAACGAAACG 81 59
U TTTGTGTTTTGATGTTTGTAGGTTTTTGT AACTCCACACTCTTCCAAAAACAAAACA 93 59
p16 M TTATTAGAGGGTGGGGCGGATCGC GACCCCGAACCGCGACCGTAA 150 65
U TTATTAGAGGGTGGGGTGGATTGT CAACCCCAAACCACAACCATAA 151 60
RASSF2 M TTTTTTTTTTTTGAGTTCGC CTAAAAAACGACGACGAACT 157 58
U TTTTTTTTTTTTTTTGAGTTTGT CCTAAAAAACAACAACAAACTA 157 56
hMLH1 M TATATCGTTCGTAGTATTCGTGT TCCGACCCGAATAAACCCAA 153 60
U TTTTGATGTAGATGTTTTATTAGGGTTGT ACCACCTCATCATAACTACCCACA 124 60
HAND11 M AATAGTTTAGGGCGTTGGTC AATTTTACGCTCAACCCG 184 61
U AATAGTTTAGGGTGTTGGTT AATTTTACACTCAACCCA 184 56
HRASLS1 M GGGTGTATTTATGATGGGTGTATTC CAACGCCTACGATCAAAACG 182 60
U GTTGTGGGAATGTTTGAGATGT CACAACCACCTCCACACACA 117 60
TM M CGTTCGTTTTTATTCGGCGTC GCCAAACCCCATCTCATCG 118 62
U ATGTGTTTGTTTTTATTTGGTGTT CATAACTAACCAAAAACCCACA 158 60
FLNc M GAGAGAGAGTTAGAGAGCGGTCGAGC GACCACGAAACTCGCTACGCTACG 121 64
U GAGAGAGAGTTAGAGAGTGGTTGAGT AACCACAAAACTCACTACACTACA 121 62

Statistical analysis

Gene methylation associated with clinicopathological features of tumor were assessed univariately using the SPSS statistical package (version 11.5; SPSS Inc., Chicago, IL, USA). Multivariate models were then developed that adjusted for the important covariates, including age, differentiation, tumor stage, lymph node metastasis and cancer-related death. Survival time was determined from the day of primary tumor surgery to the day of death or last clinical follow-up. The Kaplan-Meier method was used for survival analysis grouping with methylation status. Differences between curves were analysed using the log-rank test. Sample means were compared using unpaired student t test, assuming unequal variances, and the test was two-tailed. P values <0.05 were considered to be statistically significant. All statistical analyses were performed using the SPSS statistical package (version 11.5; SPSS Inc., Chicago, IL, USA).

Results

Frequent aberrant gene methylation in gastric cancer and its association with clinicopathological features

We examined promoter methylation of MLF1, MGMT, p16, RASSF2, hMLH1, HAND1, HRASLS, TM, and FLNc genes using MSP approach in a large cohort of gastric cancers. As shown in Figure 1, all of these genes were aberrantly methylated in gastric cancer, including the MLF1 gene in 50 of 119 tumors (42%), the MGMT gene in 10 of 119 tumors (8%), the p16 gene in 53 of 119 tumors (45%), the RASSF2 gene in 17 of 119 tumors (14%), the hMLH1 gene in 17 of 119 tumors (14%), the HAND1 gene in 22 of 119 tumors (18%), the HRASLS gene in 55 of 119 tumors (46%), the TM gene in 61 of 119 tumors (51%), and the FLNc gene in 44 of 119 tumors (37%).

Figure 1.

Figure 1

Representative MSP results of 9 gastric cancer-associated genes in gastric cancer. In vitro methylated DNA was used as positive control for methylated gene (P), bisulfite-modified normal leukocyte DNA as positive control for unmethylated gene (N), and H2O as blank control to confirm the specificity of MSP. Details are described in the Materials and Methods. Mk, DNA marker; M, methylated gene; U, unmethylated gene. GC, gastric cancer samples.

The univariate analyses showed that p16 methylation was found to be significantly associated with poor tumor differentiation (OR = 2.33, 95% Cl = 1.11-4.93; P <0.05) (Table 3). Also shown in Table 3, p16 methylation was significantly positively associated with lymph node metastasis (OR = 2.62, 95% Cl = 1.20-5.71; P <0.05). Similar to p16 gene, although no statistical significance was noted, there was a trend toward positive association of methylation of MGMT (OR = 6.33, 95% Cl = 0.77-51.7) and hMLH1 (OR = 3.40, 95% Cl = 0.92-12.6) genes with lymph node metastasis. Moreover, methylation of MLF1 (OR = 1.65, 95% Cl = 1.06-2.56; P <0.05), MGMT (OR = 2.29, 95% Cl = 1.11-4.75; P <0.05), and p16 (OR = 1.85, 95% Cl = 1.18—2.90; P <0.01) genes was significantly positively associated with the number of lymph node metastasis (Table 3). Importantly, our data showed that methylation of 5 of 9 genes, including MGMT (OR = 5.08, 95% Cl = 1.03-25.1; P <0.05), p16 (OR = 6.76, 95% Cl = 3.02-15.1; P <0.01), RASSF2 (OR = 6.67, 95% Cl = 1.80-24.7; P <0.01), hMLH1 (OR = 3.16, 95% Cl = 1.04-9.64; P <0.05), and FLNc (OR = 2.52, 95% Cl = 1.17-5.41; P <0.05), was associated with a significantly increased risk of gastric cancer-related death (Table 3). In order to assess the independent association of gene methylation with age, tumor differentiation, tumor stage, lymph node metastasis and cancer-related death, we conducted multiple multivariable logistic regressions (Table 4). Similar to univariate analysis, p16 methylation remained significantly associated with poor tumor differentiation (OR = 2.59, 95% Cl = 1.08-6.23; P <0.05) (Table 4). MGMT methylation remained positively associated with lymph node metastasis (OR = 8.10, 95% Cl = 0.55-120) (Table 4). Methylation of hMLH1 gene remained negatively associated with tumor differentiation (OR = 0.30, 95% Cl = 0.09-0.97; P <0.05) (Table 4). Methylation of MGMT, p16, RASSF2, hMLH1, and FLNc genes also remained positively associated with cancer-related death, particularly p16 (OR = 8.52, 95% Cl = 2.99-24.2; P <0.01), RASSF2 (OR = 13.6, 95% Cl = 2.49-73.7; P <0.01), and FLNc (OR = 3.15, 95% Cl = 1.20-8.25; P <0.05) (Table 4). However, after adjustment, HRASLS methylation became significantly positively associated with lymph node metastasis (OR = 4.35, 95% Cl = 1.19-15.9; P <0.05) (Table 4).

Table 3.

Methylation of individual genes in gastric cancer – univariate associations with clinicopathological characteristics (OR† and 95%CI)

Genes Male vs. Female Age1 Tumor localization2 Tumor size3 Differentiation4
MLF1 1.14(0.48-2.70) 0.92 (0.64-1.32) 0.77 (0.50-1.19) 1.35(0.86-2.13) 1.27 (0.61-2.64)
MGMT 1.52 (0.37-6.32) 0.87 (0.46-1.65) 1.21 (0.54-2.70) 1.48 (0.65-3.37) 1.27 (0.34-4.76)
p16 0.82 (0.34-1.95) 1.01 (0.71-1.44) 1.12 (0.72-1.73) 1.22 (0.78-1.91) 2.33 (1.11-4.93)*
RASSF2 0.41(0.09-1.92) 0.80 (0.48-1.34) 0.89 (0.48-1.65) 1.63(0.85-3.15) 1.22 (0.43-3.46)
hMLH1 1.52 (0.48-4.76) 1.12 (0.68-1.86) 0.99 (0.53-1.83) 1.63(0.85-3.15) 0.40 (0.14-1.16)
HAND1 1.00 (0.33-3.03) 1.09 (0.69-1.72) 1.00 (0.57-1.74) 1.16(0.65-2.06) 1.25 (0.49-3.20)
HRASLS 0.50(0.20-1.23) 1.01 (0.71-1.45) 1.15 (0.74-1.78) 0.99 (0.64-1.55) 0.76 (0.37-1.56)
TM 1.03(0.44-2.43) 1.10(0.77-1.56) 0.94 (0.61-1.45) 0.95 (0.61-1.49) 0.84 (0.41-1.72)
FLNc 0.81(0.33-2.01) 0.76 (0.52-1.10) 1.30 (0.82-2.05) 1.28 (0.81-2.04) 1.15 (0.54-2.44)
(Continued)
Genes Tumor invasion5 Tumor stage6 Lymph node metastasis No. of LNM7 Cancer-related death
MLF1 1.06(0.62-1.82) 1.15(0.76-1.73) 1.64 (0.76-3.50) 1.65 (1.06-2.56)* 1.86 (0.89-3.89)
MGMT 1.79(0.53-6.12) 1.59 (0.70-3.62) 6.33 (0.77-51.7) 2.29(1.11-4.75)* 5.08(1.03-25.1)*
p16 1.25(0.72-2.15) 1.42 (0.93-2.14) 2.62 (1.20-5.71)* 1.85(1.18-2.90)** 6.76(3.02-15.1)**
RASSF2 0.83(0.41-1.71) 1.03 (0.58-1.82) 1.61 (0.53-4.92) 1.67 (0.94-2.98) 6.67(1.80-24.7)**
hMLH1 1.33 (0.57-3.07) 1.86 (0.94-3.69) 3.40 (0.92-12.6) 1.67 (0.94-2.98) 3.16 (1.04-9.64)*
HAND1 1.25(0.60-2.59) 1.10 (0.65-1.85) 1.44 (0.54-3.86) 1.28(0.76-2.17) 1.45 (0.57-3.66)
HRASLS 0.85 (0.50-1.44) 0.97 (0.65-1.45) 1.85 (0.87-3.94) 1.38(0.90-2.12) 1.33 (0.65-2.75)
TM 0.87 (0.51-1.48) 1.00 (0.67-1.49) 1.25 (0.60-2.62) 1.30 (0.85-1.99) 1.04 (0.51-2.14)
FLNc 0.95(0.55-1.65) 1.13(0.74-1.71) 1.36 (0.63-2.96) 1.54 (0.99-2.39) 2.52 (1.17-5.41)*
†

OR: odds ratio with 95% confidence interval

1

Age (per 10 years)

2

Tumor localization (gastric cardia; gastric body; gastric antrum)

3

Tumor size (≤3 cm; >3cm and ≤5 cm; ≥5)

4

Differentiation (well or moderate; poor or no differentiation)

5

Tumor invasion (T1; T2; T3; T4)

6

Tumor stage (I; II; III; IV)

7

No. of LNM (lymph node metastasis) (0; 1-6; 7-15; > 16)

*

P <0.05

**

P <0.01

Table 4.

Methylation of individual genes in gastric cancer – multivariable models assessing age, differentiation, tumor stage, lymph node metastasis and cancer-related death (OR† and 95%CI)

Genes Age1 Differentiation2 Tumor stage3 Lymph node metastasis Cancer-related death
MLF1 0.91 (0.62-1.34) 1.15(0.53-2.49) 0.85 (0.47-1.56) 1.50 (0.47-4.79) 1.74 (0.72-4.24)
MGMT 0.73 (0.35-1.53) 0.94 (0.22-4.06) 0.43(0.14-1.34) 8.10 (0.55-120) 3.02 (0.50-18.2)
p16 1.08 (0.71-1.66) 2.59(1.08-6.23)* 0.69 (0.35-1.35) 1.26 (0.35-4.58) 8.52(2.99-24.2)**
RASSF2 0.79 (0.44-1.44) 1.02 (0.32-3.27) 0.53 (0.21-1.35) 1.00 (0.15-6.86) 13.6(2.49-73.7)**
hMLH1 0.89 (0.49-1.62) 0.30 (0.09-0.97)* 1.40 (0.53-3.74) 1.72 (0.26-11.3) 2.18 (0.58-8.24)
HAND1 1.11(0.69-1.78) 1.27 (0.48-3.38) 0.86 (0.40-1.86) 1.43 (0.32-6.35) 1.33 (0.43-4.09)
HRASLS 0.96 (0.65-1.40) 0.69 (0.32-1.51) 0.54 (0.28-1.06) 4.35 (1.19-15.9)* 1.11(0.45-2.71)
TM 1.07 (0.74-1.55) 0.85 (0.40-1.82) 0.83 (0.46-1.50) 1.65 (0.53-5.14) 0.94 (0.39-2.25)
FLNc 0.72 (0.48-1.08) 0.92 (0.41-2.08) 0.90 (0.48-1.70) 0.90 (0.26-3.08) 3.15(1.20-8.25)*
†

OR: odds ratio with 95% confidence interval

1

Age (per 10 years)

2

Differentiation (well or moderate; poor or no differentiation)

3

Tumor stage (I; II; III; IV)

*

P <0.05

**

P<0.01

The effect of gene methylation on poor prognosis in gastric cancer

The Kaplan-Meier estimator of the survivorship function was used to evaluate the impact of aberrant gene methylation on the survival of gastric cancer patients. The survival of gastric cancer patients with and without gene methylation was compared using the log-rank test. As shown in Figure 2, methylation of MGMT (P =0.02), p16 (P <0.0001), RASSF2 (P =0.01), hMLH1 (P =0.03), HAND1 (P =0.04), and FLNc (P =0.03) was significantly associated with poor survival of gastric cancer patients. However, methylation of MLF1 (P =0.30), HRASLS (P =0.56), and TM (P =0.73) did not affect the overall prognosis of gastric cancer patients.

Figure 2.

Figure 2

Effect of gene methylation on poor survival in gastric cancer. Kaplan-Meier survival curves were made according to the presence of gene methylation in a large cohort of gastric cancers. The patients with methylation of MGMT, p16, RASSF2, hMLH1, HAND1, and FLNc had significantly poorer survival times than the patients without gene methylation. Methylation of MLF1 (P =0.30), HRASLS (P =0.56), and FLNo (P =0.73) was not associated with poor survival of gastric cancer patients. M, methylated genes; U, unmethylated genes.

Numerous evidences showed that residual tumor after surgery is an independent risk factor for gastric cancer patients. We thus sought to evaluate the effect of residual tumor after surgery on the survival of gastric cancer patients in the present study. As shown in Figure 3, the patients with residual tumor after surgery had significantly shorter survival times than the patients without residual tumor (34.4 years vs. 53.5 years on average; P =0.04). Given the impact of residual tumor after surgery on poor survival of gastric cancer patients, we excluded the patients with residual tumor to determine the association of gene methylation with poor survival in gastric cancer. Similar to the findings in Figure 2, methylation of MLF1 (P =0.66), HRASLS (P =0.44), and TM (P =0.84) did not have any prognostic value for gastric cancer patients. Methylation of MGMT (P =0.02), p16 (P <0.0001), RASSF2 (P =0.01), and FLNc (P =0.048) remained significantly associated with poor survival of gastric cancer patients (Figure 4). Methylation of hMLH1 (P =0.05) and HAND1 (P =0.06) was still closely associated with poor survival of gastric cancer patients, although these associations did not reach statistical difference (Figure 4). The patients with methylation of these genes had shorter survival times than the patients without methylation of these genes, particularly MGMT gene (29.9 years vs. 55.7 years on average, P =0.03), p16 gene (36.1 years vs. 67.6 years on average, P <0.0001), and hMLH1 gene (37.7 years vs. 55.5 years on average, P =0.03) (Figure 5). The data were further stratified based on the TNM tumor stage, because it is also an independent risk factor for gastric cancer patients. As shown in Figure 6, p16 methylation was significantly associated with poor survival whatever the patients who had early-stage tumors (stage I and II) or late-stage tumors (stage III and IV). Methylation of RASSF2, hMLH1 and FLNc was more closely associated with poor prognosis in the patients who had early-stage tumors compared with the patients who had late-stage tumors, particularly RASSF2 and hMLH1 genes. Conversely, HAND1 methylation was more closely associated with poor survival in the patients who had late-stage tumors compared with the patients who had early-stage tumors.

Figure 3.

Figure 3

Effect of residual tumor after surgery on poor survival in gastric cancer. Survival was evaluated according to the presence of residual tumor after surgery in gastric cancer. Kaplan-Meier survival curves show that the patients with residual tumor after surgery had significantly shorter survival times than the patients without residual tumor (P =0.04). +, the patients with residual tumor after surgery; -, the patients without residual tumor after surgery.

Figure 4.

Figure 4

Association of gene methylation with poor survival of gastric cancer patients without residual tumor. Kaplan-Meier analysis of survival was performed according to the status of gene methylation in a large cohort of gastric cancer patients without residual tumor. Methylation of MGMT, p16, RASSF2 and FLNc was significantly associated with poor survival in gastric cancer. Methylation of hMLH1 (P =0.05) and HAND1 (P =0.06) was marginally significantly associated with poor survival of gastric cancer patients. Methylation of MLF1 (P =0.66), HRASLS (P =0.44) and TM (P =0.84) did not affect poor prognosis of gastric cancer patients. M, methylated genes; U, unmethylated genes.

Figure 5.

Figure 5

Effect of gene methylation on survival time of gastric cancer patients. The patients with methylation of MGMT, p16, RASSF2, hMLH1, HAND1, and FLNc had shorter survival times than the patients without methylation of these genes ﹛MGMT: 29.9 years vs. 55.7 years on average; p16: 36.1 years vs. 67.6 years on average; RASSF2: 40.5 years vs. 55.3 years on average; hMLH1: 37.7 years vs. 55.5 years on average; HAND1: 39.7 years vs. 56.7 years on average; FLNc: 46 years vs. 58 years on average). Methylation of MLF1, HRASLS and TM did not affect survival time of gastric cancer patients. The data were presented as the mean ± SE. *, P <0.05; *: p<0.0001.

Figure 6.

Figure 6

Effect of gene methylation on poor survival of gastric cancer patients at different tumor stages. The data were stratified based on two different TNM tumor stages (early stage, stage l+ll; late stage, stage III+IV). Methylation of p16 gene significantly affected the poor survival in gastric cancer whatever the patients who had early-stage or late-stage tumors. Methylation of RASSF2, hMLH1 and FLNc was more relevant to poor survival in the patients who had early-stage tumors compared with the patients who had late-stage tumors. Reversely, HAND1 methylation more significantly affected poor survival in the patients who had late-stage tumors compared with the patients who had early-stage tumors. M, methylated genes; U, unmethylated genes.

Discussion

Aberrant promoter methylation can permanently inactivate tumor-associated genes, particularly tumor suppressor genes, as mutations and chromosomal abnormalities do. Importantly, promoter methylation is more frequently present than gene mutations in gastric cancer [8]. Thus, we can use this frequent molecular event as a marker instead of gene mutations for early diagnosis and prognostic evaluation of this cancer. In the present study, we analyzed promoter methylation of MLF1, MGMT, p16, RASSF2, hMLH1, HAND1, HRASLS, TM, and FLNc genes using MSP method in a large cohort of gastric cancers. Although these genes were frequently methylated in gastric cancer [17-20], their association with clinicopathological characteristics and clinical outcome in gastric cancer remains largely unknown.

Similar to the previous study, our data also demonstrated that these gastric cancer-associated genes were aberrantly methylated in Chinese patients with gastric cancer, ranging from 8% to 51%. Given aberrant methylation of these genes may play a critical role in gastric tumorigenesis, we investigated their clinical significances and prognostic values in gastric cancer patients who had known survival data. Our findings showed that p16 methylation was positively associated with poor tumor differentiation, which is consistent with a previous study [21]. Similar to the previous studies that loss of p16 protein expression was reversely associated with lymph node metastasis [22,23], p16 methylation was positively associated with lymph node metastasis in the present study. In addition, our data showed that MGMT methylation was closely associated with lymph node metastasis in gastric cancer, which is consistent with the previous studies [24,25]. HRASLS is human homologue of mouse A-C1, which has been reported to inhibit growth of ras-transformed NIH3T3 cells [26,27]. Although the role of HRASLS in human gastric carcinogenesis still needs to be studied, our data first demonstrated that its methylation in gastric cancer was significantly positively associated with lymph node metastasis in the present study. Of note, methylation of MGMT, p16, RASSF2, hMLH1, and FLNc, particularly p16, RASSF2 and FLNc, was associated with a potentially increased risk of gastric cancer-related death. Collectively, these data suggested that aberrant methylation of these genes may contribute to oncologic outcomes of gastric cancer patients.

More importantly, like what observed in the previous studies [24,28], methylation of p16 and MGMT was significantly associated with poor survival of gastric cancer patients in the present study. RASSF2, a member of the RASSF1 family, has recently been identified as a potential tumor suppressor, which is frequently hypermethylated in human cancers, including gastric cancer [18,29,30]. In the present study, we first demonstrated that RASSF2 methylation was significantly associated with poor survival of gastric cancer patients, suggesting that this epigenetic event may be used to predict poor prognosis of this cancer. In support of this, a previous study showed that a combination of RASSF1A and RASSF2 methylation was found to be significantly associated with poor disease-free survival in oral squamous cell carcinoma [31]. FLNc is a member of the filamin family, which is known to organize actin polymerization in response to various signals [32]. Methylation-associated inactivation of this gene is frequently found in gastric cancer [17,19,33]. In the present study, we first demonstrated that FLNc methylation was significantly associated with poor survival and cancer-related death in gastric cancer, suggesting that abrogation of normal actin polymerization may be important in gastric carcinogenesis. In line with this finding is a recent example that simultaneous methylation of multiple genes predicted significantly worse survival in colon cancer, including FLNc methylation [34]. Methylation of hMLH1 and loss of its expression has been well documented in sporadic gastric carcinomas with high-frequency microsatellite instability (MSI-H) [35,36]. A previous study showed that the overall survival was significantly shorter in the patients with hMLH1 methylation compared to the patients without hMLH1 methylation in colorectal cancer [37]. Similarly, our data showed that hMLH1 methylation was closely associated with poor survival of gastric cancer patients, although no statistical significance was noted, suggesting that this epigenetic alteration may be a valuable marker for the prognosis of gastric cancer patients. HAND1 encodes a base helix-loop-helix transcriptional factor, which is essential for placental development and cardiac morphogenesis [38]. The previous study [17] and the present study and showed that this gene was aberrantly methylated in gastric cancer, suggesting that its expression in normal gastric mucosa and silencing in gastric cancers may play a role in the maintenance of differentiated status of gastric epithelium. Moreover, HAND1 methylation was also associated with poor survival in gastric cancer, further suggesting that this gene plays an important role in gastric carcinogenesis. Of interest, p16 methylation affected the overall prognosis in gastric cancer whatever the patients who had early-stage or late-stage tumors, suggesting that this gene plays an important role in the multistep process of gastric carcinogenesis. Moreover, compared with the patients who had late-stage tumors, methylation of RASSF2, hMLH1 and FLNc was more closely associated with poor survival in the patients who had early-stage tumors, particularly RASSF2 and hMLH1, suggesting that these genes play a role in early stage of gastric carcinogenesis. Reversely, HAND1 may play a role in late stage of gastric carcinogenesis.

In summary, we analyzed a panel of gastric cancer-associated genes in a large cohort of gastric cancers, and demonstrated that promoter methylation was strongly associated with certain clinicopathological characteristics, such as tumor differentiation, lymph node metastasis, and cancer-related death. More importantly, hyper-methylation of some genes was closely associated with poor survival of gastric cancer patients. Thus, these aberrantly methylated genes may be served as potential biomarkers for early diagnosis and prognostic evaluation in gastric cancer.

Acknowledgments

This work was supported by the National Natural Science Foundation of China (No. 30901459 and 30973372) and the National Key Program for Developing Basic Research (No. 2010CB933903).

Declaration of conflicts of interest

The authors declare that they have no competing interests.

References

  • 1.Jemal A, Bray F, Center MM, Ferlay J, Ward E, Forman D. Global cancer statistics. CA Cancer J Clin. 2011;61:69–90. doi: 10.3322/caac.20107. [DOI] [PubMed] [Google Scholar]
  • 2.Yang L. Incidence and mortality of gastric cancer in China. World J Gastroenterol. 2006;12:17–20. doi: 10.3748/wjg.v12.i1.17. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Hohenberger P, Gretschel S. Gastric cancer. Lancet. 2003;362:305–15. doi: 10.1016/s0140-6736(03)13975-x. [DOI] [PubMed] [Google Scholar]
  • 4.Kim HJ, Karpeh MS. Surgical approaches and outcomes in the treatment of gastric cancer. Semin Radiat Oncol. 2002;12:162–9. doi: 10.1053/srao.2002.30818. [DOI] [PubMed] [Google Scholar]
  • 5.Yasui W, Oue N, Kuniyasu H, Ito R, Tahara E, Yokozaki H. Molecular diagnosis of gastric cancer: present and future. Gastric Cancer. 2001;4:113–21. doi: 10.1007/pl00011733. [DOI] [PubMed] [Google Scholar]
  • 6.Yokozaki H, Yasui W, Tahara E. Genetic and epigenetic changes in stomach cancer. Int Rev Cytol. 2001;204:49–95. doi: 10.1016/s0074-7696(01)04003-7. [DOI] [PubMed] [Google Scholar]
  • 7.Yasui W, Oue N, Aung PP, Matsumura S, Shutoh M, Nakayama H. Molecular-pathological prognostic factors of gastric cancer: a review. Gastric Cancer. 2005;8:86–94. doi: 10.1007/s10120-005-0320-0. [DOI] [PubMed] [Google Scholar]
  • 8.Ushijima T, Sasako M. Focus on gastric cancer. Cancer Cell. 2004;5:121–5. doi: 10.1016/s1535-6108(04)00033-9. [DOI] [PubMed] [Google Scholar]
  • 9.Feinberg AP. Cancer epigenetics takes center stage. Proc Natl Acad Sci USA. 2001;98:392–4. doi: 10.1073/pnas.98.2.392. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Jones PA, Baylin SB. The fundamental role of epigenetic events in cancer. Nat Rev Genet. 2002;3:415–28. doi: 10.1038/nrg816. [DOI] [PubMed] [Google Scholar]
  • 11.Suzuki H, Tokino T, Shinomura Y, Imai K, Toyota M. DNA methylation and cancer pathways in gastrointestinal tumors. Pharmacogenomics. 2008;9:1917–28. doi: 10.2217/14622416.9.12.1917. [DOI] [PubMed] [Google Scholar]
  • 12.Toyota M, Ahuja N, Suzuki H, Itoh F, Ohe-Toyota M, Imai K, Baylin SB, Issa JP. Aberrant methylation in gastric cancer associated with the CpG island methylator phenotype. Cancer Res. 1999;59:5438–42. [PubMed] [Google Scholar]
  • 13.Leung WK, Yu J, Ng EK, To KF, Ma PK, Lee TL, Go MY, Chung SC, Sung JJ. Concurrent hypermethylation of multiple tumor-related genes in gastric carcinoma and adjacent normal tissues. Cancer. 2001;91:2294–301. [PubMed] [Google Scholar]
  • 14.Oue N, Oshimo Y, Nakayama H, Ito R, Yoshida K, Matsusaki K, Yasui W. DNA methylation of multiple genes in gastric carcinoma: association with histological type and CpG island methylator phenotype. Cancer Sci. 2003;94:901–5. doi: 10.1111/j.1349-7006.2003.tb01373.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Ji M, Guan H, Gao C, Shi B, Hou P. Highly frequent promoter methylation and PIK3CA amplification in non-small cell lung cancer (NSCLC) BMC Cancer. 2011;11:147. doi: 10.1186/1471-2407-11-147. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Hou P, Ji M, Xing M. Association of PTEN gene methylation with genetic alterations in the phosphatidylinositol 3-kinase/AKT signaling pathway in thyroid tumors. Cancer. 2008;113:2440–7. doi: 10.1002/cncr.23869. [DOI] [PubMed] [Google Scholar]
  • 17.Kaneda A, Kaminishi M, Yanagihara K, Sugimura T, Ushijima T. Identification of silencing of nine genes in human gastric cancers. Cancer Res. 2002;62:6645–50. [PubMed] [Google Scholar]
  • 18.Endoh M, Tamura G, Honda T, Homma N, Terashima M, Nishizuka S, Motoyama T. RASSF2, a potential tumour suppressor, is silenced by CpG island hypermethylation in gastric cancer. Br J Cancer. 2005;93:1395–9. doi: 10.1038/sj.bjc.6602854. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Oue N, Mitani Y, Motoshita J, Matsumura S, Yoshida K, Kuniyasu H, Nakayama H, Yasui W. Accumulation of DNA methylation is associated with tumor stage in gastric cancer. Cancer. 2006;106:1250–9. doi: 10.1002/cncr.21754. [DOI] [PubMed] [Google Scholar]
  • 20.Watanabe Y, Kim HS, Castoro RJ, Chung W, Estecio MR, Kondo K, Guo Y, Ahmed SS, Toyota M, Itoh F, Suk KT, Cho MY, Shen L, Jelinek J, Issa JP. Sensitive and specific detection of early gastric cancer with DNA methylation analysis of gastric washes. Gastroenterology. 2009;136:2149–58. doi: 10.1053/j.gastro.2009.02.085. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Tsujie M, Yamamoto H, Tomita N, Sugita Y, Ohue M, Sakita I, Tamaki Y, Sekimoto M, Doki Y, Inoue M, Matsuura N, Monden T, Shiozaki H, Monden M. Expression of tumor suppressor gene p16(INK4) products in primary gastric cancer. Oncology. 2000;58:126–36. doi: 10.1159/000012089. [DOI] [PubMed] [Google Scholar]
  • 22.He XS, Rong YH, Su Q, Luo Q, He DM, Li YL, Chen Y. Expression of p16 gene and Rb protein in gastric carcinoma and their clinicopathological significance. World J Gastroenterol. 2005;11:2218–23. doi: 10.3748/wjg.v11.i15.2218. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Kishimoto I, Mitomi H, Ohkura Y, Kanazawa H, Fukui N, Watanabe M. Abnormal expression of p16(INK4a), cyclin D1, cyclin-dependent kinase 4 and retinoblastoma protein in gastric carcinomas. J Surg Oncol. 2008;98:60–6. doi: 10.1002/jso.21087. [DOI] [PubMed] [Google Scholar]
  • 24.Park TJ, Han SU, Cho YK, Paik WK, Kim YB, Lim IK. Methylation of O(6)-methylguanine-DNA methyltransferase gene is associated significantly with K-ras mutation, lymph node invasion, tumor staging, and disease free survival in patients with gastric carcinoma. Cancer. 2001;92:2760–8. doi: 10.1002/1097-0142(20011201)92:11<2760::aid-cncr10123>3.0.co;2-8. [DOI] [PubMed] [Google Scholar]
  • 25.Hibi K, Sakata M, Yokomizo K, Kitamura YH, Sakuraba K, Shirahata A, Goto T, Mizukami H, Saito M, Ishibashi K, Kigawa G, Nemoto H, Sanada Y. Methylation of the MGMT gene is frequently detected in advanced gastric carcinoma. Anticancer Res. 2009;29:5053–5. [PubMed] [Google Scholar]
  • 26.Akiyama H, Hiraki Y, Noda M, Shigeno C, Ito H, Nakamura T. Molecular cloning and biological activity of a novel Ha-Ras suppressor gene predominantly expressed in skeletal muscle, heart, brain, and bone marrow by differential display using clonal mouse EC cells, ATDC5. J Biol Chem. 1999;274:32192–7. doi: 10.1074/jbc.274.45.32192. [DOI] [PubMed] [Google Scholar]
  • 27.Ito H, Akiyama H, Shigeno C, Nakamura T. Isolation, characterization, and chromosome mapping of a human A-C1 Ha-Ras suppressor gene (HRASLS) Cytogenet Cell Genet. 2001;93:36–9. doi: 10.1159/000056944. [DOI] [PubMed] [Google Scholar]
  • 28.Ben Ayed-Guerfali D, Benhaj K, Khabir A, Abid M, Bayrouti Ml, Sellami-Boudawara T, Gargouri A, Mokdad-Gargouri R. Hypermethylation of tumor-related genes in Tunisian patients with gastric carcinoma: clinical and biological significance. J Surg Oncol. 2011;103:687–94. doi: 10.1002/jso.21875. [DOI] [PubMed] [Google Scholar]
  • 29.Maruyama R, Akino K, Toyota M, Suzuki H, Imai T, Ohe-Toyota M, Yamamoto E, Nojima M, Fujikane T, Sasaki Y, Yamashita T, Watanabe Y, Hiratsuka H, Hirata K, Itoh F, Imai K, Shinomura Y, Tokino T. Cytoplasmic RASSF2A is a proapoptotic mediator whose expression is epigenetically silenced in gastric cancer. Carcinogenesis. 2008;29:1312–8. doi: 10.1093/carcin/bgn060. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Nagasaka T, Tanaka N, Cullings HM, Sun DS, Sasamoto H, Uchida T, Koi M, Nishida N, Naomoto Y, Boland CR, Matsubara N, Goel A. Analysis of fecal DNA methylation to detect gastrointestinal neoplasia. J Natl Cancer Inst. 2009;101:1244–58. doi: 10.1093/jnci/djp265. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Huang KH, Huang SF, Chen IH, Liao CT, Wang HM, Hsieh LL. Methylation of RASSF1A, RASS-F2A, and HIN-1 is associated with poor outcome after radiotherapy, but not surgery, in oral squamous cell carcinoma. Clin Cancer Res. 2009;15:4174–80. doi: 10.1158/1078-0432.CCR-08-2929. [DOI] [PubMed] [Google Scholar]
  • 32.Stossel TP, Condeelis J, Cooley L, Hartwig JH, Noegel A, Schleicher M, Shapiro SS. Filamins as integrators of cell mechanics and signalling. Nat Rev Mol Cell Biol. 2001;2:138–45. doi: 10.1038/35052082. [DOI] [PubMed] [Google Scholar]
  • 33.Kim JH, Jung EJ, Lee HS, Kim MA, Kim WH. Comparative analysis of DNA methylation between primary and metastatic gastric carcinoma. Oncol Rep. 2009;21:1251–9. doi: 10.3892/or_00000348. [DOI] [PubMed] [Google Scholar]
  • 34.Yi JM, Dhir M, Van Neste L, Downing SR, Jeschke J, Glöckner SC, de Freitas Calmon M, Hooker CM, Funes JM, Boshoff C, Smits KM, van Engeland M, Weijenberg MP, lacobuzio-Donahue CA, Herman JG, Schuebel KE, Baylin SB, Ahuja N. Genomic and epigenomic integration identifies a prognostic signature in colon cancer. Clin Cancer Res. 2011;17:1535–45. doi: 10.1158/1078-0432.CCR-10-2509. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Leung SY, Yuen ST, Chung LP, Chu KM, Chan AS, Ho JC. hMLH1 promoter methylation and lack of hMLH1 expression in sporadic gastric carcinomas with high-frequency microsatellite instability. Cancer Res. 1999;59:159–64. [PubMed] [Google Scholar]
  • 36.Fleisher AS, Esteller M, Wang S, Tamura G, Suzuki H, Yin J, Zou TT, Abraham JM, Kong D, Smolinski KN, Shi YQ, Rhyu MG, Powell SM, James SP, Wilson KT, Herman JG, Meltzer SJ. Hypermethylation of the hMLH1 gene promoter in human gastric cancers with microsatellite instability. Cancer Res. 1999;59:1090–5. [PubMed] [Google Scholar]
  • 37.Aoyagi H, Iida S, Uetake H, Ishikawa T, Takagi Y, Kobayashi H, Higuchi T, Yasuno M, Enomoto M, Sugihara K. Effect of classification based on combination of mutation and methylation in colorectal cancer prognosis. Oncol Rep. 2011;25:789–94. doi: 10.3892/or.2010.1118. [DOI] [PubMed] [Google Scholar]
  • 38.Riley P, Anson-Cartwright L, Cross JC. The Hand1 bHLH transcription factor is essential for placentation and cardiac morphogenesis. Nat Genet. 1998;18:271–5. doi: 10.1038/ng0398-271. [DOI] [PubMed] [Google Scholar]

Articles from American Journal of Cancer Research are provided here courtesy of e-Century Publishing Corporation

RESOURCES