Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2011 Dec 14.
Published in final edited form as: J Am Coll Cardiol. 2011 May 31;57(22):2273–2283. doi: 10.1016/j.jacc.2010.12.032

Cardiac-specific overexpression of caveolin-3 attenuates cardiac hypertrophy and increases natriuretic peptide expression and signaling

Yousuke T Horikawa *, Mathivadhani Panneerselvam *, Yoshitaka Kawaraguchi *, Yasuo M Tsutsumi †, Sameh S Ali *, Ravi C Balijepalli ^, Fiona Murray ‡, Brian P Head *, Ingrid R Niesman *, Timo Rieg #,§, Volker Vallon #,‡,§, Paul A Insel #,‡, Hemal H Patel *, David M Roth *,§
PMCID: PMC3236642  NIHMSID: NIHMS341681  PMID: 21616289

Abstract

Introduction

Natriuretic peptides modulate cardiac hypertrophy and are potential therapeutic options for patients with heart failure. Caveolae, microdomains in the plasma membrane that contain caveolin proteins and natriuretic peptide receptors, have been implicated in cardiac hypertrophy and natriuretic peptide localization. We hypothesized that cardiac myocyte-specific overexpression of caveolin-3, a muscle-specific caveolin, would alter natriuretic peptide signaling and attenuate cardiac hypertrophy.

Methods and Results

We generated transgenic mice with cardiac myocyte-specific overexpression of caveolin-3 (Cav-3 OE) and also used an adenoviral construct to increase Cav-3 in cardiac myocytes. Cav-3 OE mice subjected to transverse aortic constriction had increased survival, reduced cardiac hypertrophy and maintenance of cardiac function compared to control mice. In left ventricle at baseline, mRNA for atrial natriuretic peptide (ANP) and brain natriuretic peptide (BNP) were increased 7-fold and 3-fold, respectively in Cav-3 OE mice compared to controls and were accompanied by increased protein expression for ANP and BNP. In addition, ventricles from Cav-3 OE mice had greater cGMP levels, less NFAT nuclear translocation, and more nuclear Akt phosphorylation than did ventricles from controls. Cardiac myocytes incubated with Cav-3 adenovirus showed increased expression of Cav-3, ANP, and Akt phosphorylation. Incubation with methyl-β-cyclodextrin, which disrupts caveolae, or with wortmannin, a PI3K inhibitor, blocked the increase in ANP expression.

Discussion

These results imply that cardiac myocyte-specific overexpression of Cav-3 is a novel strategy to enhance natriuretic peptide expression, attenuate hypertrophy and possibly exploit the therapeutic benefits of natriuretic peptides in cardiac hypertrophy and heart failure.

Keywords: Caveolae, caveolin, hypertrophy, remodeling, ANP, BNP

Introduction

In response to chronic stress, the heart undergoes hypertrophy that can progress to adverse remodeling and heart failure. The signaling events in this progression are complex and involve cell surface receptors, signal transduction pathways, transcriptional and post-transcriptional events (1). The subcellular organization of signaling components in highly ordered lipid microdomains within the plasma membrane helps provide spatial and temporal regulation of signaling (2). Caveolae are specialized cholesterol-and sphingolipid-enriched membrane microdomains that contain the structural proteins caveolins (3). Caveolins organize and regulate receptors and signaling molecules that are involved in a wide array of cell functions, including cell growth and hypertrophy (4). These molecules include: G-protein coupled receptors, natriuretic peptide receptors, heterotrimeric G-protein subunits, G-protein-regulated effectors, and PI3 kinase (PI3K) (5,6).

There are three caveolin isoforms: caveolin 1, 2, and 3 (7). Caveolin-3 (Cav-3) is an isoform predominantly found in skeletal and cardiac muscle. Cav-3 knockout mice develop peripheral muscle myopathic changes, cardiac hypertrophy and cardiomyopathy (8). By contrast, overexpression of Cav-3 in neonatal cardiac myocytes results in the inability of an adrenergic agonist (i.e., phenylephrine) and endothelin-1 to induce myocyte hypertrophy (9). Thus, loss of Cav-3 induces cardiac hypertrophy and cardiomyopathy, and increased Cav-3 in cardiac myocytes attenuates hypertrophy.

Natriuretic peptides have numerous actions that inhibit hypertrophy; these include diuretic, natriuretic, and vasodilatory properties, as well as autocrine/paracrine actions on cardiac myocytes (10–12). In atrial myocytes ANP is secreted from caveolae and found closely associated with Cav-3 (5,13). Little is known about the role of caveolae and caveolins in natriuretic peptide biology in ventricular cardiac myocytes. Although prior studies have implicated a role for Cav-3 and caveolae in cardiac hypertrophy (9), a relationship between caveolin expression, natriuretic peptide signaling and cardiac hypertrophy has not been described. In the current study, we show that cardiac myocyte-specific overexpression of Cav-3 attenuates cardiac hypertrophy and increases natriuretic peptide expression and signaling.

Materials and Methods

Animals

Animals were treated in compliance with the Guide for the Care and Use of Laboratory Animals (National Academy of Science), and protocols were approved by the VA San Diego Healthcare System Institutional Animal Care and Use Committee. Animals were kept on a 12-hr light-dark cycle in a temperature-controlled room with ad libitum access to food and water. A subset of Cav-3 OE and control littermates were individually housed so that food and water intake could be measured daily. Transgenic mice were generated in our laboratory using the α-myosin heavy chain promoter to produce cardiac myocyte-specific overexpression of Cav-3 (Cav-3 OE) (14). In some experiments, we isolated cardiac myocytes from 200–300g male Sprague-Dawley rats.

Concentrations of Na+ and K+ in plasma and urine were determined in a subset of animals using a flame photometer (Cole-Parmer Instrument Co., Vernon Hills, IL) as described previously (15).

A subset of Cav-3 OE and control mice were trained to allow conscious blood pressure measurements without anesthesia using the CODA noninvasive tail blood pressure system (Kent Scientific, Torrington, CT). Data was analyzed using the CODA v2.5 software.

Transverse Aortic Constriction (TAC)

Eight-sixteen week old transgenic Cav-3 OE mice and transgene negative littermate mice (control) underwent TAC, as previously described (16). In brief, mice were anesthetized with isoflurane, intubated, and mechanically ventilated. An incision was made in the second intercostal space and a 7-0 silk suture was placed around the aorta and 27g needle between the innominate and left carotid artery. A double surgeon’s knot was tied down to the aorta and needle and the needle was removed resulting in a 0.41mm stenosis. Mice were allowed to recover with 100% oxygen for 1 hr. Mice were euthanized after 4 weeks of TAC. Sham animals underwent all aspects of the surgery except placement of the stenosis.

Echocardiography

Echocardiography was performed in a subset of Cav-3 OE and control mice prior to TAC surgery and to euthanasia. Mice were anesthetized with isoflurane and echocardiography was performed using a L15/6-MHz transducer (Sonos 5500, Philips Medical Systems, Andover, Mass). Mice were evaluated for presence of transverse aortic stenosis using pulse wave Doppler; all animals had > 3.5m/s gradient across the stenosis. Bilateral carotid catheterization performed in pentobarbital-anesthetized mice by the use of two high-fidelity 1.4F microtip pressure transducers 48 hrs after TAC showed mean pressure gradients between 40–50 mmHg for both experimental groups (P=NS, control vs. Cav-3 OE, n=5 per group).

Cardiac Function

A subset of Cav-3 OE and control mice were anesthetized with pentobarbital, and cardiac catheterization was performed with a high-fidelity 1.4F microtip pressure transducer (SPR-671, Millar Instruments Inc, Houston, TX). The catheter was advanced via the right carotid artery into the left ventricle after measuring systolic, diastolic, and mean arterial pressure. Parameters were determined by an algorithm from EMKA Technologies (Falls Church, VA).

Morphological Measurements

Dissected mouse hearts were placed in ice-cold saline to evacuate remaining blood prior to dissecting atria and ventricles. Dissected tissue was dried on gauze, immediately weighed and frozen. Heart weight was defined as that of the left and right ventricles. Lungs and tibias were also dissected. Lungs were dried on gauze to remove excess blood and then weighed. Tibias were stored frozen in eppendorf tubes and measured using calipers.

Histology

Animals were transcardially perfused with ice-cold cardioplegic solution (20 mM KCl) and then with either 10% formalin or 4% paraformaldehyde in phosphate buffer (pH = 7.4) and removed. Tissues were fixed overnight at 4°C and embedded in paraffin. Fibrosis was assessed with Masson’s Trichrome staining (Sigma; St. Louis, MO) and hematoxylin-eosin staining of 5μm sections.

For wheat germ agglutinin (WGA) immunofluorescence, 5μm sections of hearts were prepared, washed in PBS, incubated for 2 hr in WGA-Alexa 488 lectin (Molecular Probes), washed and mounted in anti-fade reagent. Five images (40x) from each heart were taken, and the diameter and areas from 70–100 of cross-sectionally arranged myocytes were measured individually and analyzed using NIH ImageJ software.

Electron Microscopy

Electron microscopy was performed in a subset of Cav-3 OE and control whole hearts as previously described (14).

Plasma peptide extraction and enzyme immunoassay (EIA)

Plasma ANP and BNP concentrations were determined by fluorescent immunoassay kits (Phoenix Pharmaceuticals, Inc., Burlingame, CA). Plasma was isolated from mouse blood obtained by cardiac puncture from a subset of Cav-3 OE and control littermate animals. Peptides were extracted from the plasma utilizing an established protocol (Phoenix Pharmaceuticals) that involved addition of an acidifying buffer and centrifugation of samples at 17,000× g for 20 min at 4°C. The acidified plasma was loaded on a pre-equilibrated C-18 SEP-column (Phoenix Pharmaceuticals) and then eluted for analysis of eluted proteins by use of EIA kit protocols.

cGMP assay in Mouse Heart

For cGMP measurements, hearts from control and Cav-3 OE mice were weighed (n=5–6 hearts) and homogenized in 10 volumes of cold 5% trichloroacetic acid (TCA) using a polytron homogenizer. Samples were centrifuged at 1,500× g for 10 min and the supernatants were then extracted using water-saturated ether. cGMP was measured in acetylated supernatants using an EIA kit (Cayman Chemical). cGMP content is expressed as fmol/mg wet tissue.

Isolation of Cardiac Myocytes (CM)

CM were isolated from adult male Sprague-Dawley rats (250–300 g) as previously described(17). CM were incubated with 1.0 × 108 plaque forming units (pfu) Cav-3 adenovirus or green fluorescent protein (GFP) adenovirus (Control) for 24 hr.

Immunoblotting

Whole tissue homogenates and cell lysates [prepared as previously described (14)], nuclear and cytoplasmic fractions (18), or blood samples were separated by SDS-PAGE with 10% polyacrylamide precast gels (Invitrogen, Carlsbad, CA) and transferred to polyvinylidene difluoride membranes via electroelution. Membranes were blocked in 20 mM TBS Tween (1%) containing 3% BSA and incubated with primary antibodies (Caveolin-3 and ANP, Santa Cruz Biotechnology, Carlsbad, CA; PErk, PAKT, and TAKT, Cell Signaling, Danvers, MA; GAPDH, Imgenex, San Diego, CA) overnight at 4°C. Blots were visualized using secondary antibodies conjugated with horseradish peroxidase (Santa Cruz Biotechnology) and enhanced chemiluminescence reagent (GE Healthcare, Waukesha, WI).

Quantitative Real-Time PCR analysis

Total RNA was isolated from CM using a RNeasy Mini Kit (Qiagen, Valencia, CA). First strand cDNA synthesis (iScript cDNA synthesis kit, Bio-Rad, Hercules, CA) was performed using random hexamers on 1–2 μg of total RNA. The concentration of cDNA was determined and adjusted to 50 ng/μl for real-time PCR analysis, which was performed on a MJ Research Opticon 2 (Bio-Rad) in triplicate using the IQ SYBR Green Supermix (Bio-Rad) with 100 ng cDNA and 0.5 μM forward/reverse primer mix in 20 μL final reaction volume. ANP, BNP, and αMHC primers were QuantiTect Primers (Qiagen). Primer sequences for α-sk-actin forward: GTGTCACCCACAACGTGC, reverse: AGGGCCACATAGCACAGC; β-MHC forward: GCTGAAAGCAGAAAGAGATTATC, reverse: TGGAGTTCTTCTCTTCTGGAG. Thermal cycler conditions were as follows: 94°C-10 min (1 cycle); 94°C-20 s, 55°C-20 s, and 72°C-30 s (40 cycles). Resulting PCR products were confirmed by melt curve analysis. Analysis of cycle threshold (Ct) was performed using Opticon 2 analysis software (Bio-Rad); normalized values were obtained for each group by subtracting matched glyceraldehyde-3-phosphate dehydrogenase (GAPDH) Ct values.

Statistics

Statistical analysis was performed with GraphPad Prism Software version 4.0. All values are presented as means ± standard error of the means. 1-way ANOVA followed by post-hoc Bonferroni correction for multiple comparisons (Figures 1C, 2A–F, 5C; all comparisons were performed and all P value were corrected), unpaired and paired Student’s t-test (Figures 1D, 3C–F, 4A–F, 5D) were utilized. A Kaplan-Meier analysis was performed on mouse survival following TAC banding (Figure 1A) and significance was calculated with a Logrank test. A P value <0.05 was considered statistically significant.

Figure 1. Effects of Cav-3 overexpression on mortality, ventricular size and cardiac fibrosis after TAC.

Figure 1

A. Kaplan-Meier curves show improved survival in Cav-3 OE mice compared to control mice after TAC. P<0.05; n=12–16. B. Left ventricle (LV) cross sections reveal that Cav-3 OE hearts have significantly less concentric hypertrophy after TAC when compared to hearts of control mice. C. LV to body weight (BW) and tibia length (TL) ratios are increased significantly in control mice after TAC, whereas these ratios are blunted in Cav-3 OE mice. ***P<0.001, **P<0.01; n=8–16. D. Adult cardiac myocytes (CM) from Cav-3 OE mice have a ~60% decrease in cross sectional area after TAC, as determined by wheat germ agglutinin staining (40x). ***P<0.001; n=7. E. TAC produces interstitial and perivascular fibrosis in hearts of control mice but to a much lesser extent in hearts of Cav-3 OE mice.

Figure 2. Physiological assessment of cardiac function in Cav-3 OE and control mice.

Figure 2

A and B. Echocardiography in control and Cav-3 OE mice reveals a significant decrease in ejection fraction and % fractional shortening in control mice but not Cav-3 OE mice after TAC. *P<0.05 vs. Control; n=8. C and D. Carotid catheterization reveals loss in left ventricular systolic function (dP/dtmax) and left ventricular relaxation (dP/dtmin) in control mice but not Cav-3 OE mice 4 weeks after TAC. ** P<0.01 vs. control, *P<0.05; n=8. E. Wet lung weight (Lung) to body weight (BW) and tibia length (TL) are significantly increased in control mice, but not Cav-3 OE mice after TAC. * P<0.05 vs. control; n=5–8.

Figure 5. Cardiac myocytes (CM) treated with Cav-3 adenovirus have increased ANP expression and Akt phosphorylation that is decreased by disruption of caveolae with methyl-β-cyclodextrin (MβCD) and the PI3K inhibitor, wortmannin.

Figure 5

A. CM isolated from Sprague-Dawley rats were infected with increasing plaque-forming units (pfu) of adenovirus expressing Cav-3. ANP expression and Akt phosphorylation increased in parallel with the increase in Cav-3 expression. B and C. CM treated with MβCD for 24 hr during the period of incubation with 1.0×107 pfu Cav-3 adenoviral particles have a decrease in number of caveolae even though Cav-3 expression increased in MβCD-treated CM, while ANP expression and Akt phosphorylation decreased. Scale bar = 0.10 mm. *P<0.05; n=4 D. Wortmannin inhibited Akt phosphorylation and ANP expression of CM incubated with 1.0×107 pfu Cav-3 adenovirus in the presence of DMSO (vehicle) or wortmannin (PI3K inhibitor) for 24 hr. *P<0.05; n=3.

Figure 3. Caveolae formation and analysis of NP and fetal gene expression in Cav-3 OE and control mice.

Figure 3

A. Electron microscopy of the left ventricle (LV) reveals an increased number of plasma membrane caveolae in Cav-3 OE mice. Scale bar = 0.10 mm; n=2. B. Real-time polymerase chain reaction (RT-PCR) shows a nearly 7-fold and 3-fold increase in ANP and BNP, respectively (Cav-3 OE) compared to transgene negative (control) mice, whereas other “fetal genes” remain at similar levels to control mice. n=5–6. C and D. ANP and BNP expression are significantly increased in Cav-3 OE LV homogenates *P<0.05; n=4. E and F. Mean circulating plasma ANP and BNP levels are similar in Cav-3 OE and control mice.

Figure 4. Elevated NPR-A expression increases cGMP leading to increased nuclear phophorylated AKT.

Figure 4

A NPR-A expression is significantly increased in Cav-3 OE mice compared to control mice. *P<0.05; n=3. B. Cyclic guanosine monophosphate (cGMP) is significantly increased in Cav-3 OE mice compared to control mice. *P<0.05; n=5–6. C and D. Nuclear and cytoplasmic fractions from control and Cav-3 OE left ventricle (LV) probed for NFATc3 show that Cav-3 OE mice have a significantly higher ratio of NFATc3 in the cytoplasm compared to control mice. *P<0.05; n=5. E and F. Nuclear and cytoplasmic fractions from control and Cav-3 OE LV probed for pAkt show that Cav-3 OE mice have a significantly lower ratio of pAkt in the cytoplasm compared to control mice. *P<0.05; n=5.

Results

Cardiac myocyte-specific overexpression of Cav-3 (Cav-3 OE) increases survival, attenuates cardiac hypertrophy, and maintains cardiac function in vivo

Cav-3 OE and control mice underwent 4 wk of TAC to produce pressure-induced cardiac hypertrophy. A Log-rank test on a Kaplan-Meier survival curve revealed that Cav3-OE mice have increased survival after TAC (Figure 1A). Control mice showed an increase in concentric hypertrophy, nearly doubling heart size in response to TAC but TAC produced less hypertrophy in Cav-3 OE mice (Figure 1B). TAC nearly doubled the ratio of LV to body weight and tibia length in control mice but these changes were blunted in Cav-3 OE mice with TAC (Figure 1C). Cardiac hypertrophy, assessed by WGA staining of LV cross-sections, was reduced in Cav-3 OE mice. Surface area of cardiac myocytes from control TAC-treated mice was nearly 60% greater than of myocytes from Cav-3 OE mice subjected to TAC (Figure 1D). Echocardiography confirmed that Cav-3 OE mice had a blunted hypertrophic response to TAC compared to controls. Although, Cav-3 OE mice had a hypertrophic response in IVSd and LVPWd following TAC banding, hypertrophy was attenuated compared to control mice; no changes were observed in IVSs or LVPWs (Table 1). Cav-3 OE mice also had less perivascular and interstitial cardiac fibrosis associated with TAC (Figure 1E).

Table 1.

Echocardiography Measurements

Control Cav-3 OE

Sham TAC % Change (Pre vs. Post TAC) Sham TAC % Change (Pre vs. Post TAC)
N 8 8 8 8 11 8
IVSd (mm) 0.91±0.05 1.34±0.05* 47.9±12.2% 0.88±0.05 1.10±0.05‡ 18.0±6.2%#
LVIDd (mm) 4.07±0.09 4.21±0.06 9.4±6.6% 3.85±0.08 4.09±0.17 7.9±4.4%
LVPWd (mm) 0.79±0.05 1.25±0.07* 40.6±19.3% 0.80±0.04 1.13±0.07§ 21.5±7.1%
IVSs (mm) 1.27±0.10 1.69±0.08† 27.8 ±15.1% 1.20±0.08 1.46±0.07 6.6±6.6%
LVIDs (mm) 2.91±0.12 3.27±0.12 27.5±12.1% 2.67±0.14 3.07±0.24 22.4±9.8%
LVPWs (mm) 1.11±0.11 1.53±0.07† 28.3±11.1% 1.17±0.07 1.41±0.09 12.4±7.8%

Data represent absolute echocardiographic values for Sham and TAC animals at 4 weeks in the control and Cav-3 OE groups and the % change in echocardiographic values between the pre (before TAC) and post (4 weeks after TAC) measurements in the control and Cav-3 OE groups.

*

P<0.001 and

†

P<0.05 vs. Sham Control.

‡

P<0.05 and

§

P<0.01 vs. Sham Cav-3 OE.

P<0.01 vs. Control TAC.

#

P<0.05 vs. Control % change.

Serial echocardiography revealed that control mice had decreased ejection fraction and % fractional shortening after 4 wks of TAC (Figures 2A and 2B), whereas Cav-3 OE mice subjected to TAC had no change in either measure of cardiac function. Carotid catheterization showed that control mice, but not Cav-3 OE mice, had reduced LV systolic function (dP/dtmax) after 4 wks of TAC (Figure 2C). Thus, Cav-3 OE mice maintained LV function in the presence of pressure overload. Furthermore, LV relaxation (dP/dtmin) was decreased in control mice, but not Cav-3 OE mice, after 4 wks of TAC (Figure 2D), a result consistent with the increased fibrosis observed in the control mice. Wet lung weight to body weight (BW) and tibia length (TL) ratios were increased in control, but not Cav-3 OE, mice after TAC, suggesting that control mice had increased fluid accumulation consistent with heart failure (Figure 2E).

NP expression in Cav-3 OE mice at baseline

The LVs from Cav-3 OE mice showed an increased number of caveolae in the sarcolemmal membrane (Figure 3A), a result consistent with previous observations (14). In order to define a role for NPs as a mechanism for the attenuation of cardiac hypertrophy in Cav-3 OE mice, we examined fetal gene expression. RNA isolated from LV homogenates showed a nearly 7-fold and 3-fold increase in ANP and BNP expression respectively, when compared to transgene negative littermates (control) with little to no difference in other fetal genes (Figure 3B). Consistent with the change in RNA expression, ANP and BNP protein expression in LV (Figure 3C and D) were also increased in Cav-3 OE mice. However, plasma ANP and BNP levels were not significantly different between control and Cav-3 OE mice (Figure 3E and F). We also observed no significant differences in conscious blood pressures (136±6 mmHg for Cav-3 OE and 141±3 mmHg for controls, NS, n=11 per group), water or food intake, natriuresis, or diuresis between control and Cav-3 OE mice (Table 2).

Table 2.

Food and water intake by control and Cav-3 OE mice. Sodium and potassium level in plasma and urine of control and Cav-3 OE mice.

Control Cav-3 OE
N 8 8
Food Intake (mg/day) 4.13±0.11 3.75±0.12
Water Intake (ml/day) 5.41±0.35 5.04±0.40
Plasma Sodium (mmol/l) 150.5±1.00 151.5±0.87
Plasma Potassium (mmol/l) 5.029±0.32 5.522±0.31
Urine - Na/creatinine (mmol/mmol) 32.21±5.84 36.42±6.35
Urine - K/Creatinine (mmol/mmol) 30.19±8.04 36.65±4.13

Cav-3 OE mice have increased natriurertic peptide receptor A (NPR-A) expression and cGMP levels, reduced nuclear factor of activated T-cells (NFATc3) nuclear translocation and increased nuclear pAkt

LV homogenates from Cav-3 OE and control littermates were immunoblotted for NPR-A, the dominant receptor involved in ANP and BNP signaling. We found that NPR-A expression was increased in Cav-3 OE mice (Figure 4A) and consistent with the signaling by NPR-A, that cGMP levels were also increased in those mice (Figure 4B). In order to investigate downstream signaling molecules involved in hypertrophy, we isolated nuclear and cytoplasmic fractions from Cav-3 OE and control LV homogenates and assessed the expression and localization of NFATc3 and Akt. LV from Cav-3 OE mice had a greater cytoplasmic/nuclear ratio of NFATc3 (Figures 4C and 4D) and decreased cytoplasmic/nuclear expression of pAkt due to increased nuclear expression than did LV from control littermates (Figures 4E and 4F).

ANP expression is caveolae-dependent and dependent on Akt phosphorylation

To assess whether increased expression of caveolins or caveolae were alone sufficient to observe the increase in ANP expression, we isolated ventricular CM from adult Sprague-Dawley rats and treated them with increasing Cav-3 adenovirus (from 0–30 × 107 plaque-forming units [pfu]) for 24 hr (Figure 5A). We found that as Cav-3 expression, ANP expression and Akt phosphorylation all increased in CM incubated with the Cav-3 adenovirus but that adenovirus for EGFP (control) produced no increase in Cav-3, ANP or pAkt expression (Figure 5A).

In order to determine whether Cav-3 expression or the formation of caveolae was involved in the increase in ANP expression, we incubated CM for 24 hr with methyl-β-cyclodextrin (MβCD, 500 nM), an agent that disrupts caveolae, during incubation with the Cav-3 adenovirus. MβCD disrupted caveolae (Figure 5B) but in the presence of MβCD, ANP or pAkt expression did not increase even though Cav-3 was substantially increased (Figure 5C). Thus, the presence of caveolae appears to be necessary for the increase in ANP expression in CM engineered to overexpress Cav-3.

To assess the role of Akt in ANP expression, we incubated CM with Cav-3 adenovirus for 24 hr in the presence of wortmannin, a PI3K inhibitor, or DMSO (vehicle). Wortmannin decreased Akt phosphorylation and ANP expression in myocytes incubated with Cav 3 adenovirus (Figure 5D), thus implying that the increased ANP expression in response to Cav-3 overexpression is dependent on Akt phosphorylation.

Discussion

Our results show that cardiac myocyte-specific overexpression of Cav-3 blunts pressure-induced cardiac hypertrophy and increases natriuretic peptide expression and downstream signaling. This increase in natriuretic peptide expression depended on the presence of caveolae and was associated with increased phosphorylation of Akt. Increasing cardiac Cav-3 expression thus may provide a novel therapeutic approach to enhance natriuretic peptide expression.

The localization of natriuretic peptides with caveolae and caveolins was suggested 20 years ago but little further work has investigated these relationships (5,13,19). Previously we have shown that cardiac myocyte-specific overexpression of Cav-3 mimics ischemia-induced preconditioning and protects the heart from ischemic injury by increasing pAkt signaling, effects that are blocked with 5-hydroxydecanoate, a mitochondrial KATP channel inhibitor, and wortmannin, a PI3K inhibitor (14). Treatment of rat hearts with ANP also has cardioprotective effects that are blocked with 5-hydroxydecanoate (20). Cav-3 knockout mice display enhanced hypertrophic signaling (8), an effect similar to that observed in mice with a knockout of NPR-A, the major natriuretic signaling receptor in cardiac myocytes (21). The current results show that Cav-3 OE mice are resistant to pressure-induced hypertrophy, potentially as a consequence of increased natriuretic peptide and NPR-A expression accompanied by increased cGMP and pAkt signaling. That conclusion is consistent with previous work that has documented the anti-hypertrophic (22), anti-fibrotic (23), and inotropic (24) actions of natriuretic peptides.

NPR-A overexpression has been shown to reduce TAC-induced cardiac hypertrophy via a non-MAPK signaling pathway (25). NPR-A has an intracellular guanylyl cylase domain, which upon activation increases cGMP levels and can inhibit hypertrophic signaling. Cav-3 OE mice not only have increased levels of NP, but also of NPR-A and cGMP, suggesting that NPR-A activity is increased. Although we have shown that phosphorylated endothelial nitric oxide synthase (eNOS) and NOS activity are not significantly elevated in cardiac homogenates of Cav-3 OE mice (14), recent studies suggest an interplay between ANP and NO (26) and implicate a synergistic augmentation of NPR-A signaling via NO-activated guanylyl cyclases (27). The mechanism for this crosstalk will require further investigation.

Akt localization in the nucleus can prevent cardiac hypertrophy and nuclear Akt can induce ANP expression, prevent pathological hypertrophy and maintain cardiac function following TAC (28). The increase in natriuretic peptides that occurs with cardiac hypertrophy may help compensate for the increase in afterload via its diuretic, natriuretic, and vasodilating actions as well as by its ability to inhibit aldosterone synthesis and renin secretion (10–12). Natriuretic peptides have been used to reduce post-myocardial infarction remodeling (29) and to improve stroke volume index in patients with heart failure (24). However, the use of natriuretic peptides as heart failure therapeutics has been hampered by the relatively short half-life and instability of ANPs and hypotension-dependent reductions in renal perfusion that occur with BNP (30). The current data show that Cav-3 overexpression creates a cellular pool of natriuretic peptides that can lead to long-term positive cardiovascular effects in a setting of cardiac hypertrophy.

We find that increased Cav-3 expression in CMs is associated with increases in pAkt and ANP expression and that the latter increases depend on caveolae expression and localization of Cav-3 in caveolae since MβCD treatment decreases caveolae, but not Cav-3, expression and significantly lowers pAkt and ANP expression (Figure 5C). Based on results obtained with wortmannin, which inhibits expression of pAkt and ANP, pAkt potentially contributes to the enhanced expression of ANP (28). Our results thus imply that caveolae not only localize ANP but may also decrease its degradation and facilitate the ability of PI3K and pAkt to upregulate ANP protein expression. We speculate that the increase in natriuretic peptides in Cav-3 OE mice may prevent the dephosphorylation and thus, decrease nuclear translocation of NFATc3, thereby inhibiting cardiac hypertrophy (31). Cav-3 OE mice also have greater nuclear pAkt expression, which perhaps contributes to their increase in natriuretic peptide expression.

Increased natriuretic peptide levels are generally thought to reflect cardiac dysfunction and have been used as a “biomarker” of cardiac hypertrophy (32). However, unlike in other hypertrophic models, Cav-3 OE mice have increased ANP and BNP RNA levels but not those of other hypertrophic markers. Thus, Cav-3 OE appears to have the unique ability to alter natriuretic peptide levels without inducing the complete fetal gene response, a result akin to the ability of nuclear localization of pAkt to prevent hypertrophy (28). Treatment with hypertrophic agonists can increase Cav-3 protein and caveolae formation but it is not clear if this effect is harmful or helpful in the setting of cardiac hypertrophy (9,33). The current results show that overexpressing caveolae and Cav-3 does not exacerbate, but instead prevents, cardiac hypertrophy, thus implicating a protective role for increased cav-3 expression.

The current findings in mice with myocyte-specific Cav-3 OE contrast with data for mice with non-cardiac myocyte-specific OE of Cav-3, which develop a cardiomyopathy-like phenotype (34). Cav-3 expression is normally limited to skeletal and cardiac muscle and as a result, other effects of Cav-3 OE, such as induction of vasculopathies, cannot be ruled out as the cause of cardiac dysfunction in such mice.

A limitation of the current study was that we did not directly investigate the role of NPR-A antagonism on downstream hypertrophic signaling. We were unable to obtain an inhibitor of NPR-A, e.g., HS-142-1, which was used in some prior studies but is no longer manufactured.

In conclusion, the data shown here indicate that a plasma membrane structural protein, Cav-3, not only increases caveolae formation but also induces a “protective phenotype” that is characterized by increased natriuretic peptide expression and decreased cardiac hypertrophy. The present data thus define a physiologically important relationship between Cav-3 and natriuretic peptide levels in the left ventricle and identify a novel mechanism and therapeutic rationale for the potential of increasing Cav-3 expression to enhance the expression of natriuretic peptides and their beneficial effects against heart failure.

Acknowledgments

We thank Ana Moreno and Stephanie Cipta for quantification of WGA immunofluorescence.

Sources of Funding

This work was supported by the American Heart Association: Predoctoral Fellowship 06150217Y (Y.T.H.), Beginning Grant in Aid 0765076Y (Y.M.T.), Grant in Aid 3440038 (V.V.), and Scientist Development Grant 0630039N (H.H.P.), 0730010N (R.C.P.), and 2610034 (T.R.); National Institutes of Health: HL081400 (D.M.R.), HL66941 (P.A.I. and D.M.R.), HL091071 (H.H.P.), GM66232 (P.A.I.), HL007261 (Y.T.H.), AR40155 (Y.T.H.), HL094728 (V.V.) and DK079337 (V.V.); American Society of Nephrology Carl W. Gottschalk Research Grant (T.R.); Merit Award from the Department of Veterans Affairs (D.M.R.). There are no relationships with industry.

Abbreviations

ANP

atrial natriuretic peptide

BNP

brain natriuretic peptide

Cav

caveolin

cDNA

complementary deoxynucleic acid

CM

cardiac myocyte

EGFP

enhanced green fluorescent protein

EM

electron microscopy

ERK

extracellular signal regulated kinase

LV

left ventricle

MBCD

methyl-b-cyclodextrin

mRNA

messenger ribonucleic acid

OE

overexpressor

PI3K

phosphatidylinositol-3-kinase

RT-PCR

real time polymerase chain reaction

TAC

transverse aortic constriction

References

  • 1.Heineke J, Molkentin JD. Regulation of cardiac hypertrophy by intracellular signalling pathways. Nat Rev Mol Cell Biol. 2006;7:589–600. doi: 10.1038/nrm1983. [DOI] [PubMed] [Google Scholar]
  • 2.Pike LJ. Lipid rafts: bringing order to chaos. J Lipid Res. 2003;44:655–67. doi: 10.1194/jlr.R200021-JLR200. [DOI] [PubMed] [Google Scholar]
  • 3.Palade GE. An electron microscope study of the mitochondrial structure. J Histochem Cytochem. 1953;1:188–211. doi: 10.1177/1.4.188. [DOI] [PubMed] [Google Scholar]
  • 4.Patel HH, Murray F, Insel PA. Caveolae as organizers of pharmacologically relevant signal transduction molecules. Annu Rev Pharmacol Toxicol. 2008;48:359–91. doi: 10.1146/annurev.pharmtox.48.121506.124841. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Doyle DD, Ambler SK, Upshaw-Earley J, Bastawrous A, Goings GE, Page E. Type B atrial natriuretic peptide receptor in cardiac myocyte caveolae. Circ Res. 1997;81:86–91. doi: 10.1161/01.res.81.1.86. [DOI] [PubMed] [Google Scholar]
  • 6.Krajewska WM, Maslowska I. Caveolins: structure and function in signal transduction. Cell Mol Biol Lett. 2004;9:195–220. [PubMed] [Google Scholar]
  • 7.Williams TM, Lisanti MP. The caveolin proteins. Genome Biol. 2004;5:214. doi: 10.1186/gb-2004-5-3-214. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Woodman SE, Park DS, Cohen AW, et al. Caveolin-3 knock-out mice develop a progressive cardiomyopathy and show hyperactivation of the p42/44 MAPK cascade. J Biol Chem. 2002;277:38988–97. doi: 10.1074/jbc.M205511200. [DOI] [PubMed] [Google Scholar]
  • 9.Koga A, Oka N, Kikuchi T, Miyazaki H, Kato S, Imaizumi T. Adenovirus-mediated overexpression of caveolin-3 inhibits rat cardiomyocyte hypertrophy. Hypertension. 2003;42:213–9. doi: 10.1161/01.HYP.0000082926.08268.5D. [DOI] [PubMed] [Google Scholar]
  • 10.Nishikimi T, Maeda N, Matsuoka H. The role of natriuretic peptides in cardioprotection. Cardiovasc Res. 2006;69:318–28. doi: 10.1016/j.cardiores.2005.10.001. [DOI] [PubMed] [Google Scholar]
  • 11.Rubattu S, Sciarretta S, Valenti V, Stanzione R, Volpe M. Natriuretic peptides: an update on bioactivity, potential therapeutic use, and implication in cardiovascular diseases. Am J Hypertens. 2008;21:733–41. doi: 10.1038/ajh.2008.174. [DOI] [PubMed] [Google Scholar]
  • 12.Lee CY, Burnett JC., Jr Natriuretic peptides and therapeutic applications. Heart Fail Rev. 2007;12:131–42. doi: 10.1007/s10741-007-9016-3. [DOI] [PubMed] [Google Scholar]
  • 13.Newman TM, Severs NJ, Skepper JN. The pathway of atrial natriuretic peptide release--from cell to plasma. Cardioscience. 1991;2:263–72. [PubMed] [Google Scholar]
  • 14.Tsutsumi YM, Horikawa YT, Jennings MM, et al. Cardiac-specific overexpression of caveolin-3 induces endogenous cardiac protection by mimicking ischemic preconditioning. Circulation. 2008;118:1979–88. doi: 10.1161/CIRCULATIONAHA.108.788331. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Rieg T, Tang T, Murray F, et al. Adenylate Cyclase 6 Determines cAMP Formation and Aquaporin-2 Phosphorylation and Trafficking in Inner Medulla. J Am Soc Nephrol. 2010 doi: 10.1681/ASN.2010040409. epub ahead of print. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Rockman HA, Ross RS, Harris AN, et al. Segregation of atrial-specific and inducible expression of an atrial natriuretic factor transgene in an in vivo murine model of cardiac hypertrophy. Proc Natl Acad Sci U S A. 1991;88:8277–81. doi: 10.1073/pnas.88.18.8277. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Patel HH, Head BP, Petersen HN, et al. Protection of adult rat cardiac myocytes from ischemic cell death: role of caveolar microdomains and delta-opioid receptors. Am J Physiol Heart Circ Physiol. 2006;291:H344–50. doi: 10.1152/ajpheart.01100.2005. [DOI] [PubMed] [Google Scholar]
  • 18.Hunter JC, Kostyak JC, Novotny JL, Simpson AM, Korzick DH. Estrogen deficiency decreases ischemic tolerance in the aged rat heart: Roles of PKCdelta, PKCepsilon, Akt, and GSK3beta. Am J Physiol Regul Integr Comp Physiol. 2007;292:R800–9. doi: 10.1152/ajpregu.00374.2006. [DOI] [PubMed] [Google Scholar]
  • 19.Page E, Upshaw-Earley J, Goings GE. Localization of atrial natriuretic peptide in caveolae of in situ atrial myocytes. Circ Res. 1994;75:949–54. doi: 10.1161/01.res.75.5.949. [DOI] [PubMed] [Google Scholar]
  • 20.Okawa H, Horimoto H, Mieno S, Nomura Y, Yoshida M, Shinjiro S. Preischemic infusion of alpha-human atrial natriuretic peptide elicits myoprotective effects against ischemia reperfusion in isolated rat hearts. Mol Cell Biochem. 2003;248:171–7. doi: 10.1023/a:1024148621505. [DOI] [PubMed] [Google Scholar]
  • 21.Oliver PM, Fox JE, Kim R, et al. Hypertension, cardiac hypertrophy, and sudden death in mice lacking natriuretic peptide receptor A. Proc Natl Acad Sci U S A. 1997;94:14730–5. doi: 10.1073/pnas.94.26.14730. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Horio T, Nishikimi T, Yoshihara F, Matsuo H, Takishita S, Kangawa K. Inhibitory regulation of hypertrophy by endogenous atrial natriuretic peptide in cultured cardiac myocytes. Hypertension. 2000;35:19–24. doi: 10.1161/01.hyp.35.1.19. [DOI] [PubMed] [Google Scholar]
  • 23.Maki T, Horio T, Yoshihara F, et al. Effect of neutral endopeptidase inhibitor on endogenous atrial natriuretic peptide as a paracrine factor in cultured cardiac fibroblasts. Br J Pharmacol. 2000;131:1204–10. doi: 10.1038/sj.bjp.0703679. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Saito Y, Nakao K, Nishimura K, et al. Clinical application of atrial natriuretic polypeptide in patients with congestive heart failure: beneficial effects on left ventricular function. Circulation. 1987;76:115–24. doi: 10.1161/01.cir.76.1.115. [DOI] [PubMed] [Google Scholar]
  • 25.Knowles JW, Esposito G, Mao L, et al. Pressure-independent enhancement of cardiac hypertrophy in natriuretic peptide receptor A-deficient mice. J Clin Invest. 2001;107:975–84. doi: 10.1172/JCI11273. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Costa MD, Bosc LV, Majowicz MP, Vidal NA, Balaszczuk AM, Arranz CT. Atrial natriuretic peptide modifies arterial blood pressure through nitric oxide pathway in rats. Hypertension. 2000;35:1119–23. doi: 10.1161/01.hyp.35.5.1119. [DOI] [PubMed] [Google Scholar]
  • 27.Kotlo KU, Rasenick MM, Danziger RS. Evidence for cross-talk between atrial natriuretic peptide and nitric oxide receptors. Mol Cell Biochem. 338:183–9. doi: 10.1007/s11010-009-0352-6. [DOI] [PMC free article] [PubMed]
  • 28.Tsujita Y, Muraski J, Shiraishi I, et al. Nuclear targeting of Akt antagonizes aspects of cardiomyocyte hypertrophy. Proc Natl Acad Sci U S A. 2006;103:11946–51. doi: 10.1073/pnas.0510138103. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Kuga H, Ogawa K, Oida A, et al. Administration of atrial natriuretic peptide attenuates reperfusion phenomena and preserves left ventricular regional wall motion after direct coronary angioplasty for acute myocardial infarction. Circ J. 2003;67:443–8. doi: 10.1253/circj.67.443. [DOI] [PubMed] [Google Scholar]
  • 30.Sackner-Bernstein JD, Skopicki HA, Aaronson KD. Risk of worsening renal function with nesiritide in patients with acutely decompensated heart failure. Circulation. 2005;111:1487–91. doi: 10.1161/01.CIR.0000159340.93220.E4. [DOI] [PubMed] [Google Scholar]
  • 31.Wilkins BJ, De Windt LJ, Bueno OF, et al. Targeted disruption of NFATc3, but not NFATc4, reveals an intrinsic defect in calcineurin-mediated cardiac hypertrophic growth. Mol Cell Biol. 2002;22:7603–13. doi: 10.1128/MCB.22.21.7603-7613.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Schwartz K, Boheler KR, de la Bastie D, Lompre AM, Mercadier JJ. Switches in cardiac muscle gene expression as a result of pressure and volume overload. Am J Physiol. 1992;262:R364–9. doi: 10.1152/ajpregu.1992.262.3.R364. [DOI] [PubMed] [Google Scholar]
  • 33.Kikuchi T, Oka N, Koga A, Miyazaki H, Ohmura H, Imaizumi T. Behavior of caveolae and caveolin-3 during the development of myocyte hypertrophy. J Cardiovasc Pharmacol. 2005;45:204–10. doi: 10.1097/01.fjc.0000152029.53997.57. [DOI] [PubMed] [Google Scholar]
  • 34.Aravamudan B, Volonte D, Ramani R, et al. Transgenic overexpression of caveolin-3 in the heart induces a cardiomyopathic phenotype. Hum Mol Genet. 2003;12:2777–88. doi: 10.1093/hmg/ddg313. [DOI] [PubMed] [Google Scholar]

RESOURCES