Abstract
Using in vitro labelling techniques, a tRNAGly from M. mycoides sp. capri PG3 has been shown to have the sequence : pGCAGGUGs4UAGUUUAAUGGCAGAACUUC AGCCUUCCm6AAGCUGAUUGUGAGGGU psi CGAUUCCCUUCACCUGCUCCAOH. The anticodon is UCC and no other tRNAGly has been detected in the crude tRNA isolated from this organism. As is the case with some mitochondrial tRNAs, where the genome size of the organelle is small, it is possible that this tRNA is used to read all four glycine codons GGN.
Full text
PDF



Selected References
These references are in PubMed. This may not be the complete list of references from this article.
- Razin S. The mycoplasmas. Microbiol Rev. 1978 Jun;42(2):414–470. doi: 10.1128/mr.42.2.414-470.1978. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Sprinzl M., Grueter F., Spelzhaus A., Gauss D. H. Compilation of tRNA sequences. Nucleic Acids Res. 1980 Jan 11;8(1):r1–r22. [PMC free article] [PubMed] [Google Scholar]
- Stanley J., Vassilenko S. A different approach to RNA sequencing. Nature. 1978 Jul 6;274(5666):87–89. doi: 10.1038/274087a0. [DOI] [PubMed] [Google Scholar]
- Tanaka Y., Dyer T. A., Brownlee G. G. An improved direct RNA sequence method; its application to Vicia faba 5.8S ribosomal RNA. Nucleic Acids Res. 1980 Mar 25;8(6):1259–1272. doi: 10.1093/nar/8.6.1259. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Walker R. T., RajBhandary U. L. The nucleotide sequence of formylmethionine tRNA from Mycoplasma mycoides sp. capri. Nucleic Acids Res. 1978 Jan;5(1):57–70. doi: 10.1093/nar/5.1.57. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Woese C. R., Maniloff J., Zablen L. B. Phylogenetic analysis of the mycoplasmas. Proc Natl Acad Sci U S A. 1980 Jan;77(1):494–498. doi: 10.1073/pnas.77.1.494. [DOI] [PMC free article] [PubMed] [Google Scholar]
