Abstract
One Drosophila melanogaster tRNAGly gene occurs on each 1.1-2.0 kb unit of a direct duplication at chromosomal region 56F. The nucleotide sequence of the gene and the 5' flanking region has been determined. The non-transcribed strand sequence of the tRNA gene is: 5' GCATCGGTGGTTCAGTGGTAGAATGCTCGCCTGCCACGCGGGCGGCCCGGGTTCGATTCCCGGCCGATGCA 3'. This nucleotide sequence is identical to that of the major glycine tRNA in Bombyx mori posterior silk gland. Within the 22 kb region mapped, additional tRNA genes are found, an observation consistent with reports that genes for other isoacceptors are present at this locus.
Full text
PDF











Images in this article
Selected References
These references are in PubMed. This may not be the complete list of references from this article.
- Benton W. D., Davis R. W. Screening lambdagt recombinant clones by hybridization to single plaques in situ. Science. 1977 Apr 8;196(4286):180–182. doi: 10.1126/science.322279. [DOI] [PubMed] [Google Scholar]
- Blattner F. R., Williams B. G., Blechl A. E., Denniston-Thompson K., Faber H. E., Furlong L., Grunwald D. J., Kiefer D. O., Moore D. D., Schumm J. W. Charon phages: safer derivatives of bacteriophage lambda for DNA cloning. Science. 1977 Apr 8;196(4286):161–169. doi: 10.1126/science.847462. [DOI] [PubMed] [Google Scholar]
- Bogenhagen D. F., Sakonju S., Brown D. D. A control region in the center of the 5S RNA gene directs specific initiation of transcription: II. The 3' border of the region. Cell. 1980 Jan;19(1):27–35. doi: 10.1016/0092-8674(80)90385-2. [DOI] [PubMed] [Google Scholar]
- Bolivar F., Rodriguez R. L., Greene P. J., Betlach M. C., Heyneker H. L., Boyer H. W., Crosa J. H., Falkow S. Construction and characterization of new cloning vehicles. II. A multipurpose cloning system. Gene. 1977;2(2):95–113. [PubMed] [Google Scholar]
- Cohen S. N., Chang A. C., Boyer H. W., Helling R. B. Construction of biologically functional bacterial plasmids in vitro. Proc Natl Acad Sci U S A. 1973 Nov;70(11):3240–3244. doi: 10.1073/pnas.70.11.3240. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Dunn R., Hayashi S., Gillam I. C., Delaney A. D., Tener G. M., Grigliatti T. A., Kaufman T. C., Suzuki D. T. Genes coding for valine transfer ribonucleic acid-3b in Drosophila melanogaster. J Mol Biol. 1979 Mar 5;128(3):277–287. doi: 10.1016/0022-2836(79)90088-3. [DOI] [PubMed] [Google Scholar]
- Fyrberg E. A., Kindle K. L., Davidson N., Kindle K. L. The actin genes of Drosophila: a dispersed multigene family. Cell. 1980 Feb;19(2):365–378. doi: 10.1016/0092-8674(80)90511-5. [DOI] [PubMed] [Google Scholar]
- Garber R. L., Gage L. P. Transcription of a cloned Bombyx mori tRNA2Ala gene: nucleotide sequence of the tRNA precursor and its processing in vitro. Cell. 1979 Nov;18(3):817–828. doi: 10.1016/0092-8674(79)90134-x. [DOI] [PubMed] [Google Scholar]
- Garel J. P., Keith G. Nucleotide sequence of Bombyx mori L. tRNA1Gly. Nature. 1977 Sep 22;269(5626):350–352. doi: 10.1038/269350a0. [DOI] [PubMed] [Google Scholar]
- Grigliatti T. A., White B. N., Tener G. M., Kaufman T. C., Suzuki D. T. The localization of transfer RNA5Lys genes in Drosophila melanogaster. Proc Natl Acad Sci U S A. 1974 Sep;71(9):3527–3531. doi: 10.1073/pnas.71.9.3527. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Grunstein M., Hogness D. S. Colony hybridization: a method for the isolation of cloned DNAs that contain a specific gene. Proc Natl Acad Sci U S A. 1975 Oct;72(10):3961–3965. doi: 10.1073/pnas.72.10.3961. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Gupta R. C., Roe B. A., Randerath K. The nucleotide sequence of human tRNAGly (anticodon GCC). Nucleic Acids Res. 1979 Oct 25;7(4):959–970. doi: 10.1093/nar/7.4.959. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Hayashi S., Gillam I. C., Delaney A. D., Dunn R., Tener G. M., Grigliatti T. A., Suzuki D. T. Hybridization of tRNAs of Drosophila melanogaster to polytene chromosomes. Chromosoma. 1980;76(1):65–84. doi: 10.1007/BF00292227. [DOI] [PubMed] [Google Scholar]
- Hovemann B., Sharp S., Yamada H., Söll D. Analysis of a drosophila tRNA gene cluster. Cell. 1980 Apr;19(4):889–895. doi: 10.1016/0092-8674(80)90080-x. [DOI] [PubMed] [Google Scholar]
- Knapp G., Ogden R. C., Peebles C. L., Abelson J. Splicing of yeast tRNA precursors: structure of the reaction intermediates. Cell. 1979 Sep;18(1):37–45. doi: 10.1016/0092-8674(79)90351-9. [DOI] [PubMed] [Google Scholar]
- Korn L. J., Brown D. D. Nucleotide sequence of Xenopus borealis oocyte 5S DNA: comparison of sequences that flank several related eucaryotic genes. Cell. 1978 Dec;15(4):1145–1156. doi: 10.1016/0092-8674(78)90042-9. [DOI] [PubMed] [Google Scholar]
- Kubli E., Schmidt T. The localization of tRNA4Glu genes from Drosophila melanogaster by "in situ" hybridization. Nucleic Acids Res. 1978 May;5(5):1465–1478. doi: 10.1093/nar/5.5.1465. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Maniatis T., Hardison R. C., Lacy E., Lauer J., O'Connell C., Quon D., Sim G. K., Efstratiadis A. The isolation of structural genes from libraries of eucaryotic DNA. Cell. 1978 Oct;15(2):687–701. doi: 10.1016/0092-8674(78)90036-3. [DOI] [PubMed] [Google Scholar]
- Maniatis T., Jeffrey A., Kleid D. G. Nucleotide sequence of the rightward operator of phage lambda. Proc Natl Acad Sci U S A. 1975 Mar;72(3):1184–1188. doi: 10.1073/pnas.72.3.1184. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Maxam A. M., Gilbert W. Sequencing end-labeled DNA with base-specific chemical cleavages. Methods Enzymol. 1980;65(1):499–560. doi: 10.1016/s0076-6879(80)65059-9. [DOI] [PubMed] [Google Scholar]
- Müller F., Clarkson S. G. Nucleotide sequence of genes coding for tRNAPhe and tRNATyr from a repeating unit of X. laevis DNA. Cell. 1980 Feb;19(2):345–353. doi: 10.1016/0092-8674(80)90509-7. [DOI] [PubMed] [Google Scholar]
- Ritossa F. M., Atwood K. C., Spiegelman S. On the redundancy of DNA complementary to amino acid tranfer RNA and its absence from the nucleolar organizer region of Drosophila melanogaster. Genetics. 1966 Aug;54(2):663–676. doi: 10.1093/genetics/54.2.663. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Sakonju S., Bogenhagen D. F., Brown D. D. A control region in the center of the 5S RNA gene directs specific initiation of transcription: I. The 5' border of the region. Cell. 1980 Jan;19(1):13–25. doi: 10.1016/0092-8674(80)90384-0. [DOI] [PubMed] [Google Scholar]
- Southern E. M. Detection of specific sequences among DNA fragments separated by gel electrophoresis. J Mol Biol. 1975 Nov 5;98(3):503–517. doi: 10.1016/s0022-2836(75)80083-0. [DOI] [PubMed] [Google Scholar]
- Sprinzl M., Grueter F., Spelzhaus A., Gauss D. H. Compilation of tRNA sequences. Nucleic Acids Res. 1980 Jan 11;8(1):r1–r22. [PMC free article] [PubMed] [Google Scholar]
- Steffensen D. M., Wimber D. E. Localization of tRNA genes in the salivary chromosomes of Drosophila by RNA:DNA hybridization. Genetics. 1971 Oct;69(2):163–178. doi: 10.1093/genetics/69.2.163. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Tartof K. D., Perry R. P. The 5 s RNA genes of Drosophila melanogaster. J Mol Biol. 1970 Jul 28;51(2):171–183. doi: 10.1016/0022-2836(70)90135-x. [DOI] [PubMed] [Google Scholar]
- Weber L., Berger E. Base sequence complexity of the stable RNA species of Drosophila melanogaster. Biochemistry. 1976 Dec 14;15(25):5511–5519. doi: 10.1021/bi00670a015. [DOI] [PubMed] [Google Scholar]
- Yen P. H., Sodja A., Cohen M., Jr, Conrad S. E., Wu M., Davidson N. Sequence arrangement of tRNA genes on a fragment of Drosophila melanogaster DNA cloned in E. coli. Cell. 1977 Aug;11(4):763–777. doi: 10.1016/0092-8674(77)90290-2. [DOI] [PubMed] [Google Scholar]
- Zúiga M. C., Steitz J. A. The nucleotide sequence of a major glycine transfer RNA from the posterior silk gland of Bombyx mori L. Nucleic Acids Res. 1977 Dec;4(12):4175–4196. doi: 10.1093/nar/4.12.4175. [DOI] [PMC free article] [PubMed] [Google Scholar]


