Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2013 Feb 1.
Published in final edited form as: Comp Biochem Physiol B Biochem Mol Biol. 2011 Sep 29;161(2):93–101. doi: 10.1016/j.cbpb.2011.09.011

Isolation and molecular characterization of Rem2 isoforms in the rainbow trout (Oncorhynchus mykiss): Tissue and central nervous system expression

David M Hollis a,†, Yuri Sawa a, Ashley Wagoner a, Jason S Rawlings a, Frederick W Goetz b
PMCID: PMC3242864  NIHMSID: NIHMS329191  PMID: 21983188

1. Introduction

The RAS superfamily of GTP binding proteins is composed of six subfamilies, the RAS, RAB, RHO, ARF, RAN, and RGK (REM, RAD, and GEM/KIR) subfamilies. The RGK subfamily of GTPases all share features that distinguish them from the other five RAS subfamilies. Such features include the lack of lipid modification for membrane anchorage (Del Villar et al., 1996), N-terminal and C-terminal extensions beyond the RAS core as well as a unique G3 motif (Finlin et al. 2000), and they are regulated at the transcriptional level (Maguire et al, 1994; Cohen et al., 1994; Vanhove et al., 1997; Leone et al., 2001; Suyama et al., 2003; Ohsugi et al., 2004; Warton et al, 2004; Finlin et al., 2005; Paradis et al., 2007). In mammals, among the RGK family, REM2 was the first of the RGK family to be found at high expression levels in neural tissue (Finlin et al. 2000). Within neural tissue, REM2 plays a prominent role in very diverse functions including modulation of Ca2+ currents (Chen et al., 2005), excitatory and inhibitory synapse development (Paradis et al., 2007; Ghiretti and Paradis 2010), survival of embryonic stem cells (Edel et al., 2010a, 2010b), and regulation of dendrite morphology (Ghiretti and Paradis, 2010).

In mammals, REM2 has been well-characterized. The original clone of mammalian REM2, described in rat (Finlin et al., 2000), may be a shorter N-terminal splice variant as a long form was later identified (Church et al., 2009; thereafter, REM2 refers to the long form). There is a high level of conservation among the RAS core of REM2 with other members of the RGK subfamily. However, the extended N-terminus of REM2 appears distinct and may be responsible for functions unique from other RGK subfamily members (Seau and Pitt, 2006). REM2 appears conserved across vertebrate classes (Edel et al., 2010b). However, the zebrafish Rem2 protein appears to lack the extended N-terminus of mammalian REM2. Whether this difference is consistent across vertebrate classes or is species-specific is not known due to a lack of rem2 clones from non-mammalian species. This can also be said for the C-terminal extension, as mammalian REM2 possesses an extended C-terminus distinct from the other RGK members as well (Seau and Pitt, 2006).

In the non-mammalian vertebrates Xenopus laevis, X. tropicalis, and the zebrafish (Danio rerio) rem2 has been isolated (Klein et al., 2002; Edel et al., 2010b), however its characterization including tissue specificity has been limited to zebrafish during embryological development (Edel et al., 2010b). Rem2 has not been characterized in an adult teleost fish species. Unlike mammals, adult teleost fish have been shown to have an enormous capacity for neurogenesis and brain repair (Zupanc, 1999). In both mammals and fish, REM2 has been shown to influence the central nervous system (CNS) regarding neural tissue development, synapse formation, cell proliferation and apoptosis, and stem cell survival (Paradis et al., 2007; Edel et al., 2010a, 2010b; Ghiretti and Paradis, 2010). Such mechanisms of neural plasticity, such as apoptosis and cell proliferation, have been found to be part of the response of the adult fish brain to injury that characterizes the tremendous regenerative properties of their CNS (Zupanc and Zupanc, 2006).

To begin understanding the role that Rem2 could have in adult teleost neurogenesis and brain regenerative capabilities, this study characterized Rem2 and examined its gene expression in the rainbow trout (Oncorhynchus mykiss). Rainbow trout are used extensively as a physiological model system because they are an experimentally tractable species of importance in aquaculture (Thorgaard et al., 2002). Furthermore, rainbow trout are distinctive in having a relatively recent tetraploid ancestry (Allendorf and Thorgaard, 1984; Moghadam et al., 2005; Shiina et al., 2005; Evans et al., 2008), which allows for examination of the process of evolution by gene duplication (Thorgaard et al., 2002). Most importantly, rainbow trout have become a species of interest in behavioral and physiological processes as it relates to neurogenesis and adult brain repair (Menuet et al., 2003, Sørensen et al., 2007, 2011).

The present study describes the first isolation of two alternate forms of Rem2 in a non-mammalian species, the rainbow trout. We present the complete characterization of the cDNAs for both rem2 genes. Furthermore, we compare the tissue specificity of both rem2 genes as well as the expression profiles of both genes across major regions of the CNS.

2. Materials and methods

2.1 Animals

Rainbow trout (Oncorhynchus mykiss, Salmonidae) were obtained from the South Carolina Department of Natural Resources, Walhalla State Fish Hatchery (Mountain Rest, SC, USA). Trout were housed in ‘living streams’ (Frigid Units, Inc.) with capacities of 530 operating liters of dechlorinated water, which was kept at 10 °C. Animals were maintained on a diet of trout chow (Goldfin Slow Sinking Pellets 5.0 mm; Zeigler) and fed twice per day.

2.2 Tissue collection and RNA isolation

Trout were anesthetized using 2-phenoxyethanol (1ml/L H2O) and then sacrificed by rapid decapitation. Tissues were collected, weighed, and immediately homogenized in cold (4°C) TRIzol® reagent for total RNA isolation using the TRIzol® Plus RNA Purification Kit (Invitrogen) in combination with the PureLink™ DNase Set (Invitrogen) to remove genomic DNA. For the isolation of the full-length rem2 genes, whole brain tissue was collected from rainbow trout. For tissue specificity of the rainbow trout rem2 genes, tissue was collected from each of five rainbow trout and included the brain, bulbus arteriosus, gill, head kidney, intestine, liver, spleen, stomach, trunk kidney, ventricle, and red and white muscle. For the regional distribution of gene expression of both rem2 genes in the rainbow trout CNS, brains were removed from five rainbow trout and the olfactory bulb, cerebrum, midbrain, cerebellum, and hindbrain were isolated from each as was a portion of the spinal cord.

2.3 Molecular cloning and sequencing of full-length rem2 genes

One microgram of total RNA from rainbow trout whole brain tissue was used for reverse transcription using BD PowerScript Reverse Transcriptase (BD Biosciences). The synthesized first strand cDNA was then used as a template in 3′ and 5′ RACE assays using the RNA ligase-mediated Rapid Amplification of cDNA Ends (RLM-RACE) Amplification kit (BD Biosciences) according to the manufacturer’s protocol. Initial rem2 5′-RACE and 3′-RACE primer design was based on the analysis of multiple sequence alignments (ClustalW2) between members of the mammalian RGK subfamily and a single 922 bp fragment of a rem2 gene transcript isolated from rainbow trout brain tissue in preliminary differential display assays (GeneFishing™; SeeGene Inc.) using primers supplied by the manufacturer’s kit (Table 1; Hollis unpublished results). From this alignment, four gene-specific primers, two forward and two reverse primers (primary and nested primers for each), for nested RLM-RACE PCR were designed, and a full-length rem2 gene (rem2a) was isolated using these primers (see Table 1). Sequence analysis (described below) during the isolation of this rem2 gene indicated the presence of a second possible rem2 gene transcript. From this transcript, a second set of gene-specific primers were designed for nested RLM-RACE and a second full-length rem2 gene (rem2b) was isolated (see Table 1). The cycling conditions for RLM-RACE for both rem2 genes were 94 °C (3 min) followed by 35 cycles of 94 °C (30 s), 59.5 °C (30 s), 72 °C (1 min), followed by 72 °C (7 min). Verification of the full-length open reading frames (ORFs) for both transcripts was performed using primers specific for the extreme 5′- and 3′-ends of each rem2 gene ORF (see Table 1) with the exception of the reverse primer, which was degenerate in 2 of its 24 base pairs. The cycling conditions for this standard PCR reaction were 94 °C (5 min) followed by 35 cycles of 94 °C (30 s), 60 °C (30 s), 72 °C (1 min), followed by 72 °C (3 min).

Table 1.

Primers and the assays in which they were used.

Assay (Usage)
  Primer Sets Primer sequence
Gene-Fishing™
 Arbitrary primer 12 5′–GTCTACCAGGCATTCGCTTCATXXXXXACCGTGGACG–3′
 dT-Arbitrary Control Primer 2 5′–CTGTGAATGCTGCGACTACGATXXXXX(T)15-3′
Nested RLM-RACE PCR (Obtain full-length sequences)
  rem2a 3′ RACE (forward-outer) 5′–GATTGGACATCAGGGTTGGCTGGA–3′
  rem2a 3′ RACE (forward-inner) 5′–GTGTTCTCTGTCACGGACAGGCGT–3′
  rem2a 5′ RACE (reverse-outer) 5′–ACGCCTGTCCGTGACAGAGAACAC–3′
  rem2a 5′ RACE (reverse-inner) 5′–AGCCCTCTCCTTCAGAATCCACAGA–3′
  rem2b 3′ RACE (forward-outer) 5′–CGACCTGGTCCGTTCACGT–3′
  rem2b 3′ RACE (forward-inner) 5′–TCACCGCACGGCAGAGC–3′
  rem2b 5′ RACE (reverse-outer) 5′–TGAAGTGTGATAGTATGACTCTGTCCAGTGCA–3′
  rem2b 5′ RACE (reverse-inner) 5′–CGACAGATGCGCTCAAAGACAGTATCAG–3′
PCR (Obtain full-length ORFs)
  rem2a (forward) 5′–ATGCAGACAGATGCGCTCATAGACATTATCAA–3′
  rem2a (reverse) 5′– TGCCACGACCTGGGAGCCCTGTGA–3′
  rem2b (forward) 5′– ATGCCGACAGATGCGCTCAAAGACAGTATCAG–3′
  rem2b (reverse) 5′– TGCCACGACCTGGGAGCCCTGTGA–3′
TaqMan PCR
 Gene-specific primers
  rem2(forward) 5′–CCTTGCTATCGCCTTGGCT–3′
  rem2 (reverse) 5′–TCCTTATCTACGACAACTGGAGGC–3′
 Probes
  rem2a 5′–AGAACTGCTTCTGTGGATTCTGAAGGAGAT–3′
  rem2b 5′–CGAACTGCATCTGTGGATTCTGAAGGGGAG–3′
 Reference gene
  eef1a1(forward) 5′–TGATCTACAAGTGCGGAGGCA–3′
  eef1a1(reverse) 5′–CAGCACCCAGGCATACTTGA–3′
Open in a new tab

Products from all PCR were separated on agarose gels, visualized under UV light and the appropriate sized band was cut and cloned into TOPO pCR 2.1 (Invitrogen). Plasmid preparations were made from randomly selected positive colonies and sequenced using the dideoxy chain termination method with “Big Dye Terminator” (Applied Biosystems) and vector primers. Sequencing reactions were precipitated and resuspended in “Hi-Di Formamide with EDTA” (Applied Biosystems) and run on an ABI Prism 3730 automated sequencer (Applied Biosystems). Each product was cloned and sequenced a minimum of 20 times. Four to five additional sequences were also obtained by directly sequencing DNA from PCR reactions. The DNA was purified directly from the PCR reaction (if only one transcript was present in gel electrophoresis analysis) using the ExoSAP-It kit (USB/Affymetrix) following the manufacturers’ instructions. If multiple transcripts were present in gel electrophoresis analysis, the appropriate sized band was cut and gel purified using the QIAquick Gel Extraction kit (QIAgen) following the manufacturers’ instructions. Direct sequencing of the isolated DNA was performed on an automated sequencer (ABI 3730) at the Arizona State University DNA Laboratory (Tempe, AZ, USA).

Sequence chromatogram files were trimmed for quality using phred (http://www.phrap.org/phrap.docs/phred.html), vector screened using cross match (http://www.phrap.org/phrap.docs/phrap.html) and analyzed locally using the Basic Local Alignment Search Tool (BLAST: http://blast.ncbi.nlm.nih.gov/Blast.cgi), specifically blastx against the NCBI nonredundant (nr) protein database and blastn against the NCBI nucleotide (nt) database. Nucleotide alignments were performed using an online ClustalW2 alignment program (http://www.ebi.ac.uk/Tools/msa/clustalw2/). Deduced amino acid sequences also used the ClustalW2 alignment program as well as manual alignments.

2.4 Gene expression analysis

Gene-specific primers were used in combination with isoform-specific probes used for real-time TaqMan® PCR (see Table 1). Real-time TaqMan® PCR was carried out following the manufacturer’s instructions for the SYBR Green One-Step RT-PCR method (Applied Biosystems). TaqMan® probes were labeled with the FAM (6-carboxyfluorescein) fluorophore. A total of 250 ng of total RNA was used per reaction. Reverse transcription was carried out using MultiScribe Reverse Transcriptase (Applied Biosystems) and the generated cDNA was used as a template for PCR amplification. The cycling conditions were, for the reverse transcription, 48 °C (30 min), which was then followed by PCR consisting of 95 °C (10 min), then 40 cycles of 95 °C (15 s), and 60 °C (1 min). Reverse transcription and PCR amplification were performed on a DNA Engine Opticon®2 (BIO-RAD) thermal cycler and analyzed using Opticon® Monitor 3 software (BIO-RAD). For tissue specificity and CNS distribution, measurements were taken from five individual rainbow trout. Gene expression was normalized using a 101 bp fragment of the elongation factor 1 alpha (eef1a1) gene using gene-specific primers following the methods of Verleih et al. (2010; see Table 1). Expression of eef1a1 was performed using real-time PCR following the manufacturer’s instructions for the SYBR Green One-Step RT-PCR method (Applied Biosystems). Total RNA from rainbow trout brain tissue was used to produce standard curves (ranging from 15 to 2000 ng; in triplicate) which were used to compute expression values for all genes analyzed. Data are calibrated to the lowest expressing tissue (red muscle). The cycling conditions for eef1a1 were as those for rem2. Statistical significance for overall expression pattern between the rem2 genes was evaluated by two-way ANOVA (P < 0.05), while differences in expression levels among the individual tissues was evaluated by t-test (P < 0.05). Differential expression across tissues and CNS regions within a single rem2 gene was evaluated by one-way ANOVA (P < 0.05) followed with Tukey’s multiple comparison test (P < 0.05). All statistics were performed using GraphPad Prism software.

3. Results

3.1 Molecular cloning and sequencing of full-length rem2 genes

The two full-length rem2 genes were isolated by cDNA cloning of PCR products from 5′-RACE and 3′-RACE. The ORF of each gene was 912 bp and within the ORF, the two nucleotide sequences were identical in all but 72 base pairs (92% identity). From these nucleotide differences, 29 amino acid differences resulted (Fig. 1). BLAST searches (blastx) in the GenBank database resulted in deduced amino acid sequences of both genes having highest identity (64%) with that of the zebrafish Rem2 protein. Thus, the two genes might represent Rem2 isoforms and therefore, were named O. mykiss rem2a (GenBank accession number JN175327) and O. mykiss rem2b (JN175328). The full-length cDNA sequence of rem2a was 1459 bp, including a 107 bp 5′ untranslated region (UTR), a 912 bp ORF, and a 426 bp 3′ UTR (excluding the poly(A)+ tail). The full-length cDNA sequence of rem2b was 1186 bp, including an 87 bp 5′ untranslated region (UTR), a 912 bp ORF, and an 174 bp 3′ UTR (excluding the poly(A)+ tail). There was less identity between the UTRs than between the ORFs. The rem2a gene had both a longer 5′ UTR (20 additional nucleotides) and a longer 3′ UTR (239 additional nucleotides) than rem2b. Excluding gaps in the 5′ UTR (86 positions), rem2a and rem2b shared 56% identity. In the 3′ UTR, excluding gaps, there were 174 positions where both genes possessed nucleotides, sharing 79 % identity (excluding the poly(A)+ tail).

Fig. 1.

Fig. 1

Open in a new tab

Nucleotide and deduced amino acid sequences of rainbow trout rem2a and rem2b. The nucleotide sequences are aligned and shown in the 5′ to 3′ direction and numbered to the right. The deduced amino acid sequences are in the single letter amino acid code and numbered to the right in italics. Where amino acids differences occur due to codon differences, the Rem2a amino acid is listed first, followed by a slash (/), followed by the Rem2b amino acid. The start and stop codons are boxed. Nucleotides highlighted in gray ( Inline graphic) indicate where trout rem2a and rem2b differ. The location of the primers and probes used in gene expression assays are underlined.

3.2 Deduced amino acid sequence alignment

The rainbow trout Rem2a and Rem2b proteins each consist of 304 deduced amino acids with 90.5% identity between the two based on our alignments (Fig. 2). The deduced amino acid alignment indicates that the rainbow trout Rem2 proteins have highest identity (72%) with that of an unnamed protein of the pufferfish (Tetraodon nigroviridis), which had been identified in BLAST (tblastx) searches, followed closely by the zebrafish Rem2 protein (Rem2a, 61%; Rem2b, 62%). When aligned with all four of the mammalian RGK subfamily members, both rainbow trout isoforms aligned most closely with that of REM2 (43%), as compared to REM (36%), RAD (35%), or GEM (32%). The rainbow trout Rem2a and Rem2b proteins share conservation with the RAS superfamily G1, G3, G4, and G5 GTP binding sites, but like the RGK subfamily, lack the threonine residue of the G2 GTP binding domain that is conserved throughout the rest of the RAS superfamily (Thr35 in H-RAS; Colicelli, 2004). Also, mammalian RGK subfamily members are distinct from the RAS superfamily in that they possess altered residues (Glu84 in GEM, Pro89 in REM and Pro100 in RAD, and Ser123 in REM2) of the residue equivalent to the highly conserved Gly12 in H-RAS within the G1 domain (Colicelli, 2004; Correll et al. 2008). Consistent with this, rather than a glycine residue, both rainbow trout Rem2 isoforms possess an asparagine (Asn99) in this position, as does the zebrafish Rem2 protein (Asn83) and the unnamed pufferfish protein (Asn204). Furthermore, rainbow trout Rem2a and Rem2b share the conserved DXWE G3 motif with the rest of the RGK subfamily members, which is divergent from the DTAGQ motif found in the rest of the RAS superfamily. Finally, within the N-terminal extension of both rainbow trout Rem2 proteins, the amino acids Met22Thr23Leu24 were manually aligned with the conserved amino acids Met1Thr2Leu3 found in REM, RAD, and GEM as this may represent homology. One residue deviation from the conserved RAS superfamily G1–G5 binding motifs was observed in Rem2a, which possessed a threonine (Thr225) in a position typically occupied by an alanine (Ala225 of Rem2b) in the G5 motif.

Fig. 2.

Fig. 2

Open in a new tab

Amino acid sequence alignment of the rainbow trout Rem2a (GenBank accession number JN175327) and Rem2b (JN175328) isoforms. Included in the alignment are the pufferfish unnamed protein (CAG10942.1), zebrafish Rem2 (NM_001123046), human REM2 (NP_775798.2), human RAD (NP_004156.1), human REM (AAC33132.1), and human GEM (NP_005252.1). Shades of gray indicate the corresponding level of identity across sequences with the darker shades indicating increased levels identity ( Inline graphic >50%, Inline graphic > 75%, Inline graphic = 100%). The arrow (▾) indicates where the trout isoforms differ. Consensus sequences for GTP-binding regions (G1–G5) and the conserved C7 sequence motif are indicated below the alignments (Finlin et al., 2000). The G3 consensus shown is that which is unique to the RGK subfamily. The binding sites for the 14-3-3 protein are indicated with an asterisk (Correll et al., 2009). Bold lines below the alignment indicate N-terminal and C-terminal extensions (Splingard et al., 2007). The solid boxes indicate the mammalian REM2 extended N-terminus and C-terminus following Seu and Pitt (2006). The dashed box indicates the SH3 (Src homology 3) binding motif (Splingard et al., 2007). Underlined methionines (M) in Human REM2 (M11), Rem (M1) and GEM (M1) indicate where these amino acids have been previously aligned (Seu and Pitt, 2006; Splingard et al., 2006). Amino acids are numbered to the right. Percent identity of Rem2a and Rem2b with each sequence is indicated at the end of the alignment.

3.3 Tissue specificity of rainbow trout rem2 genes

The overall pattern of expression for the two rainbow trout rem2 genes was very similar, with the brain showing significantly greater levels of expression than any other tissue for both isoforms (Fig. 3). After the brain, the spleen consistently showed high levels of expression. This was followed by the kidney and bulbus arteriosus. The lowest levels of expression were typically seen in regions associated with the digestive system, as well as the red and white skeletal muscle. With the exception of the brain and head kidney, the rem2a gene showed greater levels of expression than that of the rem2b gene in every tissue, with significantly greater expression levels in the liver, kidney, intestine, stomach, spleen, ventricle, bulbus arteriosus, gill, white muscle and red muscle.

Fig. 3.

Fig. 3

Open in a new tab

Tissue specificity of rainbow trout rem2a and rem2b using Real-Time PCR with TaqMan® probes. The overall relative gene expression profile in the different tissues for each isoform was similar (Two-way ANOVA; not significant). There was a significant difference between the two isoforms regarding overall relative expression among the tissues (Two-way ANOVA; P < 0.0001). There was a significant difference in relative expression between all tissues for both isoforms (Two-way ANOVA; P < 0.0001). Significantly greater expression of a particular isoform in a tissue is indicated by an asterisk (t-test, P < 0.05). Each isoform showed differential expression between the different tissues (One-way ANOVA; P < 0.0001) and the relative expression in the brain of each isoform (indicated by “a” for rem2a and “b” for rem2b) was significantly greater than its respective expression in all other tissues (Tukey’s multiple comparison; P < 0.01).

3.4 Central nervous system distribution of rainbow trout rem2 genes

The level of expression for the two rem2 genes in the CNS was similar, with the cerebrum showing high levels of expression (Fig. 4). Along with the cerebrum, the olfactory bulb and the midbrain also had relatively high levels of expression. The cerebellum, hindbrain, and the spinal cord all had relatively low levels of rem2 gene expression. In fact, for each rem2 gene, the olfactory bulb, cerebrum, and midbrain all had significantly higher expression levels than the cerebellum and hindbrain. The cerebrum had significantly higher levels of both rem2 genes than the spinal cord as well. The cerebellum consistently had the lowest levels of expression for both genes. There was a significantly higher level of relative expression of rem2a than rem2b in the spinal cord. Furthermore, though not significant, the rem2a mean levels of expression were consistently higher than rem2b with the exception of the olfactory bulb.

Fig. 4.

Fig. 4

Open in a new tab

Regionalization of rem2a and rem2b in the rainbow trout CNS using Real-Time PCR with TaqMan® probes. The overall pattern of relative gene expression in the CNS of the rainbow trout brain for each isoform was similar (Two-way ANOVA; not significant). There was no significant expression difference between the isoforms among the different regions. There was a significant difference in relative expression between all regions of the CNS assayed for both isoforms (Two-way ANOVA; P < 0.0001). Significantly greater expression of a particular isoform in a region is indicated by an asterisk (t-test, P < 0.05). Each isoform showed differential expression in the CNS (One-way ANOVA; rem2a and rem2b; P < 0.0002). The relative expression of each isoform in the cerebrum (indicated by “a1” for rem2a and “b1” for rem2b) was significantly greater than its respective expression in the cerebellum, hindbrain, and spinal cord, and in the case of rem2a, the olfactory bulb as well (Tukey’s multiple comparison; P < 0.05). Both the midbrain and the olfactory bulb had greater relative expression levels than the cerebellum (indicated by “a2” for rem2a and “b2” for rem2b), except rem2a relative expression in the midbrain was also significantly greater than its expression in the hindbrain as well (P < 0.05).

4. Discussion

4.1 Molecular cloning and sequencing of full-length rem2 genes

In this study, we isolated, cloned, and characterized two forms of the rem2 gene, designated O. mykiss rem2a and rem2b, from the adult rainbow trout. The presence of Rem2 isoforms in rainbow trout is not unexpected as salmonids are well-known to possess isoforms implicated as the result of gene duplication (Moore et al., 1999; Doyon et al., 2003; Englesma et al., 2003; Richards et al., 2003; Koskinen et al., 2004; Gabillard et al., 2006; Quezada et al., 2006; Gharbi et al., 2007; Negler et al., 2007; Ostbye et al., 2007; Saito et al., 2007; Zakhartsev et al., 2007; Chondrou et al., 2008; Hansson and Hahn, 2008; Guo et al., 2009; Østergaard et al., 2009; Morash et al., 2010). REM2 was first described in mammals (Finlin et al., 2000), and has since been isolated in fish (Edel et al. 2010b). Isoforms of REM2 have been previously identified in mammals in the form of splice variants including a short form (Finlin et al., 2000), as well as a long form (Church et al., 2009). It is possible that trout rem2a and/or rem2b RNAs could be alternatively spliced. This subject merits further investigation. This study is the first report of Rem2 isoforms arising from gene duplication, rather than splice variants.

4.2 The deduced amino acid sequences of the rainbow trout Rem2 isoforms

Within the ORF, rainbow trout rem2a and rem2b genes are highly conserved at both the nucleotide and protein level. The only residue deviation from the conserved binding motifs of not only the RGK family, but the RAS superfamily as a whole, was with regard to Rem2a. Within the G5 motif of Rem2a, a threonine (Thr225) is in a position typically occupied by an alanine (Ala225 of Rem2B), though a threonine also resides in this position in RAS superfamily member RASL11A (Colicelli, 2004). This difference has been suggested to indicate that the universal switch mechanism of small GTPases may be structurally different for RASL11A and members of its subfamily (Louro et al., 2004). This may be the case for Rem2a as well. Additionally, zebrafish Rem2 also shows a deviation from this highly conserved alanine and instead, has a valine (Val213). This is similar to members of the NKIRAS branch of the RAS superfamily (Colicelli, 2004). Therefore, the deviation seen in the Rem2a G5 motif, though uncommon, is not completely unique.

Like other members of the RGK subfamily of proteins, mammalian REM2 possesses N-terminal and C-terminal extensions that flank its RAS core (Finlin et al., 2000). It is speculated that the effects of mammalian REM2 upon Ca2+ channel kinetics is due to its extended N-terminus and C-terminus (Seu and Pitt, 2006). Thus, the N-terminal and C-terminal extensions are likely a source of other functional distinctions among RGK proteins. Both rainbow trout Rem2a and Rem2b possess the N-terminal and C-terminal extensions. As a result of the relatively large phylogenetic distance between species used in our alignment, ClustalW2 alignments overlooked certain biologically relevant regions (such as the 5′ 14-3-3 protein binding site). Therefore, additional manual alignments were made to reflect this conservation. In past studies as well as this study, deduced amino acid alignments of the RGK subfamily N-terminal and C-terminal extensions show much less conservation between mammalian REM2 with the rest of the RGK subfamily (Colicelli, 2004; Seu and Pitt, 2006; Splingard et al., 2007). Our deduced amino acid alignments indicate large discrepancies between not only the vertebrate classes, but between different species within the same vertebrate classes as well. The mammalian REM2 N-terminal extension is unique compared to that of other RGK subfamily members in that it is extended with signal transduction binding sites, which likely allows REM2 to be a transcription regulator as is speculated in its ability to hold human embryonic stem cells in a state of pleuropotency by blocking p53 and cyclinD1 transcription (Edel et al., 2010a). The N-terminal extensions of the rainbow trout Rem2a and Rem2b isoforms appears to lack a large portion of the mammalian REM2 N-terminal extension as the there are only 29 amino acids in the rainbow trout isoforms within the first 63 amino acid residues of the mammalian REM2 protein (human Met1 to Pro63). This occurs just upstream of much more highly conserved regions. However, based on manual alignments, the rainbow trout Rem2 isoforms and the pufferfish unnamed protein do in fact indicate potential homology with mammalian REM2 within the first 29 amino acids (human REM2, Met1 to Pro29). Typically in Clustal alignments, Met11 of mammalian REM2 (human Met11) has been aligned to indicate conservation with the initial methionine (Met1) of RAD, REM, and GEM (Seu and Pitt, 2006; Splingard et al., 2007). However, it may be, as indicated in our alignment, that the initial methionine of RAD, REM, and GEM (Met1 of each), plus the following threonine (Thr2 of each) and leucine (Leu3of each) are not only conserved among all three of these proteins, but with both the rainbow trout Rem2 isoforms as well (rainbow trout Rem2a and Rem2b Met22, Thr23, Leu24; see Figure 2). The fact that mammalian REM2 lacks identity with these three highly conserved residues may indicate a derived distinction in function from both its homologs as well as its fellow RGK subfamily members. With regard to the C-terminal extension, a distinct extended region of mammalian REM2 (human REM2 Gly283- Gln290; Seu and Ptt, 2006) appears to be, for the most part, lacking in rainbow trout Rem2. However, a glycine residue in rainbow trout Rem2 (rainbow trout Rem2a and Rem2b Gly244) within this extended C-terminus region appears to be conserved. It is possible that this conserved glycine could be of functional significance. While this alignment is speculative, it does maintain a fairly conserved region between all fish Rem2 proteins and mammalian REM2 regarding the adjacent, downstream amino acids (from rainbow trout Rem2a and Rem2b Ser246-Gly251) that encompass the Src homology 3 (SH3) binding motif (Splingard et al. 2007; see Figure 2). While the rainbow trout Rem2a and Rem2b proteins offer further insight into conservation within the distinct N-terminal and C-terminal extensions of REM2, further comparative studies, particularly involving additional species of amphibians, non-avian reptiles, and birds would offer even greater perspective into putative functional domains within these extensions.

4.3 Tissue specificity of rainbow trout rem2 genes

In mammals, REM2 is unique among the RGK subfamily members in that it expressed at relatively high levels in neural tissue (Finlin et al., 2000; Becker et al., 2008). Consistent with this, early embryos of zebrafish also show high levels of rem2 in neural tissue, and in fact, it is exclusively in the brain and eye (Edel et al., 2010b). The adult rainbow trout expressed both rem2a and rem2b in all tissues examined and is consistent with previous work in that relative expression of rem2 in general, was significantly higher in the brain than every other tissue examined. The pattern of expression of both rem2 genes was very similar except that rem2a was significantly higher in most tissues. Differential expression of isoforms has been observed in salmonid fish, specifically with somatostatin in rainbow trout (Moore et al., 1999), as well as myostatin in brook trout (Roberts and Goetz, 2001). It has been suggested that the different isoforms of myostatin possess different functional roles (Ostbye et al., 2007). Whether the observed expression differences between rem2a and rem2b in the different tissues represent functional differences in the rainbow trout is unknown and the subject for future examination.

Expression of rem2a and rem2b was detected in all tissues assayed. The detection of rem2 in the bulbous arteriosus is the first description of rem2 expression in this tissue, which mainly consists of connective tissue and smooth muscle (Heidal et al., 1997). Furthermore, this is the first description of rem2 gene expression in the gills and head kidney as well. The spleen of the rainbow trout showed levels of rem2a and rem2b expression that were higher than all other tissues except the brain. The high expression of rem2 in the spleen of the rainbow trout contrasts sharply with that of rem2 expression in the spleen of mammals (Finlin et al., 2000; Becker et al., 2008). In rats, Rem2 is found at relatively high levels in the kidney (Finlin et al., 2000), which contrasts with the relatively low expression levels of the rem2 genes in the rainbow trout kidney as well as that of the mouse from previous work (Becker et al., 2008). Finally, based on this study and that from previous work in rodents (Finlin et al., 2000; Becker et al., 2008), Rem2 appears to be at low expression levels across vertebrates in tissues associated with the alimentary canal as well as in skeletal muscle, whereas there appear to be discrepancies between different species with regard to the liver and respiratory organs. If expression levels bear any reflection on functional Rem2 protein levels, the significance and role of Rem2 in the different tissues may be species-specific.

4.4 The expression of rainbow trout rem2 genes in the CNS

The relative expression levels of rainbow trout rem2a and rem2b in the different brain regions were very similar with no significant differences between the two genes. The only significant expression difference between the two genes in the CNS occurred outside of the brain, in the spinal cord. These findings are the first such description of relative regional brain expression of rem2 in an adult non-mammalian vertebrate as far as we know. In mice, Rem2 does not appear to be ubiquitous, but it does exhibit strong expression levels in certain regions of the telencephalon (Becker et al., 2008). Expression of rem2 has also been described in the brain of the zebrafish embryo at different stages of development (between 24 hours and 5 days) and was found to be expressed exclusively in the tectum (Edel et al., 2010b). These findings in zebrafish embryos contrast sharply with those of this study, where both rem2 genes were expressed in the olfactory bulb, telencephalon, mesencephalon, cerebellum, hindbrain and spinal cord. Thus, there likely exists a developmental shift in rem2 gene expression from embryo to adult in the fish brain. However, there exists the possibility for species-specific differences as well, or some combination of both. An examination of rem2 regional gene expression in the adult zebrafish brain, as well as those of rainbow trout embryos, would offer significant insight into this question.

The question as to the role of Rem2 in the developing embryonic fish versus that of the adult fish is of particular interest due to the exceptional ability of adult fish, unlike adult mammals, to retain brain neurogenesis and regeneration capabilities (Zupanc, 1999; Zupanc and Zupanc, 2006; Alvarado and Tsonis, 2006; Chapouton et al., 2007). The adult teleost fish brain has many zones of new cell proliferation including the olfactory bulb, dorsal telencephalon, and regions of the diencephalon, mesencephalon, rhombencephalon, and cerebellum (Zupanc et al., 2005). These new cells have survival times up to nearly ¼ of the entire lifespan of the fish. Furthermore, in the cerebellum of adult brown ghost (Apteronotus leptorhynchus), new cells survive for nearly ½ of the animals’ adult life span (Ott et al., 1997; Zupanc et al., 2006). Also observed in the brown ghost, those cells that do not reach their targets, about 50% of new cells, undergo apoptosis (Soutchek and Zupanc, 1996). It seems quite likely that the prevalence of rem2 expression throughout the adult rainbow trout brain may reflect a possible role for Rem2 in the persistence of newly generated cells. The cerebellum of the adult rainbow trout showed extremely low relative expression of both rem2a and rem2b. In adult zebrafish, the cerebellum exhibits the greatest number of mitotic cells (Zupanc et al., 2005). The relatively high number of mitotic cells in the cerebellum appears to be consistent in teleost fish (Kranz and Richter, 1970; Zupanc and Horshke, 1995; Zikopoulos et al., 2000; Ekström et al., 2001). The low levels of rem2 gene expression in the rainbow trout cerebellum could possibly point toward a regulatory role for Rem2 regarding mitotic activity in the adult fish brain. However, in mammals, REM2 holds human embryonic stem cells in a state of pleuropotency and accelerates the cell cycle (Edel et al., 2010a). REM2 is also known to promote endothelial cell proliferation in angiogenesis (Bierings et al., 2008). Thus, the low levels of rem2 gene expression we found in the rainbow trout cerebellum would seem to be inconsistent with the idea of Rem2 as having a regulatory role regarding mitotic activity in the fish brain. However, newly generated cells in the adult zebrafish cerebellum also migrate long distances within the cerebellum, from the molecular layers to the granule cell layers, and differentiate (Zupanc et al., 2005). It is well-established that during cell differentiation, changes in dendritic morphology occur as synapses are formed with cells in the cerebellum, including granule cells (Duffy and Rakic, 1983). Knockdown of Rem2 in cultured mammalian hippocampal neurons alters their dendritic morphology by increasing the number of dendritic branches (Ghiretti and Paradis, 2010). The low levels of rem2 gene expression we found in the rainbow trout cerebellum could be reflective of the fact that low levels of rem2 previously observed in the developing fish brain are associated with conditions of cell differentiation previously described (Edel et al., 2010b). Thus, the regional, differential expression of the rem2 genes observed across brain regions may reflect overall regional differences in new cell proliferation, migration, and differentiation.

4.5 Conclusion

Among the different GTP-binding proteins, REM2 is unique due to its regulatory role in different neural pathways including neural development and synapse formation. In this study, we isolated and identified, for the first time, Rem2 in an adult teleost fish, and report the first known incidence of Rem2 isoforms that are the result of gene duplication, Rem2a and Rem2b. The pattern of tissue specificity of each of the rainbow trout rem2 genes shows similarity to mammals, yet, there are several distinctions such as relatively high levels in the spleen and relatively low levels in the kidney. Furthermore, this is the first report of rem2 in the gills of a fish, as well as the bulbus arteriosus and head kidney. Teleost fish, such as the rainbow trout, are recognized as unique models of adult neurogenesis and, as tetraploid organisms, they provide the opportunity to examine gene evolution, particularly if functional distinctions exist. The isolation and characterization of rainbow trout rem2 will allow further investigation into understanding the role of this GTP-binding protein in CNS pathways relevant not only to neural development, but likely to adult vertebrate neurogenesis and brain repair as well.

Acknowledgments

This work was funded by the National Institute of Health (NIH) IDeA Network of Biomedical Research Excellence (INBRE) and Furman Advantage. Special thanks to Eli Hestermann, Min-Ken Liao, Crystal Simchick, Megan DeRocher, Chunyu Duan, Gina Tong, Feng-Ru Zhao, the Arizona State University DNA Lab, and the generosity of the South Carolina Department of Natural Resources Walhalla State Fish Hatchery.

Footnotes

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

References

  1. Allendorf FW, Thorgaard GH. Tetraploidy and the evolution of salmonid fishes. In: Turner BJ, editor. The Evolutionary Genetics of Fishes. Plenum Press; New York: 1984. pp. 1–53. [Google Scholar]
  2. Becker JAJ, Befort K, Blad C, Filliol D, Ghate A, Dembele D, Thibault C, Koch M, Muller J, Lardenois A, Poch O, Kieffer BL. Transcriptome analysis identifies genes with enriched expression in the mouse central extended amygdala. Neuroscience. 2008;156(4):950–965. doi: 10.1016/j.neuroscience.2008.07.070. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Bierings R, Beato M, Edel MJ. An endothelial cell genetic screen identifies the GTPase Rem2 as a suppressor of p19ARF expression that promotes endothelial cell proliferation and angiogenesis. J Biol Chem. 2008;283:4408–4416. doi: 10.1074/jbc.M707438200. [DOI] [PubMed] [Google Scholar]
  4. Chapouton P, Jagasia R, Bally-Cuif L. Adult neurogenesis in non-mammalian vertebrates. Bioessays. 2007;29:745–757. doi: 10.1002/bies.20615. [DOI] [PubMed] [Google Scholar]
  5. Chen H, Puhl HL, III, Niu S-L, Mitchell DC, Ikeda SR. Expression of Rem2, an RGK family small GTPase, reduces N-type calcium current without affecting channel surface density. J Neurosci. 2005;25:9762–9772. doi: 10.1523/JNEUROSCI.3111-05.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Chondrou M, Papanastasiou AD, Spyroulious GA, Zarkadis IK. Three isoforms of complement properdin factor P in trout: cloning, expression, gene organization and constrained modeling. Dev Comp Immunol. 2008;32:1454–1466. doi: 10.1016/j.dci.2008.06.010. [DOI] [PubMed] [Google Scholar]
  7. Church DM, Goodstadt L, Hillier LW, Zody MC, Goldstein S, She X, Bult CJ, Agarwala R, Cherry JL, DiCuccio M, Hlavina W, Kapustin Y, Meric P, Maglott D, Birtle Z, Marques AC, Graves T, Zhou S, Teague B, Potamousis K, Churas C, Place M, Herschleb J, Runnheim R, Forrest D, Amos-Landgraf J, Schwartz DC, Cheng Z, Lindblad-Toh K, Eichler EE, Ponting CP. Lineage-specific biology revealed by a finished genome assembly of the mouse. PLoS Biol. 2009;7:E1000112. doi: 10.1371/journal.pbio.1000112. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Cohen L, Mohr R, Chen YY, Huang M, Kato R, Dorin D, Tamanoi F, Goga A, Afar D, Rosenberg N. Transcriptional activation of a ras-like gene (kir) by oncogenic tyrosine kinases. Proc Natl Acad Sci USA. 1994;91:12448–12452. doi: 10.1073/pnas.91.26.12448. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Colicelli J. Human RAS superfamily proteins and related GTPases. Sci STKE. 2004;2004(250):RE13. doi: 10.1126/stke.2502004re13. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Correll RN, Pang C, Niedowicz DM, Finlin BS, Andres DA. The RGK family of GTP-binding proteins: regulators of voltage-dependent calcium channels and cytoskeleton remodeling. Cell Signal. 2008;20:292–300. doi: 10.1016/j.cellsig.2007.10.028. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Del Villar K, Dorin D, Sattler I, Urano J, Poullet P, Robinson N, Mitsuzawa H, Tamanoi F. C-terminal motifs found in Ras-superfamily G-proteins: CAAX and C-seven motifs. Biochem Soc Trans. 2006;24:709–713. doi: 10.1042/bst0240709. [DOI] [PubMed] [Google Scholar]
  12. Doyon C, Gilmour KM, Trudeau VL, Moon TW. Corticotropin-releasing factor and neuropeptide Y mRNA levels are elevated in the preoptic area of socially subordinate rainbow trout. Gen Comp Endocrinol. 2003;133:260–271. doi: 10.1016/s0016-6480(03)00195-3. [DOI] [PubMed] [Google Scholar]
  13. Duffy CJ, Rakic P. Differentiation of granule cell dendrites in the dentate gyrus of the rhesus monkey: A quantitative Golgi study. J Comp Neurol. 1983;214:224–237. doi: 10.1002/cne.902140210. [DOI] [PubMed] [Google Scholar]
  14. Edel MJ, Menchon C, Menendez S, Consiglio A, Raya A, Izpisua Belmonte JC. Rem2 GTPase maintains survival of human embryonic stem cells as well as enhancing reprogramming by regulating p53 and cyclin D1. Genes Dev. 2010a;24:561–573. doi: 10.1101/gad.1876710. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Edel MJ, Boue S, Menchon C, Sánchez-Danés A, Izpisua Belmonte JC. Rem2 GTPase controls proliferation and apoptosis of neurons during embryo development. Cell Cycle. 2010b;9:3414–3422. doi: 10.4161/cc.9.17.12719. [DOI] [PubMed] [Google Scholar]
  16. Ekström P, Johnsson CM, Ohlin LM. Ventricular proliferation zones in the brain of an adult teleost fish and their relation to neuromeres and migration (secondary matrix) zones. J Comp Neurol. 2001;436:92–110. [PubMed] [Google Scholar]
  17. Englesma MY, Stet RJ, Saeij JP, Verburg-van Kemenade BM. Differential expression and haplotypic variation of two interleukin-1beta genes in the common carp (Cyprinus carpio L.) Cytokine. 2003;22:21–32. doi: 10.1016/s1043-4666(03)00102-9. [DOI] [PubMed] [Google Scholar]
  18. Evans H, De Tomaso T, Quail M, Rogers J, Gracey AY, Cossins AR, Berenbrink M. Ancient and modern duplication events and the evolution of stearoyl-CoA desaturases in teleost fishes. Physiol Genomics. 2008;35:18–29. doi: 10.1152/physiolgenomics.90266.2008. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Finlin BS, Shao H, Kadono-Okuda K, Guo N, Andres DA. Rem2, a new member of the Rem/Rad/Gem/Kir family of Ras-related GTPases. Biochem J. 2000;347:223–231. [PMC free article] [PubMed] [Google Scholar]
  20. Finlin BS, Mosley AL, Crump SM, Correll RN, Ozcan S, Satin J, Andres DA. Regulation of L-type Ca2+ channel activity and insulin secretion by the Rem2 GTPase. J Biol Chem. 2005;280:41864–41871. doi: 10.1074/jbc.M414261200. [DOI] [PubMed] [Google Scholar]
  21. Gabillard JC, Yao K, Vandeputte M, Gutierrez J, Le Bail PY. Differential expression of two GH receptor mRNAs following temperature change in rainbow trout (Oncorhynchus mykiss) J Endocrinol. 2006;190:29–37. doi: 10.1677/joe.1.06695. [DOI] [PubMed] [Google Scholar]
  22. Gharbi K, Murray BW, Moghadam HK, Ferguson MM, Wright PA, Danzmann RG. Genome organization of glutamine synthetase genes in rainbow trout (Oncorhynchus mykiss) Cytogenet Genome Res. 2007;116:113–115. doi: 10.1159/000097428. [DOI] [PubMed] [Google Scholar]
  23. Ghiretti AE, Paradis S. The GTPase Rem2 regulates synapse development and dendritic morphology. Dev Neurobiol. 2010;71:374–389. doi: 10.1002/dneu.20868. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Guo B, Tong C, He S. Sox genes evolution in closely related young tetraploid cyprinid fishes and their diploid relative. Gene. 2009;439:102–112. doi: 10.1016/j.gene.2009.02.016. [DOI] [PubMed] [Google Scholar]
  25. Hansson MC, Hahn ME. Functional properties of the four Atlantic salmon (Salmo salar) aryl hydrocarbon receptor type 2 (AHR2) isoforms. Aquat Toxicol. 2008;86:121–130. doi: 10.1016/j.aquatox.2007.10.012. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Heidal JR, LaPatra SE, Giles J. Mineralization of the bulbus arteriosus in adult rainbow trout (Oncorhynchus mykiss) J Vet Diagn Invest. 1997;9:213–216. doi: 10.1177/104063879700900222. [DOI] [PubMed] [Google Scholar]
  27. Klein SL, Strausberg RL, Wagner L, Pontius J, Clifton SW, Richardson P. Genetic and genomic tools for Xenopus research: The NIH Xenopus initiative. Dev Dyn. 2002;225:384–391. doi: 10.1002/dvdy.10174. [DOI] [PubMed] [Google Scholar]
  28. Koskinen H, Krasnov A, Rexroad C, Gorodilov Y, Afanasyev S, Mölsä H. The 14-3-3 proteins in the teleost fish rainbow trout (Oncorhynchus mykiss) J Exp Biol. 2004;207:3361–3368. doi: 10.1242/jeb.01165. [DOI] [PubMed] [Google Scholar]
  29. Kranz D, Richter W. Autoradiographic studies on the synthesis of DNA in the cerebellum and medulla oblongata of teleosts of various ages. Z Mikrosk Anat Forsch. 1970;82:264–292. [PubMed] [Google Scholar]
  30. Leone A, Mitsiades N, Ward Y, Spinelli B, Poulaki V, Tsokos M, Kelly K. The Gem GTP-binding protein promotes morphological differentiation in neuroblastoma. Oncogene. 2001;20:3217–3225. doi: 10.1038/sj.onc.1204420. [DOI] [PubMed] [Google Scholar]
  31. Louro R, Nakaya HI, Paguoula AC, Martins EA, da Silva AM, Verjovski-Almeida S, Reis EM. RASL11A, member of a novel small monomeric GTPase gene family, is down-regulated in prostate tumors. Biochem Biophys Res Commun. 2004;316:618–627. doi: 10.1016/j.bbrc.2004.02.091. [DOI] [PubMed] [Google Scholar]
  32. Maguire J, Santoro T, Jensen P, Siebenlist U, Yewdell J, Kelly K. Gem: An induced, immediate early protein belonging to the Ras family. Science. 1994;265:241–244. doi: 10.1126/science.7912851. [DOI] [PubMed] [Google Scholar]
  33. Menuet A, Anglade I, Le Guevel R, Pellegrini E, Pakdel F, Kah O. Distribution of aromatase mRNA and protein in the brain and pituitary of female rainbow trout: Comparison with estrogen receptor alpha. J Comp Neurol. 2003;462:180–193. doi: 10.1002/cne.10726. [DOI] [PubMed] [Google Scholar]
  34. Moghadam HK, Ferguson MM, Danzmann RG. Evidence for Hox gene duplication in rainbow trout (Oncorhynchus mykiss): a tetraploid model species. J Mol Evol. 2005;61:804–818. doi: 10.1007/s00239-004-0230-5. [DOI] [PubMed] [Google Scholar]
  35. Moore CA, Kittilson JD, Ehrman MM, Sheridan MA. Rainbow trout (Oncorhynchus mykiss) possess two somatostatin mRNAs that are differentially expressed. Am J Physiol. 1999;277:R1553–R1561. doi: 10.1152/ajpregu.1999.277.6.R1553. [DOI] [PubMed] [Google Scholar]
  36. Morash AJ, Le Moine CM, McClelland GB. Genome duplication events have led to a diversification in the CPT I gene family in fish. Am J Physiol Regul Integr Comp Physiol. 2010;299:R579–R589. doi: 10.1152/ajpregu.00088.2010. [DOI] [PubMed] [Google Scholar]
  37. Nagler JJ, Cavileer T, Sullivan J, Cyr DG, Rexroad C., 3rd The complete nuclear estrogen receptor family in the rainbow trout: discovery of the novel ERalpha2 and both ERbeta isoforms. Gene. 2007;392:164–173. doi: 10.1016/j.gene.2006.12.030. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Ohsugi M, Cras-Méneur C, Zhou Y, Warren W, Bernal-Mizrachi E, Permutt MA. Glucose and insulin treatment of insulinoma cells results in transcriptional regulation of a common set of genes. Diabetes. 2004;53:1496–1508. doi: 10.2337/diabetes.53.6.1496. [DOI] [PubMed] [Google Scholar]
  39. Ostbye TK, Wetten OF, Tooming-Klunderud A, Jakobsen KS, Yafe A, Etzioni S, Moen T, Andersen O. Myostatin (MSTN) gene duplications in Atlantic salmon (Salmo salar): Evidence for different selective pressure on teleost MSTN-1 and -2. Gene. 2007;403:159–169. doi: 10.1016/j.gene.2007.08.008. [DOI] [PubMed] [Google Scholar]
  40. Østergaard AE, Martin SA, Wang T, Stet RJ, Secombes SJ. Rainbow trout (Oncorhynchus mykiss) possess multiple novel immunoglobulin-like transcripts containing either an ITAM or ITIMs. Dev Comp Immunol. 2009;33:525–532. doi: 10.1016/j.dci.2008.10.002. [DOI] [PubMed] [Google Scholar]
  41. Ott R, Zupanc GK, Horschke I. Long-term survival of postembryonically born cells in the cerebellum of gymnotiform fish, Apteronotus leptorhynchus. Neurosci Lett. 1997;221:185–188. doi: 10.1016/s0304-3940(96)13322-x. [DOI] [PubMed] [Google Scholar]
  42. Paradis S, Harrar DB, Lin Y, Koon AC, Hauser JL, Griffith EC, Zhu L, Brass LF, Chen C, Greenberg ME. An RNAi-based approach identifies molecules required for glutamatergic and GABAergic synapse development. Neuron. 2007;53:217–232. doi: 10.1016/j.neuron.2006.12.012. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Quezada C, Navarro C, San Martin R, Alvarez M, Molina A, Vera MI. Genomic organization of nucleolin gene in carp fish: evidence for several genes. Biol Res. 2006;39:353–365. doi: 10.4067/s0716-97602006000200017. [DOI] [PubMed] [Google Scholar]
  44. Richards JG, Semple JW, Bystriansky JS, Schulte PM. Na+ / K+-ATPase α-isoform switching in gills of rainbow trout (Oncorhynchus mykiss) during salinity transfer. J Exp Biol. 2003;206:4475–4486. doi: 10.1242/jeb.00701. [DOI] [PubMed] [Google Scholar]
  45. Roberts SB, Goetz FW. Differential skeletal muscle expression of myostatin across teleost species, and the isolation of multiple myostatin isoforms. FEBS Lett. 2001;491:212–216. doi: 10.1016/s0014-5793(01)02196-2. [DOI] [PubMed] [Google Scholar]
  46. Saito M, Li H, Thompson VF, Kunisaki N, Goll DE. Purification and characterization of calpain and calpastatin from rainbow trout, Oncorhynchus mykiss. Comp Biochem Physiol B Biochem Mol Biol. 2007;146:445–455. doi: 10.1016/j.cbpb.2006.10.110. [DOI] [PubMed] [Google Scholar]
  47. Sánchez Alvarado A, Tsonis PA. Bridging the regeneration gap: genetic insights from diverse animal models. Nat Rev Genet. 2006;7:873–884. doi: 10.1038/nrg1923. [DOI] [PubMed] [Google Scholar]
  48. Seu L, Pitt GS. Dose-dependent and isoform-specific modulation of Ca2+ channels by RGK GTPases. J Gen Physiol. 2006;128:605–613. doi: 10.1085/jgp.200609631. [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Shiina T, Dijkstra JM, Shimizu S, Watanabe A, Yanagiya K, Kiryu I, Fujiwara A, Nishida-Umehara C, Kaba Y, Hirono I, Yoshiura Y, Aoki T, Inoko H, Kulski JK, Ototake M. Interchromosomal duplication of major histocompatibility complex class I regions in rainbow trout (Oncorhynchus mykiss), a species with a presumably recent tetraploid ancestry. Immunogenetics. 2005;56:878–893. doi: 10.1007/s00251-004-0755-1. [DOI] [PubMed] [Google Scholar]
  50. Sørensen C, Øverli Ø, Summers CH, Nilsson GE. Social regulation of neurogenesis in teleosts. Brain Behav Evol. 2007;70:239–246. doi: 10.1159/000105487. [DOI] [PubMed] [Google Scholar]
  51. Sørensen C, Bohlin LC, Øverli Ø, Nilsson GE. Cortisol reduces cell proliferation in the telencephalon of rainbow trout (Oncorhynchus mykiss) Physiol Behav. 2011;102:518–523. doi: 10.1016/j.physbeh.2010.12.023. [DOI] [PubMed] [Google Scholar]
  52. Soutschek J, Zupanc GK. Apoptosis in the cerebellum of adult teleost fish, Apteronotus leptorhynchus. Brain Res Dev Brain Res. 1996;97:279–286. doi: 10.1016/s0165-3806(96)00145-9. [DOI] [PubMed] [Google Scholar]
  53. Splingard A, Ménétrey J, Perderiset M, Cicolari J, Regazzoni K, Hamoudi F, Cabanié L, El Marjou A. Biochemical and structural characterization of the gem GTPase. J Biol Chem. 2007;282:1905–1915. doi: 10.1074/jbc.M604363200. [DOI] [PubMed] [Google Scholar]
  54. Suyama E, Kawasaki H, Nakajima M, Taira K. Identification of genes involved in cell invasion by using a library of randomized hybrid ribozymes. Proc Natl Acad Sci USA. 2003;100:5616–5621. doi: 10.1073/pnas.1035850100. [DOI] [PMC free article] [PubMed] [Google Scholar]
  55. Thorgaard GH, Bailey GS, Williams D, Buhler DR, Kaattari SL, Ristow SS, Hansen JD, Winton JR, Bartholomew JL, Nagler JJ, Walsh PJ, Vijayan MM, Devlin RH, Hardy RW, Overturf KE, Young WP, Robison BD, Rexroad C, Palti Y. Status and opportunities for genomics research with rainbow trout. Comp Biochem Physiol B Biochem Mol Biol. 2002;133:609–646. doi: 10.1016/s1096-4959(02)00167-7. [DOI] [PubMed] [Google Scholar]
  56. Vanhove B, Hofer-Warbinek R, Kapetanopoulos A, Hofer E, Bach FH, de Martin R. Gem, a GTP-binding protein from mitogen-stimulated T cells, is induced in endothelial cells upon activation by inflammatory cytokines. Endothelium. 1997;5:51–61. doi: 10.3109/10623329709044158. [DOI] [PubMed] [Google Scholar]
  57. Verleih M, Rebl A, Köllner B, Koryt33 Kotterba G, Anders E, Wimmers K, Goldammer T. Molecular characterization of PRR13 and its tissue-specific expression in rainbow trout (Oncorhynchus mykiss) Fish Physiol Biochem. 2010;36:1271–1276. doi: 10.1007/s10695-010-9407-6. [DOI] [PubMed] [Google Scholar]
  58. Warton K, Foster NC, Gold WA, Stanley KK. A novel gene family induced by acute inflammation in endothelial cells. Gene. 2004;342:85–95. doi: 10.1016/j.gene.2004.07.027. [DOI] [PubMed] [Google Scholar]
  59. Wells A, Houdusse A, de Gunzburg J. Biochemical and structural characterization of the Gem GTPase. J Biol Chem. 2007;282:1905–1915. doi: 10.1074/jbc.M604363200. [DOI] [PubMed] [Google Scholar]
  60. Zakhartsev M, Lucassen M, Kulishova L, Deigweiher K, Smirnova YA, Zinov’eva RD, Muque N, Baklushinskaya I, Pörtner HO, Ozernyuk ND. Differential expression of duplicated LDH-A genes during temperature acclimation of weatherfish Misgurnus fossilis. Functional consequences for the enzyme FEBS J. 2007;274:1503–1513. doi: 10.1111/j.1742-4658.2007.05692.x. [DOI] [PubMed] [Google Scholar]
  61. Zikopoulos B, Kentouri M, Dermon CR. Proliferation zones in the adult brain of a sequential hermaphrodite teleost species (Sparus aurata) Brain Behav Evol. 2001;56:310–322. doi: 10.1159/000047215. [DOI] [PubMed] [Google Scholar]
  62. Zupanc GK, Horschke I. Postembryonic development of the cerebellum in gymnotiform fish. J Comp Neurol. 1995;370:443–464. doi: 10.1002/(SICI)1096-9861(19960708)370:4<443::AID-CNE3>3.0.CO;2-4. [DOI] [PubMed] [Google Scholar]
  63. Zupanc GK. Neurogenesis, cell death and regeneration in the adult gymnotiform brain. J Exp Biol. 1999;202:1435–1446. doi: 10.1242/jeb.202.10.1435. [DOI] [PubMed] [Google Scholar]
  64. Zupanc GK, Hinsch K, Gage FH. Proliferation, migration, neuronal differentiation, and long-term survival of new cells in the adult zebrafish brain. J Comp Neurol. 2005;488:290–319. doi: 10.1002/cne.20571. [DOI] [PubMed] [Google Scholar]
  65. Zupanc GK, Zupanc MM. New neurons for the injured brain: mechanisms of neuronal regeneration in adult teleost fish. Regeneration. 2006;1:207–216. doi: 10.2217/17460751.1.2.207. [DOI] [PubMed] [Google Scholar]

RESOURCES