Abstract
Phosphotriester solid phase methodology on a polyamide support [(1980) Nucleic Acids Research, 8, 1081-1096] has been extended for the rapid synthesis of the tetradecanucleotide, d(AGTTGTTTGTAGTT), the octadecanucleotide, d(GTGGGTTTGGGGCAGGTC), and the heneicosanucleotide, d(GTGCTCTTATCCTCTTGGCTC). Thus, oligodeoxyribonucleotides comparable in size to those obtained by solution synthesis are readily accessible using solid phase techniques. An approach to the purification of the synthetic octadecanucleotide without recourse to high performance liquid chromatography is described.
Full text
PDF












Images in this article
Selected References
These references are in PubMed. This may not be the complete list of references from this article.
- Atherton E., Clive D. L., Sheppard R. C. Letter: Polyamide supports for polypeptide synthesis. J Am Chem Soc. 1975 Oct 29;97(22):6584–6585. doi: 10.1021/ja00855a053. [DOI] [PubMed] [Google Scholar]
- Crea R., Horn T. Synthesis of oligonucleotides on cellulose by a phosphotriester method. Nucleic Acids Res. 1980 May 24;8(10):2331–2348. doi: 10.1093/nar/8.10.2331. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Fritz H. J., Belagaje R., Brown E. L., Fritz R. H., Jones R. A., Lees R. G., Khorana H. G. High-pressure liquid chromatography in polynucleotide synthesis. Biochemistry. 1978 Apr 4;17(7):1257–1267. doi: 10.1021/bi00600a020. [DOI] [PubMed] [Google Scholar]
- Gait M. J., Sheppard R. C. Rapid synthesis of oligodeoxyribonucleotides. II. Machine-aided solid-phase syntheses of two nonanucleotides and an octanucleotide. Nucleic Acids Res. 1977 Dec;4(12):4391–4410. doi: 10.1093/nar/4.12.4391. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Gait M. J., Singh M., Sheppard R. C., Edge M. D., Greene A. R., Heathcliffe G. R., Atkinson T. C., Newton C. R., Markham A. F. Rapid synthesis of oligodeoxyribonucleotides. IV. Improved solid phase synthesis of oligodeoxyribonucleotides through phosphotriester intermediates. Nucleic Acids Res. 1980 Mar 11;8(5):1081–1096. doi: 10.1093/nar/8.5.1081. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Gough G. R., Singleton C. K., Weith H. L., Gilham P. T. Protected deoxyribonucleoside-3' aryl phosphodiesters as key intermediates in polynucleotide synthesis. Construction of an icosanucleotide analogous to the sequence at the ends of Rous sarcoma virus 35S RNA. Nucleic Acids Res. 1979 Apr;6(4):1557–1570. doi: 10.1093/nar/6.4.1557. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Maxam A. M., Gilbert W. Sequencing end-labeled DNA with base-specific chemical cleavages. Methods Enzymol. 1980;65(1):499–560. doi: 10.1016/s0076-6879(80)65059-9. [DOI] [PubMed] [Google Scholar]
- Narang S. A., Bahl C. P., Wu R. Synthesis and cloning of operator DNA of the lac operon of E. coli. Can J Biochem. 1977 Nov;55(11):1125–1133. doi: 10.1139/o77-168. [DOI] [PubMed] [Google Scholar]
- Potapov V. K., Veiko V. P., Koroleva O. N., Shabarova Z. A. Rapid synthesis of oligodeoxyribonucleotides on a grafted polymer support. Nucleic Acids Res. 1979;6(6):2041–2056. doi: 10.1093/nar/6.6.2041. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Sung W. L., Hsiung H. M., Brousseau R., Michniewicz J., Wu R., Narang S. A. Synthesis of the human insulin gene. Part II. Further improvements in the modified phosphotriester method and the synthesis of seventeen deoxyribooligonucleotide fragments constituting human insulin chains B and mini-CDNA. Nucleic Acids Res. 1979 Dec 20;7(8):2199–2212. doi: 10.1093/nar/7.8.2199. [DOI] [PMC free article] [PubMed] [Google Scholar]

