Skip to main content
NCBI home page
Nucleic Acids Research logoLink to Nucleic Acids Research
. 1980 Nov 25;8(22):5423–5426. doi: 10.1093/nar/8.22.5423

The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.

H Hori, S Osawa, K Murao, H Ishikura
PMCID: PMC324311  PMID: 6780979

Abstract

The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria.

Full text

PDF
5423

Selected References

These references are in PubMed. This may not be the complete list of references from this article.

  1. Brownlee G. G., Sanger F., Barrell B. G. Nucleotide sequence of 5S-ribosomal RNA from Escherichia coli. Nature. 1967 Aug 12;215(5102):735–736. doi: 10.1038/215735a0. [DOI] [PubMed] [Google Scholar]
  2. Fox G. E., Woese C. R. 5S RNA secondary structure. Nature. 1975 Aug 7;256(5517):505–507. doi: 10.1038/256505a0. [DOI] [PubMed] [Google Scholar]
  3. Hori H. Molecular evolution of 5S RNA. Mol Gen Genet. 1976 May 7;145(2):119–123. doi: 10.1007/BF00269583. [DOI] [PubMed] [Google Scholar]
  4. Hori H., Osawa S. Evolutionary change in 5S RNA secondary structure and a phylogenic tree of 54 5S RNA species. Proc Natl Acad Sci U S A. 1979 Jan;76(1):381–385. doi: 10.1073/pnas.76.1.381. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Marotta C. A., Varricchio F., Smith I., Weissman S. M. The primary structure of Bacillus subtilis and Bacillus stearothermophilus 5 S ribonucleic acids. J Biol Chem. 1976 May 25;251(10):3122–3127. [PubMed] [Google Scholar]
  6. Nazar R. N., Matheson A. T., Bellemare G. Nucleotide sequence of Halobacterium cutirubrum ribosomal 5 S ribonucleic acid. An altered secondary structure in halophilic organisms. J Biol Chem. 1978 Aug 10;253(15):5464–5469. [PubMed] [Google Scholar]
  7. Nishimura S. Minor components in transfer RNA: their characterization, location, and function. Prog Nucleic Acid Res Mol Biol. 1972;12:49–85. [PubMed] [Google Scholar]
  8. Rubin G. M. Preparation of RNA and ribosomes from yeast. Methods Cell Biol. 1975;12:45–64. doi: 10.1016/s0091-679x(08)60951-6. [DOI] [PubMed] [Google Scholar]
  9. Silberklang M., Prochiantz A., Haenni A. L., Rajbhandary U. L. Studies on the sequence of the 3'-terminal region of turnip-yellow-mosaic-virus RNA. Eur J Biochem. 1977 Feb;72(3):465–478. doi: 10.1111/j.1432-1033.1977.tb11270.x. [DOI] [PubMed] [Google Scholar]

Articles from Nucleic Acids Research are provided here courtesy of Oxford University Press

RESOURCES