Abstract
Culex tarsalis Coquillett (Diptera: Culicidae) is a highly efficient arbovirus vector. Spatial and temporal heterogeneity have been observed in Cx. tarsalis for phenotypic traits including autogeny, virus susceptibility and host preference. Genetic differences between populations may in part explain these observations. Using the M13-tailed primer method, we identified 45 novel polymorphic microsatellite markers from microsatellite-enriched Cx. tarsalis genomic libraries. The M13-tailed primer method was more efficient in identifying useful loci than traditional screening by acrylamide gel electrophoresis. These markers will be useful for investigating genetic questions in this important vector mosquito.
Keywords: Culex tarsalis, microsatellites, disease vector, mosquito, West Nile Virus, genetic marker
Culex tarsalis Coquillett (Diptera: Culicidae) is an important North American arboviral vector of West Nile Virus (WNV), Western Equine Encephalitis Virus (WEEV) and St. Louis Encephalitis Virus (SLEV) (Reeves and Milby 1990, Goddard et al. 2002; 2003, Reisen 2003). Spatial variation in the ability of wild Cx. tarsalis populations to transmit WNV orally and vertically has been documented (Goddard et al. 2002; 2003). Several recent QTL studies have linked pathogen susceptibility in mosquito vectors to within-species genetic variation, such as in Aedes aegypti and dengue virus and Anopheles gambiae and Plasmodium falciparum (Menge et al. 2006, Bennett et al 2005, Gomez-Machorro et al. 2004). The contribution of genetic differences among Cx. tarsalis populations to variations in arboviral susceptibility is currently unknown. We previously identified 12 Cx. tarsalis microsatellites as part of an ongoing effort to develop markers suitable for genetic studies in this mosquito (Rasgon et al. 2006). Here, we report the use of an optimized marker screening process to identify 45 new polymorphic microsatellite loci in the Cx. tarsalis genome. Together with previous work, this set of 57 markers provides a suite of tools that can be used to characterize genetic structure and investigate relationships between genetic and phenotypic variation in Cx. tarsalis.
Wild adult Cx. tarsalis were collected from Adams, County, Nebraska using CDC light traps, placed into 100% ethanol and transported to the Johns Hopkins Bloomberg School of Public Health. Genomic DNA was extracted by salt extraction/ethanol precipitation as previously described (Rasgon and Scott 2003). Construction of four Cx. tarsalis microsatellite-enriched genomic libraries (AC, AG, CAG and ATG) has been described previously (Rasgon et al. 2006). From each library, we randomly picked and sequenced 10-30 clones. Plasmid DNA was isolated using Qiaprep columns (Qiagen, Valencia, CA) and inserts sequenced using primer M13F on an ABI PRISM 3100 Avant Genetic Analyzer with BigDye chemistry (Applied Biosystems, Foster City, CA). PCR primers were designed using Primer3 (http://biotools.umassmed.edu/bioapps/primer3_www.cgi). Primers were redesigned up to 2 times for loci that did not amplify consistently.
Four microsatellite loci were PCR-amplified using previously described reaction mixtures and amplification conditions (Rasgon et al. 2006). Reliable amplification for each primer set was confirmed using 1% agarose gel electrophoresis on wild-caught individuals. Forward primers for these four loci were then 5’ labeled with fluorescent HEX or 6-FAM for PCR amplification and assessment of allele sizes on a capillary sequencer (described below).
For the remaining 41 microsatellite loci, we used the M13-tailed primer method (Boutin-Ganache et al. 2001) to label amplicons for visualization on the capillary sequencer. Forward primers were 5’-tailed with the 23 base pair M13 (uni-43) sequence (AGGGTTTTCCCAGTCACGACGTT), such that the entire forward primer would look like 5’-AGGGTTTTCCCAGTCACGACGTTXXXXXXXXXXXXXXXXXXXX-3’, where the X’s denote the microsatellite-specific primer sequence (Table 1). PCR was conducted in 10 μl reactions containing 0.8 units Taq polymerase, 1.0 μl 10X ThermoPol buffer (New England Biolabs, Ipswich, MA), 0.2 mM each dNTP, 1 μM each microsatellite-specific primer, 0.5 uM 5’-fluorescently labeled M13 (uni-43) primer and 0.5 μl template DNA. The M13 (uni-43) primer was 5’-fluorescently tagged with HEX, 6-FAM or NED to facilitate multiplexing. Amplicons were amplified using a PTC-200 Peltier thermocycler (Biorad, Hercules, CA) under the following reaction conditions: 95 °C for 5 min, 10 cycles of 94 °C for 30 s, a primer-specific annealing temperature (see Table 1) for 1 min, and 72 °C for 30 s, 27 cycles of 94 °C for 30 s, 55 °C for 1 min and 72 °C for 30 s, followed by a 10 min extension at 72 °C. Most primers amplified at an annealing temperature of 57 °C. Gradient PCR was used to determine optimal annealing temperatures for primers that failed to amplify at 57 °C.
Table one.
List of identified polymorphic Cx. tarsalis microsatellite loci. Locus names are followed by GenBank accession numbers. N, number of mosquitoes assayed. M13, AGGGTTTTCCCAGTCACGACGTT tail attached to the 5’ end of the forward primer.
| Locus | 5’ Label | Core Repeat | Ta (°C) | Primers | Population | N | No. of alleles | Size Range | Ho | He | P |
|---|---|---|---|---|---|---|---|---|---|---|---|
| CUTA6 | HEX | (AC)n | 60 | F: 5’-ACTCACACCCGATTGTAGAG-’3 | Adams Cty, NE | 16 | 13 | 259-307 | 0.438 | 0.956 | <0.001 |
| DQ682664 | R: 5’-AGCCAGTCAGTCAGTCAGTG-’3 | ||||||||||
| CUTA101 | 6-FAM | (AC)n | 56 | F: 5’-GAGCATTTTGCTGCAATTC-’3 | Adams Cty, NE | 16 | 5 | 91-111 | 0.688 | 0.790 | 0.101 |
| DQ682665 | R: 5’-CGATTTCGCGTGTGAGTT-’3 | ||||||||||
| CUTA105#7 | M13 | (AC)n | 57 | F: 5’-TCGCCTTACTTCCCACAT-’3 | Adams Cty, NE | 18 | 9 | 244-282 | 0.111 | 0.859 | <0.001 |
| DQ682666 | R: 5’-AGGACCCAACAACAGCAC-’3 | ||||||||||
| CUTA109#7 | M13 | (AC)n | 57 | F: 5’-CCATCACATTGAACATCACTT-’3 | Adams Cty, NE | 15 | 13 | 236-288 | 0.600 | 0.947 | <0.001 |
| DQ682667 | R: 5’-CGAGTTGCCGATAGAAGAT-’3 | ||||||||||
| CUTA119 | M13 | (AC)n | 57 | F: 5’-GCAGAGAAAATCGAGTGCATA-’3 | Adams Cty, NE | 18 | 6 | 200-246 | 0.056 | 0.744 | <0.001 |
| DQ682668 | R: 5’-TCCCAAATTAAGTTTACCCATG-’3 | ||||||||||
| CUTA122 | M13 | (AC)n | 57 | F: 5’-CCTACAAACCCGGTGAGAC-’3 | Adams Cty, NE | 15 | 5 | 200-216 | 0.333 | 0.363 | 1.00 |
| DQ682669 | R: 5’-GGGTAAGGGGGATTTCATC-’3 | ||||||||||
| CUTA212 | M13 | (AC)nAT(AC)n | 57 | F: 5’-TTGGTAGACCCAGTGCAGAG-’3 | Adams Cty, NE | 15 | 7 | 235-269 | 0.000 | 0.871 | <0.001 |
| DQ682670 | R: 5’-CCCGTGATTCCCAAATTAAG-’3 | ||||||||||
| CUTA214 | M13 | (AC)n | 57 | F: 5’-TGCTTCTGCAACACCTCTTC-’3 | Adams Cty, NE | 18 | 8 | 229-249 | 0.611 | 0.806 | 0.010 |
| DQ682671 | R: 5’-TGACATCTCCTCCCGTCAG-’3 | ||||||||||
| CUTA216 | M13 | (AC)n | 57 | F: 5’-GTGAGACCTGGACGCTGAC-’3 | Adams Cty, NE | 20 | 5 | 227-237 | 0.200 | 0.319 | 0.015 |
| DQ682672 | R: 5’-GCGCAGTGGCAAAATTAAG-’3 | ||||||||||
| CUTA218 | M13 | (AC)n | 53 | F: 5’-CGCTAAACACACTCGCCTAAG-’3 | Adams Cty, NE | 16 | 7 | 185-263 | 0.313 | 0.815 | <0.001 |
| DQ682673 | R: 5’-TCCACCAGACCGTAAAGTGC-’3 | ||||||||||
| CUTA220 | M13 | (AC)n | 57 | F: 5’-TGAGCACGGGTGAGTTACAC-’3 | Adams Cty, NE | 18 | 9 | 148-168 | 0.667 | 0.852 | 0.124 |
| DQ682674 | R: 5’-CCAATCGACGGGAAATTACA-’3 | ||||||||||
| CUTA221 | M13 | (AC)n | 57 | F: 5’-CAACCCACAGATGAGAAAGAG-’3 | Adams Cty, NE | 16 | 6 | 163-183 | 0.813 | 0.798 | 0.075 |
| DQ682675 | R: 5’-AGCGGTCAGCAAAGTTGTC-’3 | ||||||||||
| CUTA226 | M13 | (AC)n | 57 | F: 5’-CCAGTGTCGAGTTATTGCAC-’3 | Adams Cty, NE | 15 | 19 | 234-286 | 0.733 | 0.975 | 0.002 |
| DQ682676 | R: 5’-CTTCTTCCGCTGTCAATGTC-’3 | ||||||||||
| CUTA229 | M13 | (AC)n | 57 | F: 5’-CGAAAGTAGCAACGGAATCTG-’3 | Adams Cty, NE | 18 | 8 | 225-251 | 0.556 | 0.798 | 0.003 |
| DQ682677 | R: 5’-CATTCCTTTGTTTCAGTGTGC-’3 | ||||||||||
| CUTB6 | M13 | (AG)n | 57 | F: 5’-CAGGGTGCCTTCATTCAC-’3 | Adams Cty, NE | 18 | 17 | 251-323 | 0.389 | 0.962 | <0.001 |
| DQ682678 | R: 5’-CCTCCCCATACAAAATACACA-’3 | ||||||||||
| CUTB12#1 | M13 | (AG)n(TG)n | 57 | F: 5’-TTGCTCTCCTCTCTCTAATCTC-’3 | Adams Cty, NE | 17 | 13 | 243-291 | 0.118 | 0.971 | <0.001 |
| DQ682679 | R: 5’-AGGATGTCCTGGTTCAATC-’3 | ||||||||||
| CUTB101 | M13 | (AG)nGG(AG)nGG(AG)n | 57 | F: 5’-GGGGTTCTTCGTGAGTTC-’3 | Adams Cty, NE | 17 | 8 | 218-246 | 0.529 | 0.873 | 0.013 |
| DQ682680 | R: 5’-AGCAAGCGATTTCCCTAC-’3 | ||||||||||
| CUTB112 | HEX | (AG)n | 56 | F: 5’-AACCCCAGATTCTTAATGGC-’3 | Adams Cty, NE | 16 | 7 | 164-176 | 0.625 | 0.829 | 0.294 |
| DQ682681 | R: 5’-GGAATTGGCTCAAACAACC-’3 | ||||||||||
| CUTB118 | M13 | (AG)n | 57 | F: 5’-TGTTGTTCGTTCGTGTATGTAG-’3 | Adams Cty, NE | 16 | 10 | 207-227 | 0.375 | 0.851 | <0.001 |
| DQ682682 | R: 5’-TTACCCTTGTACCATTCATTTG-’3 | ||||||||||
| CUTB119 | M13 | (AG)nAAA(AG)n | 57 | F: 5’-CTCCTCTTTCCTTCTTCTCACC-’3 | Adams Cty, NE | 16 | 10 | 248-274 | 0.500 | 0.917 | <0.001 |
| DQ682683 | R: 5’-TTGTGGTGGTTTTTTAGTCCTG-’3 | ||||||||||
| CUTB121 | M13 | (AG)n | 57 | F: 5’-AGTGGGGAGATTTGGAGTAG-’3 | Adams Cty, NE | 16 | 9 | 123-143 | 0.563 | 0.831 | 0.004 |
| DQ682684 | R: 5’-GGTCCTTGTAACGATTTCTGT-’3 | ||||||||||
| CUTB122 | M13 | (AG)n | 55 | F: 5’-AGCAGAAGTCCCGCACTC-’3 | Adams Cty, NE | 17 | 7 | 139-205 | 0.765 | 0.843 | 0.007 |
| DQ682685 | R: 5’-AGCAGCACGGTAAAAAACG-’3 | ||||||||||
| CUTB201 | M13 | (AG)nAA(AG)n | 57 | F: 5’-AGGCTTCAACCACCTATCG-’3 | Adams Cty, NE | 15 | 8 | 280-298 | 0.400 | 0.867 | <0.001 |
| DQ682686 | R: 5’-GAACTCCGCTGGTCAGTC-’3 | ||||||||||
| CUTB203 | M13 | (AC)n | 57 | F: 5’-ACGAACGCGAAAGAAGAGAG-’3 | Adams Cty, NE | 16 | 11 | 230-256 | 0.250 | 0.931 | <0.001 |
| DQ682687 | R: 5’-CACACCCGATTGTAGAGTGC-’3 | ||||||||||
| CUTB206 | M13 | (AG)n | 59 | F: 5’-ATGCAAGAAGGCATCGTCA-’3 | Adams Cty, NE | 15 | 12 | 223-267 | 0.133 | 0.966 | <0.001 |
| DQ682688 | R: 5’-GCCTATCCATCAACCAACG-’3 | ||||||||||
| CUTB207 | M13 | (AG)n | 57 | F: 5’-CTAGGGTTGGATTAGATTAG-’3 | Adams Cty, NE | 14 | 7 | 117-133 | 0.143 | 0.749 | <0.001 |
| DQ682689 | R: 5’-TCGTAACAACAATCAGTAC-’3 | ||||||||||
| CUTB210 | M13 | (AG)n | 57 | F: 5’-ACCCACTGTTTGCGTATGAA-’3 | Adams Cty, NE | 16 | 5 | 264-272 | 0.750 | 0.776 | 0.025 |
| DQ682690 | R: 5’-ACACTCACACCACCTTGTGC-’3 | ||||||||||
| CUTB212 | M13 | (AG)n | 57 | F: 5’-TGTCGAGGTGAAACAACCAG-’3 | Adams Cty, NE | 18 | 6 | 148-176 | 0.556 | 0.756 | 0.028 |
| DQ682691 | R: 5’-CCGAACGAAAAGCAAAAGTC-’3 | ||||||||||
| CUTB213 | M13 | (AG)nAA(AG)n | 57 | F: 5’-CGTGGGCAATAACGAACTTT-’3 | Adams Cty, NE | 16 | 12 | 172-212 | 0.688 | 0.877 | 0.021 |
| DQ682692 | R: 5’-AGTAACGGAACCCCAATTCA-’3 | ||||||||||
| CUTB214 | M13 | (AG)n | 57 | F: 5’-GCAGTAGCTGGAACGTGCT-’3 | Adams Cty, NE | 16 | 9 | 165-187 | 0.750 | 0.802 | 0.338 |
| DQ682693 | R: 5’-GCGCATAAAATACACAGCAAA-’3 | ||||||||||
| CUTB218 | M13 | (AG)n | 57 | F: 5’-TGCTGAGGCCGTTTTACC-’3 | Adams Cty, NE | 16 | 15 | 150-214 | 0.188 | 0.976 | <0.001 |
| DQ682694 | R: 5’-CCCTGGAAAAGCATCAAACT-’3 | ||||||||||
| CUTB219 | M13 | (AC)n | 57 | F: 5’-AACGAGCATTGTCCATTGTG-’3 | Adams Cty, NE | 16 | 9 | 162-214 | 0.313 | 0.804 | <0.001 |
| DQ682695 | R: 5’-CACATCCAGCAACTGTCC-’3 | ||||||||||
| CUTB223 | M13 | (AG)n | 57 | F: 5’-CGATATTTTGCTCCCACTTTG-’3 | Adams Cty, NE | 16 | 7 | 153-167 | 0.813 | 0.782 | 0.998 |
| DQ682696 | R: 5’-AACTCCTTCGGGCTACACTG-’3 | ||||||||||
| CUTB228 | M13 | (AG)n | 57 | F: 5’-CATCACCATCAATCGTTTCC-’3 | Adams Cty, NE | 16 | 11 | 143-181 | 0.750 | 0.819 | 0.288 |
| DQ682697 | R: 5’-GAAAACTTCCGGCACACAC-’3 | ||||||||||
| CUTC102 | M13 | (ATG)nCTG(ATG)n | 57 | F: 5’-GGAACCACAATCATCATAACC-’3 | Adams Cty, NE | 18 | 8 | 256-292 | 0.611 | 0.827 | 0.098 |
| DQ682698 | R: 5’-GCAACAAACGAATCTTAGAAAC-’3 | ||||||||||
| CUTC201 | M13 | (ATG)n | 57 | F: 5’-GCGAACTTTGTGCTTCGAC-’3 | Adams Cty, NE | 16 | 4 | 246-255 | 0.563 | 0.700 | 0.734 |
| DQ682699 | R: 5’-ATCATCATCCTTCCCACCAG-’3 | ||||||||||
| CUTC203 | M13 | (ATG)n | 57 | F: 5’-AGGCCATGCAACATCCTTAC-’3 | Adams Cty, NE | 16 | 9 | 200-224 | 0.813 | 0.869 | 0.718 |
| DQ682700 | R: 5’-CGACTTTATCTAGGCGCTCTC-’3 | ||||||||||
| CUTD5#7 | M13 | (CAG)n | 57 | F: 5’-GTAGGTATTGGACGACTGTGTC-’3 | Adams Cty, NE | 18 | 3 | 169-178 | 0.111 | 0.162 | 1.000 |
| DQ682701 | R: 5’-GCACTACAACGGCAACAAT-’3 | ||||||||||
| CUTD10 | M13 | (CAG)n | 57 | F: 5’-GGTCTTCTTTTCAGACAACCAC-’3 | Adams Cty, NE | 15 | 5 | 214-232 | 0.267 | 0.710 | <0.001 |
| DQ682702 | R: 5’-CGTTCATGTTGATGTTGAAGTT-’3 | ||||||||||
| CUTD102 | M13 | (CAG)nCAACAGCAA(CAG)n | 60 | F: 5’-CAGTTCCAGCAGCAGTCA-’3 | Adams Cty, NE | 16 | 4 | 117-142 | 0.250 | 0.290 | 1.000 |
| DQ682703 | R: 5’-CAGGTGATGGGGGTGTAG-’3 | ||||||||||
| CUTD104 | HEX | (CAG)nCAA(CAG)n(CAA)n | 60 | F: 5’-CGCCAGTAACCAGATTATGC-’3 | Adams Cty, NE | 16 | 9 | 124-155 | 0.938 | 0.833 | 0.546 |
| DQ682704 | R: 5’-GTTGTTGTGATTGTTGCTGTGT-’3 | ||||||||||
| CUTD203 | M13 | (CAG)nCAC(CAG)nCAA(CAG)n | 57 | F: 5’-TATCCGGCAGCAGAACTTG-’3 | Adams Cty, NE | 16 | 4 | 224-236 | 0.375 | 0.726 | 0.017 |
| DQ682708 | R: 5’-ACAAGCACCACAGCAAACTG-’3 | ||||||||||
| CUTD206 | M13 | (CAG)n | 57 | F: 5’-CCCACCACTCATCTCAACC-’3 | Adams Cty, NE | 16 | 3 | 227-233 | 0.375 | 0.331 | 1.000 |
| DQ682705 | R: 5’-TGCTGCTGAAGGATTTGC-’3 | ||||||||||
| CUTD211 | M13 | (CAG)n | 57 | F: 5’-TTCTGTTGTTGGGATTGCTG-’3 | Adams Cty, NE | 17 | 6 | 261-276 | 0.118 | 0.873 | <0.001 |
| DQ682706 | R: 5’-GTCCGCACCCTGAATTGTA-’3 | ||||||||||
| CUTD213 | M13 | (CAG)nCAA(CAG)n | 57 | F: 5’-CAACGGTAAACAGCACGA-’3 | Adams Cty, NE | 16 | 3 | 225-232 | 0.125 | 0.181 | 1.000 |
| DQ682707 | R: 5’-GTTTTCATTCACAGCCCACA-’3 |
Mosquitoes from Adams County, NE (N = 15-20) were assayed for allelic variation on an ABI-3100 Avant capillary sequencer (Applied Biosystems, Foster City, CA). Allele sizes were automatically determined using GeneScan v. 3.7 with an internal ROX-500 size standard (Applied Biosystems). Deviations from Hardy-Weinberg expectation (HWE) were calculated with exact tests using Arlequin software (Schneider et al. 2000). Linkage disequilibrium (LD) between all pairs of loci was calculated using GenePop (Raymond and Rousset 1995) with a Bonferroni correction for multiple tests.
We designed primers for 83 identified unique microsatellite-containing sequences. Twenty-two never amplified consistently despite primer redesign. Of the remaining 61 potential loci, 12 appeared to be multi-copy and 4 were not polymorphic, and were not investigated further. The remaining 45 loci were polymorphic. Allele number ranged between 3 and 20. Sixteen loci were in HWE. The remaining loci showed evidence of heterozygote deficiency, likely due to the presence of null alleles (Table 1). Significant linkage disequilibrium was detected between loci CUTB101 and CUTB219.
We found the M13-tailed primer method to be a highly efficient protocol to isolate microsatellite markers from Cx. tarsalis. Due to the expense of purchasing individually-labeled primers for all putative loci, in our previous study we used acrylamide gel electrophoresis to identify promising markers prior to their resolution on the capillary sequencer (Rasgon et al. 2006). In this study, the use of fluorescently-labeled M13-tailed primers allowed us to eliminate the acrylamide step and economically screen all primer sets directly on the capillary sequencer. At a fraction of the cost, we were able to generate almost 4 times as many usable markers in approximately one third the time compared to our previous study. The tailed primer method facilitates sequencer multiplexing for economical marker resolution, as the fluorescent label can be changed at will. While we did not do so in this report, it is also possible to use different primer tail sequences to conduct multiplexed PCR of multiple loci simultaneously (Missiaggia and Grattapaglia 2006).
The ecology and population dynamics of Cx. tarsalis have been well studied (Reisen et al. 1992; Reisen and Lothrop 1995; Reisen et al. 1995; Reisen et al. 1996), but genetic studies have been lacking due to the absence of genetic markers and tools for this mosquito. In concert with our previous efforts, we have developed a suite of 57 microsatellite loci that can be used to investigate the genetics of Culex tarsalis. We anticipate that these markers will be highly useful for the medical entomology community for conducting population genetic and mapping studies (Black et al. 2002) in Cx. tarsalis and possibly other Culex species.
Acknowledgments
We thank Wayne Kramer for providing mosquito specimens, Catherine Westbrook for laboratory assistance and an anonymous reviewer for helpful comments on the manuscript. Funding was provided by the Johns Hopkins Malaria Research Institute (JLR) and NIEHS Training Grant ES07141 (MV).
References
- Bennett KE, Flick D, Fleming KH, Jochim R, Beaty BJ, Black WC., IV Quantitative trait loci that control dengue-2 virus dissemination in the mosquito Aedes aegypti. Genetics. 2005;170:185–94. doi: 10.1534/genetics.104.035634. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Black WC, IV, Bennett KE, Gorrochotegui-Escalante N, Barillas-Mury CV, Fernandez-Salas I, de Lourdes Munoz M, Farfan-Ale JA, Olson KE, Beaty BJ. Flavivirus susceptibility in Aedes aegypti. Archives of Medical Research. 2002;33:379–388. doi: 10.1016/s0188-4409(02)00373-9. [DOI] [PubMed] [Google Scholar]
- Boutin-Ganache I, Raposo M, Raymond M, Deschepper CF. M13-tailed primers improve the readability and usability of microsatellite analyses performed with two different allele-sizing methods. Biotechniques. 2001;31:25–28. [PubMed] [Google Scholar]
- Goddard LB, Roth AE, Reisen WK, Scott TW. Vector competence of California mosquitoes for West Nile virus. Emerging Infectious Diseases. 2002;8:1385–1391. doi: 10.3201/eid0812.020536. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Goddard LB, Roth AE, Reisen WK, Scott TW. Vertical transmission of West Nile Virus by three California Culex (Diptera: Culicidae) species. Journal of Medical Entomology. 2003;40:743–746. doi: 10.1603/0022-2585-40.6.743. [DOI] [PubMed] [Google Scholar]
- Gomez-Machorro C, Bennett KE, del Lourdes Munoz M, Black WC., IV Quantitative trait loci affecting dengue midgut infection barriers in an advanced intercross line of Aedes aegypti. Insect Molecular Biology. 2004;13:637–48. doi: 10.1111/j.0962-1075.2004.00522.x. [DOI] [PubMed] [Google Scholar]
- Menge DM, Zhong D, Guda T, Gouagna L, Githure J, Beier J, Yan G. Quantitative trait loci controlling refractoriness to Plasmodium falciparum in natural Anopheles gambiae mosquitoes From a malaria-endemic region in Western Kenya. Genetics. 2006;173:235–41. doi: 10.1534/genetics.105.055129. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Missiaggia A, Grattapaglia D. Plant microsatellite genotyping with 4-color fluorescent detection using multiple-tailed primers. Genetics and Molecular Research. 2006;5:72–78. [PubMed] [Google Scholar]
- Rasgon JL, Venkatesan M, Westbrook CJ, Hauer MC. Polymorphic microsatellite loci from the West Nile Virus vector Culex tarsalis. Molecular Ecology Notes. 2006 doi: 10.1111/j.1471-8286.2006.01303.x. Published online May 23, 2006. [DOI] [Google Scholar]
- Rasgon JL, Scott TW. Wolbachia and cytoplasmic incompatibility in the California Culex pipiens species complex: Parameter estimates and infection dynamics in natural populations. Genetics. 2003;165:2029–2038. doi: 10.1093/genetics/165.4.2029. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Raymond M, Rousset F. Genepop (version 1.2): Population genetics software for exact tests and ecumenicism. Journal of Heredity. 1995;86:248–249. [Google Scholar]
- Reeves WC, Milby MM. Natural Infection in Arthropod Vectors. In: Reeves WC, editor. Epidemiology and control of mosquito-borne arboviruses in California, 1943-1987. California Mosquito and Vector Control Association; Sacramento CA: 1990. pp. 128–143. [Google Scholar]
- Reisen WK, Milby MM, Meyer RP. Population dynamics of adult Culex mosquitoes (Diptera: Culicidae) along the Kern River, Kern County, California, in 1990. Journal of Medical Entomology. 1992;29:531–543. doi: 10.1093/jmedent/29.3.531. [DOI] [PubMed] [Google Scholar]
- Reisen WK, Lothrop HD. Population ecology and dispersal of Culex tarsalis (Diptera: Culicidae) in the Coachella Valley of California. Journal of Medical Entomology. 1995;32:490–502. doi: 10.1093/jmedent/32.4.490. [DOI] [PubMed] [Google Scholar]
- Reisen WK, Lothrop HD, Hardy JL. Bionomics of Culex tarsalis (Diptera: Culicidae) in relation to arbovirus transmission in southeastern California. Journal of Medical Entomology. 1995;32:316–327. doi: 10.1093/jmedent/32.3.316. [DOI] [PubMed] [Google Scholar]
- Reisen WK, Hardy JL, Presser SB, Chiles RE. Seasonal variation in the vector competence of Culex tarsalis (Diptera:Culicidae) from the Coachella Valley of California for western equine encephalomyelitis and St. Louis encephalitis viruses. Journal of Medical Entomology. 1996;33:433–437. doi: 10.1093/jmedent/33.3.433. [DOI] [PubMed] [Google Scholar]
- Reisen WK. Epidemiology of St. Louis encephalitis virus. Advances in Virus Research. 2003;61:139–183. doi: 10.1016/s0065-3527(03)61004-3. [DOI] [PubMed] [Google Scholar]
- Schneider S, Roessli D, Excoffier L. Arlequin: a software for population genetics data analysis, version 2.000. Genetics and Biometry Lab, University of Geneva; Switzerland: 2000. [Google Scholar]