Skip to main content
UKPMC Funders Author Manuscripts logoLink to UKPMC Funders Author Manuscripts
. Author manuscript; available in PMC: 2012 Jul 1.
Published in final edited form as: J Immunol. 2011 Nov 30;188(1):37–46. doi: 10.4049/jimmunol.1002777

Indoleamine 2,3-dioxygenase (IDO) and Treg Support are Critical for CTLA4Ig-Mediated Long-term Solid Organ Allograft Survival

Robert Sucher *, Klaus Fischler *, Rupert Oberhuber *, Irmgard Kronberger *, Christian Margreiter *, Robert Ollinger *, Stefan Schneeberger *, Dietmar Fuchs †, Ernst R Werner †, Katrin Watschinger †, Bettina Zelger ‡, George Tellides §, Nina Pilat , Johann Pratschke *, Raimund Margreiter *, Thomas Wekerle , Gerald Brandacher *
PMCID: PMC3249458  EMSID: UKMS40279  PMID: 22131334

Abstract

Co-stimulatory blockade of CD28-B7 interaction with CTLA4Ig is a well-established strategy to induce transplantation tolerance. Although previous in vitro studies suggest that CTLA4Ig up-regulates expression of the immunoregulatory enzyme indoleamine 2,3-dioxygenase (IDO) in dendritic cells, the relationship of CTLA4Ig and IDO in in vivo organ transplantation remains unclear. Here we studied if concerted immunomodulation in vivo by CTLA4Ig depends on IDO. C57BL/6 recipients receiving a fully MHC-mismatched BALB/c heart graft treated with CTLA4Ig + donor specific transfusion (DST) showed indefinite graft survival [>100 days] without signs of chronic rejection or donor specific antibody formation. Recipients with long-term surviving grafts had significantly higher systemic IDO activity as compared to rejectors, which markedly correlated with intragraft IDO and Foxp3 levels. IDO inhibition with 1-methyl-DL-tryptophan, either at transplant or at POD 50, abrogated CTLA4Ig+DST-induced long-term graft survival. Importantly, IDO1 knock-out recipients experienced acute rejection and graft survival comparable to controls. In addition, αCD25 mAb-mediated depletion of Tregs resulted in decreased IDO activity and again prevented CTLA4Ig+DST induced indefinite graft survival. Our results suggest that CTLA4Ig-induced tolerance to murine cardiac allografts is critically dependent on synergistic cross-linked interplay of IDO and Tregs. These results have important implications for the clinical development of this co-stimulatory blocker.

INTRODUCTION

Despite recent advances in immunosuppressive drug and protocol development, long-term side effects are still a major problem after solid organ transplantation. Therefore there is a continued search to develop alternative immunosuppressive approaches to more selectively regulate the alloimmune response and hence limit systemic toxicities. However, the ultimate goal and “holy grail” remain strategies to induce immune tolerance, defined as donor antigen-specific unresponsiveness without the need for lifelong immunosuppression (1).

In this regard, an increased understanding of the molecular pathways involved in antigen presentation and T-cell activation has provided various novel targets for therapeutic intervention in transplantation over the past decade. One of the most promising approaches identified was blockade of T-cell co-stimulatory pathways such as the CD28-B7 pathway. Cytotoxic T-lymphocyte-associated antigen-4 immunoglobulin (CTLA4Ig) is an engineered fusion protein comprised of the extracellular human or murine domain of CTLA4 and the hinge CH2 and CH3 domains of a human or mouse IgG that binds to B7 molecules with high affinity thus preventing CTLA4-CD28 engagement and leading to partial T-cell activation and T-cell anergy (2).

Co-stimulatory blockade by use of CTLA4Ig with or without the concomitant administration of donor cells has been demonstrated as a promising strategy to prevent acute and chronic rejection and to induce tolerance in various small and large animal models (3, 4). Recently a novel mutant of CTLA4Ig, LEA29Y, with increased binding affinity to B7 has been generated and successfully introduced into human trials with favorable results (5).

However, the mechanistic and molecular basis of CTLA4Ig function in solid organ transplantation remains poorly understood. For the particular case of islet cell transplantation Grohmann et al. proposed that the immunomodulatory enzyme indoleamine 2,3-dioxygenase (IDO) is the mediator of CTLA4Ig-induced tolerance via reverse B7 signaling in DCs (6). In addition, Mellor et al. published a series of papers describing the effects of CTLA4Ig administration on IDO induction in a subset of splenic DCs that led to T-cell suppression in vivo (7-9). IDO is induced in various cell types and tissues by cytokines such as interferon-γ (IFN-γ) and catalyzes the initial and rate-limiting step in the degradation of the essential amino acid tryptophan (10). Via tryptophan depletion and the production of pro-apoptotic downstream metabolites IDO suppresses adaptive T-cell-mediated immunity and provides the common basis for tolerance induction in pregnancy, autoimmunity, tumor immunosurveillance and transplantation (10-13).

Growing evidence also indicates that IDO contributes to the immunoregulatory effects of CD4+CD25+Foxp3+ T regulatory cells (Treg) (14,15). Treg, which constitutively express CTLA4, have been shown to lead to IDO production by DCs following B7 engagement and thereby facilitate their regulatory function. In addition, co-stimulatory blockade can lead to generation and emergence of Treg and thereby induce a state of tolerance (16). However, if those mechanisms are operative in CTLA4Ig-mediated models of transplantation tolerance to solid organ transplants is currently unknown. Therefore the aim of this study was to investigate if CTLA4Ig-mediated co-stimulatory blockade in vivo depends on and requires both IDO and Treg for its immunosuppressive and pro-tolerogenic action.

MATERIAL AND METHODS

Animals

Male inbred BALB/c and C57BL6 mice weighting 20-25g were obtained from Harlan Winkelmann (Borchen, Germany) and used for transplant experiments. C57BL6IDO1−/− mice were provided by the Department of Surgery, Yale University School of Medicine, New Haven, CT. hCTLA4Ig (abatacept) was generously provided by Bristol-Myers-Squibb (Princton, NJ, USA) and given i.p. for all in vivo experiments. All animals received human care in compliance with the “Principles of Laboratory Animal Care” formulated by the National Society for Medical Research and the “Guide for the Care and Use of Laboratory Animals” prepared by the National Academy of Sciences and published by the National Institutes of Health (NIH Publication No.86-23, revised 1985). All experiments were approved by the Austrian Ministry of Education, Science and Culture (BMWF-66.011/0144-II/10b/2009).

Heterotopic cervical heart transplantation

BALB/c hearts were transplanted heterotopically to C57BL/6 (WT/IDO1−/−) using a modified cuff technique. Graft survival was assessed daily by visual inspection and palpation. Treatment of recipient mice consisted of no treatment, DST (5×106 BALB/c splenocytes i.v. on day 0), CTLA4Ig (0.5 mg i.p. on day 0, 0.25mg on days 2, 4, 6), CTLA4Ig (0.5 mg i.p. on day 0, 0.25mg on days 2, 4, 6) + DST (5×106 splenocytes i.v. on day 0), CTLA4Ig (0.5 mg i.p. on day 0, 0.25mg on days 2, 4, 6) + DST (5×106 splenocytes i.v. on day 0) + 1-MT (200mg, 9 day release pellets implanted on day 0), CTLA4Ig (0.5 mg i.p. on day 0, 0.25mg on days 2, 4, 6) + DST (5×106 splenocytes i.v. on day 0) + 1-MT (200mg, 9 day release pellets implanted on day 50), CTLA4Ig (0.5 mg i.p. on day 0, 0.25mg on days 2, 4, 6) + DST (5×106 splenocytes i.v. on day 0; IDO−/−), anti-CD25mAb (PC61, 0.5 mg i.p. on day −5) + CTLA4Ig (0.5 mg i.p. on day 0, 0.25mg on days 2, 4, 6) + DST (5×106 splenocytes i.v. on day 0). Day 0 is defined as the day of heart transplantation.

Donor specific transfusion

Spleen tissue was fragmented in PBS (PAA Laboratories, Linz, Austria) and red blood cells were lysed using an ACK lysis buffer. Donor specific splenocytes were cultured for 24 hours in RPMI 1640 supplemented with 10% heat-inactivated FCS, 100 U/ml penicillin, 100μg/ml streptomycin, 2mM L-glutamine, 10mM Hepes, 0.1 mM non essential amino acids, 1mM sodium pyruvate and 5 μg/ml Concanavalin A (all from Sigma Aldrich, Vienna, Austria). For donor specific transfusion (DST) 5×106 cells were injected i.v. at the time of transplantation.

Tryptophan and kynurenine measurement

Tryptophan and kynurenine concentrations in serum were determined by reversed-phase high-pressure liquid chromatography (HPLC) on days 0, 5, 10, 15, 100 or at times of allograft rejection as described earlier (17). Briefly, specimens were deproteinized with trichloroacetic acid and were separated on reversed phase C18 material using 0.015 mol/L potassium phosphate buffer (pH 6.4). Tryptophan was monitored by means of its native fluorescence at 285nm excitation and 360nm emission wavelengths; kynurenine was detected by UV-absorption at 365nm wavelength in the same chromatographic run. Finally, kyn/trp was calculated as an indirect estimate of IDO activity by dividing kynurenine concentrations (μmol/L) by tryptophan concentrations (mmol/L).

Histology

Tissues were fixed in 10% neutral buffered formalin and embedded in paraffin. 5-μm sections were stained with hematoxylin and eosin and scored according to the ISHLT rejection score.

Immunohistochemistry

IDO and Foxp3 immunohistochemistry was performed on 4-6μm heart sections. Sections were incubated for 30 min with polyclonal anti-indoleamine 2,3 dioxygenase (cat# ALX-210-432, Enzo Life Sciences, Farmingdale, NY, USA) and Foxp3 (cat# 14-4777-82, Biocare Medical, Concord, California, USA) Antibody. Immunostaining of all mouse tissue specimens was performed using an automated method on the Ventana utilizing the iVIEW DAB indirect biotin streptavidin detection system (Ventana Medical Systems, Inc., Tucson, AZ, USA). Immunoreactivity was semiquantitatively scored in a blinded fashion as follows: 0= no immunostaining in any vessels/cells; 1 = slight immunostaining in few cells or vessels; 2 = slight immunostaining in many cells/vessels or strong staining in a few cells/vessels; 3 = strong immunostaining in many cells/vessels (18).

Quantitative RT-PCR

For real time quantitative PCR, 500 ng of total RNA isolated by aid of the Trizol reagent (Invitrogen) was reverse-transcribed using M-MLV RNAse H-, (Promega), and gene expression quantified in relation to 18S ribosomal RNA using the Taqman-technique in an ABI Prism 7700 Sequence Detector Instrument (Applied Biosystems, Vienna, Austria). Sequences of primers and probes (3′ FAM, 5′-TAMRA label, synthesized by Microsynth, Balgach, Switzerland) were:

  • murine IDO1; primer forward: GGCTTTGCTCTACCACATCCAC, primer reverse: TAGCCACAAGGACCCAGGG, probe: CTGTATGCGTCGGGCAGCTCCA.

  • murine IDO2; primer forward: TCATGCCTTCGATGAGTTCCT, primer reverse: GCATGTAGTCCCTCATTCTGTGTAGA, probe: AGCCAACACTTTCCTTGCAATGCTCAA. 18S RNA; primer forward: CCATTCGAACGTCTGCCCTAT, primer reverse: TCACCCGTGGTCACCATG, probe: ACTTTCGATGGTAGTCGCCGTGCCT.

  • murine GZMB; primer forward: CCCCAATGGGCAAATACTCA, primer reverse: TCACACTCCCGATCCTTCTGT, probe: CACGCTACAAGAGGTTGAGCTGACAG. murine FOXP3; primer forward: TCTACCATTGGTTTACTCGCATGT, primer reverse: TGGCGGATGGCATTCTTC, probe: CGCCTACTTCAGAAACCACCCCGC.

Anti-donor antibodies

Recipient serum obtained at the day of rejection or day100 post transplant was heat inactivated and incubated with recipient- and donor-type thymocytes (which are low in Fc-receptors, reducing background). Binding of serum IgG Abs to thymocytes was detected using FITC-conjugated rat anti-mouse IgG1 and IgG2a/2b (BD Biosciences, Schwechat, Austria) and analysed by flow cytometric analysis.

Statistical analysis

Data were analyzed using Prism 4.0 (GraphPad Software, Inc., San Diego, CA, USA). Statistical significance was determined by a Student’s t test (between 2 groups) or analysis of variance (ANOVA) with a post-hoc test (three ore more groups). Average duration of graft survival presented as the median was analyzed according to the Kaplan-Meier method. The Mantel cox test was used to compare survival curves for different subgroups on univariate analyses. P-values <0.05 were considered statistically significant.

RESULTS

CTLA4Ig plus DST induces indefinite graft survival in a fully MHC-mismatched murine cardiac transplant model

C57BL/6 (H-2b) mice received fully MHC mismatched cardiac allografts from BALB/c (H-2d) donors. As shown in Figure 1A untreated animals showed a median graft survival (MST) of 9 days. Treatment with CTLA4Ig led to significant prolongation of graft survival with occasional long-term survival (MST 41 days). When additional therapy was given in the form of a DST at the time of transplantation, the outcome was further substantially improved, with virtually all animals having indefinite (MST >100 days) graft survival. Long-term survival observed in these animals was not due to DST alone, as mice receiving DST without CTLA4Ig uniformly rejected their grafts with a MST of 10 days comparable to untreated controls.

Figure 1. DST+CTLA4Ig treatment results in long-term allograft survival.

Figure 1

C57BL/6 mice received fully mismatched BALB/c heart allografts. Treatment regimens included (■) no immunosuppression n=12; (□) DST (5×106 splenocytes i.v.) n=11; (□) CTLA4Ig (500μg on day 0 and 250μg on days 2, 4 and 6), n=11; (○) DST + CTLA4Ig n=6. (A) Median graft survival (MST): (■) 9 days; (□) 10 days; (□) 41 days and (○) >100 days; p<0.0001, Mantel Cox Test. (B) Representative H&E images of heart grafts either at time of clinical rejection or po day 100 from DST+CTLA4Ig treated animals (magnification 20x, insert 40x, zoom 4x). (C) ISHLT rejection scores (mean±SD): no IS: 3.83±0.41; DST: 3.0±0.90; CTLA4Ig: 3.67±0.82; DST+CTLA4Ig: 1.67±1.4; (*p<0.001, ANOVA).

To further confirm rejection and to examine the condition of cardiac allografts, we performed histopathological analyses at the time of clinical rejection (loss of palpable heartbeat) or at day 100 after transplantation. Representative images and ISHLT rejection scores are shown in Figure 1B and C. Untreated as well as allografts treated with DST or CTLA4Ig alone showed diffuse, perivascular, or interstitial infiltrates with myocyte damage and focal necrosis. In contrast, DST+CTLA4Ig-treated allografts were notable for the excellent preservation of myocardial histology, and revealed almost no cellular infiltrates on day 100 post transplantation. In addition, DST when added to CTLA4Ig treatment was able to prevent signs of chronic cardiac allograft rejection such as interstitial fibrosis, focal scarring, myointimal proliferation and transplant arteriosclerosis.

CTLA4Ig increases intragraft IDO expression and enzyme activity

Since the role of IDO-mediated tryptophan catabolism in the development of indefinite graft survival in this vascularized transplant model is unknown we assessed IDO protein and gene expression to further elucidate the tolerogenic mechanisms of CTLA4Ig.

First, in order to localize and quantify intragraft expression of IDO all cardiac transplants were stained for IDO. Quantitative IDO expression was calculated as outlined in Material and Methods. Representative images and IDO staining scores (mean±SD) are shown in Figure 2A and B. Untreated controls showed no or minimal IDO expression in the native heart (0.35±0.16), kidney (0.55±0.23) and liver (0.60±0.15) and weak to moderate expression in lymph nodes (0.90±0.28) and spleen (1.10±0.19). In contrast, IDO expression and IDO+ cells were found in all animals upon treatment with CTLA4Ig. However, highest IDO-scores were present in long-term surviving allografts of DST+CTLA4Ig-treated recipients (Figure 2B). IDO was mainly expressed in vascular endothelial cells and cells morphologically similar to APCs such as macrophages and DC identified as larger angular cells. The absolute number of IDO+ cells found in the CTLA4Ig-treated groups was much higher than in grafts from untreated or DST alone treated animals, which showed few or no IDO-expressing cells (Figure 2B). In addition to the high intragraft IDO expression (1.83±0.75), DST+CTLA4Ig treatment resulted in increased IDO expression and staining scores in lymph node (1.33±0.16) and spleen (1.67±0.17) but did not alter baseline expression in the kidney (0.41±0.20) or liver (0.33±0.17). Non-transplanted animals showed upregulation of IDO while treated with CTLA4-Ig but no prolonged increase in IDO expression and activity as opposed to transplant recipients (data not shown). We therefore hypothesize that the graft contributes to a prolonged and maintained increased IDO activity after CTLA4-Ig + DST treatment.

Figure 2. CTLA4Ig induces IDO expression and enzyme activity.

Figure 2

(A) Representative IHC images of intragraft IDO expression are shown in individual treatment groups (magnification 20x, insert 40x, zoom 4x). (B) IDO expression was scored semiquantitatively based on staining intensity and distribution as detailed in Material and Methods. IHC score no IS: 0; DST: 0.17±0.41; CTLA4Ig: 0.83±0.75; DST+CTLA4Ig: 1.83±0.75. Data are presented as mean ± SD; *p< 0.0001, ANOVA. (C) Quantitative real-time PCR (Taqman technology) for intragraft IDO1 (no IS: 2.68e-006±1.41e-006; DST: 1.31e-006±1.10e-006; CTLA4Ig: 1.31e-006±1.09e-006; DST+CTLA4Ig: 1.37e-006±1.18e-006) and IDO2 (no IS: 3.10e-008±1.40e-008; DST: 1.80e-008±1.58e-008; CTLA4Ig: 2.59e-008±1.79e-008; DST+CTLA4Ig: 2.99e-008±2.35e-008) expression; IDO1 expression in syngeneic grafts was 1.47e-007+/-1.05e-007. p=n.s. ANOVA. (D) Changes in IDO activity assessed as serum kyn/trp ratio by HPLC. (■) d0: 1±0.23; d5: 0.94±0.33; d10: 0.51±0.19; (□) d0: 1±0.28; d5: 0.64±0.16; d10: 0.45±0.11; (□) d0: 1±0.49; d5: 1.30±0.15; d10: 0.96±0.48; d15: 0.72±0.31; d100: 0.69±0.28; (○) d0: 1±0.44; d5: 1.76±0.05; d10: 1.79±0.24; d15: 1.63±0.13; d100: 1.26±0.44. Data are given as mean ± SD. *p<0.05.

Notably, qPCR performed for IDO1 and IDO2 showed significant increased levels as compared to syngeneic controls but no significant differences in levels of intragraft gene expression at the day of rejection or endpoint of the study respectively in either experimental group (Figure 2C). Since these analyses were performed with samples taken either at the time of rejection, or on day 100 if no rejection is seen the differences in IDO staining scores and expression may reflect the presence of rejection rather than the direct effect of the treatment. However, despite this limitation the data is in agreement with reports of other groups who have demonstrated that IDO expression increases in grafts during both tolerance and rejection (19, 20).

In addition, to transcriptional regulation, IDO function is subject to signals, which alter enzyme activity without affecting transcription or translation (21). Therefore, we next examined IDO activity by means of serum free tryptophan and kynurenine concentrations, as an indirect estimate of IDO activity/metabolism. Fitting with the immunochemistry data, and as shown in Figure 2D, IDO activity was significantly elevated in the tolerant group receiving CTLA4Ig+DST as early as by day five post transplantation when compared to the other regimens. These differences in IDO activity remained significant throughout the entire observation period. Pretransplant kyn/trp levels did not differ between groups.

IDO inhibition with 1-methyl-DL-tryptophan abrogates tolerogenic effects of CTLA4Ig

IDO has been shown in several in vitro studies to inhibit alloreactive immune responses, yet there is limited in vivo data from solid organ transplant models to support this. To determine whether IDO activity is required for CTLA4Ig+DST-mediated long-term graft survival we next treated allograft recipients with 1-methyl-DL-tryptophan (1-MT), a pharmacological IDO inhibitor. When recipients received 1-MT at the time of transplantation to block IDO activity in vivo, treatment of CTLA4Ig+DST was no longer able to promote long-term graft acceptance and rejection occurred with median survival times comparable to untreated controls (Figure 3A). In addition, when recipients with stable and robust graft function received 1-MT delayed at day 50 after transplantation tolerance was lost and all cardiac grafts rejected promptly (Figure 3A). Survival data were again confirmed by histology (Figure 3B) showing significantly lower ISHLT-scores in grafts from CTLA4Ig+DST treated animals as compared to the other regimens (Figure 3C).

Figure 3. DST+CTLA4Ig-induced long-term graft acceptance depends on IDO activity.

Figure 3

C57BL/6 wt or IDO−/− mice received fully mismatched BALB/c heart allografts. Treatment regimens included (■) no immunosuppression n=12; (○) DST (5×106 splenocytes i.v.) + CTLA4Ig (500μg on day 0 and 250μg on days 2, 4 and 6) n=6; (X) DST+CTLA4Ig+1-MT d0 (200mg/9 day slow release pellets) n=13; (+) DST+CTLA4Ig+1-MT d50 (200mg/9day slow release pellets) n=5; (□) DST+CTLA4Ig (IDO−/−), n=4. (A) Median graft survival times (MST): (■) 9 days; (○) all grafts >100 days; (X) 11 days (+) 58 days and (□) 18 days. p<0.001, Mantel Cox Test. (B and C) Representative H&E images and ISHLT rejection scores of heart grafts from individual treatment groups. No IS: 3.83±0.41; DST+CTLA4Ig: 1.67±1.40; DST+CTLA4Ig+1MT(d0): 3.71±0.40; DST+CTLA4Ig+1MT(d50): 3.75±0.29; DST+CTLA4Ig (IDO−/−): 3.50±0.50. p<0.001, ANOVA. (D) Changes in IDO activity assessed as serum kyn/trp ratio by HPLC. (■) d0: 1±0.23; d5: 0.94±0.33; d10: 0.51±0.19; (○) d0: 1±0.44; d5: 1.76±0.05; d10: 1.79±0.24; d15: 1.63±0.13; d100: 1.26±0.44. (X) d0: 1±0.28; d5: 1.78±0.18; d10: 1.30±0.16; d15: 1.00 (□) all days <0.3. Data are given as mean ± SD. *p<0.05.

Systemic IDO enzyme activity of 1-MT treated animals was significantly lower as compared to the CTLA4Ig+DST treated group (Figure 3D). Inhibition of IDO activity by 1-MT did not result in significant changes of IDO1 and IDO2 gene expression (data not shown). No effect of control placebo pellets on graft survival was observed (data not shown).

In addition to pharmacological IDO inhibition, IDO−/− mice lacking a functional IDO1 gene showed also mean graft survival times comparable to control groups following CTLA4Ig+DST treatment (Figure 3). Systemic IDO activity was almost undetectable (Figure 3D) and grafts from IDO−/− animals did not reveal expression of IDO1 and IDO2 (data not shown).

These in vivo results demonstrate that IDO activity is necessary for both the early induction of long-term allograft survival by CTLA4Ig+DST and for the maintenance phase of graft acceptance mediated by this regimen.

Linked immunomodulation of CTLA4Ig and T regulatory cells

We next investigated the contribution of Treg towards CTLA4Ig-induced long-term graft survival in this model and assessed expression of the Treg specific transcription factor forkhead box protein 3 (Foxp3) by means of IHC and q-PCR. Since Foxp3 expression is unique to Treg, presence of Treg in cardiac allografts should be mirrored by expression of Foxp3. As shown in Figure 4A and B all CTLA4Ig-treated cardiac grafts displayed significantly higher numbers of Foxp3+ Treg as compared to grafts without co-stimulatory blocker treatment (Figure 4 A-C). In addition, nodular infiltrates of Foxp3+ cells were often associated with IDO-positive arterial endothelium. Of note, staining for Foxp3 in grafts from IDO−/− animals despite treatment with CTLA4Ig+DST was rare and revealed scores comparable to untreated controls or animals treated with DST alone (Figure 4A and B).

Figure 4. CTLA4Ig increases intragraft Foxp3+ expression.

Figure 4

(A) Representative IHC images showing intragraft Foxp3 expression in individual treatment groups (magnification 20x, insert 40x, zoom 4x). (B) Foxp3 expression was scored semiquantitatively based on staining intensity and distribution as detailed in Material and Methods. IHC score no IS: 0.50±0.05; DST: 0.83±0.41; CTLA4Ig: 1.67±0.52; DST+CTLA4Ig: 1.50±0.84; DST+CTLA4Ig+1MT: 1.58±0.51; DST+CTLA4Ig (IDO−/−): 0.66±0.51. Data are presented as mean ± SD; *p< 0.01, ANOVA. (C) Quantitative real-time PCR (Taqman technology) for intragraft Foxp3 expression: no IS: 6.55e-007±3.63e-007; DST: 8.18e-007±3.24e-007; CTLA4Ig: 1.67e-006±3.94e-007; DST+CTLA4Ig: 4.01e-006±8.72e-007; DST+CTLA4Ig+1MT: 1.45e-006±6.89e-007; DST+CTLA4Ig (IDO−/−): 3.05e-007±4.07e-008. (D) Intragraft Foxp3/GZMB ratio assessed by qPCR was significantly higher after DST+CTLA4Ig (0.48±0.14) treatment as compared to the other regimens (No IS: 0.015±0.004 DST: 0.025±0.009 and CTLA4Ig: 0.204±0.066); p<0.01, ANOVA.

In addition to IHC staining, total RNA was isolated from cardiac allografts to evaluate for presence or absence of Foxp3 expression. As summarized in Figure 4C, Foxp3 mRNA was significantly elevated in CTLA4Ig+DST-treated allografts but was comparable to background and controls in the other groups with only a slight increase in CTLA4Ig and CTLA4Ig+DST+1MT treated grafts.

To further investigate the hypothesis that Foxp3+ cells are an integral component of CTLA4Ig+DST-treated grafts and are dominant over pathogenic effectors we assessed the intragraft ratio between cytopathic granzyme B (GZMB) expressing effector cells and Foxp3+ protective Treg. Foxp3/GZMB gene expression ratio was significantly higher in the CTLA4Ig+DST group as compared to the other regimens (Figure 4D). These data suggest that there is an increased load in intragraft tolerogenic Treg upon CTLA4Ig+DST treatment.

T regulatory cells are required for CTLA4Ig-mediated indefinite graft survival

With regard to the mechanisms of induction of indefinite graft survival in this model, the observed intragraft accumulation of Foxp3+ Treg and the high expression of IDO by graft endothelial cells and DC indicates an interplay between these two immunoregulatory mechanisms. To test this hypothesis, we next depleted recipient Treg pretransplant using an anti-CD25mAb which resulted in loss of indefinite graft survival and survival times decreased to those of untreated controls (Figure 5A-C). These data demonstrate that following selective pre-transplant depletion of Treg despite unaltered high intragraft expression of IDO, CTLA4Ig+DST was unable to induce long-term graft survival in our model (Figure 5E). Most interestingly, recipients treated with anti-CD25mAb showed considerably less systemic IDO activity as compared to non-Treg-depleted CTLA4Ig+DST-treated animals (Figure 5F). In addition, selective late Treg depletion at po day 50 resulted in loss of indefinite graft survival and rejection following aCD25mAb treatment (Figure 5A). IDO activity significantly dropped after delayed Treg depletion and intragraft IDO expression was found to be significantly decreased (Figure 5 E,F).

Figure 5. CTLA4Ig-mediated indefinite graft survival requires Tregs.

Figure 5

Tregs were depleted in recipient animals using anti-CD25 mAb (500μg i.p. on day −5) prior to DST+CTLA4Ig treatment to test for their requirement for permanent graft acceptance in this model. (A) (▲) rejected their grafts with a MST of 12 days comparable to untreated controls. p=n.s. In addition, late depletion of Tregs at post transplant day 50 (d+50) in CTLA4Ig+DST treated recipients resulted in acute rejection and a MST of 63 days (□). (B) Representative H&E and Foxp3 IHC images of heart grafts from individual treatment groups (magnification 20x, insert 40x, zoom 4x). (C) ISHLT scores: No IS: 3.83±0.41; DST+CTLA4Ig: 1.67±1.40; DST+CTLA4Ig+aCD25mAb (d-5): 3.60±0.42; DST+CTLA4Ig+aCD25mAB (d+50): 3.20± 0.76 (D) Foxp3 IHC expression scores: No IS: 0.50±0.50; DST+CTLA4Ig: 1.50±0.84; DST+CTLA4Ig+aCD25mAb (d-5): 0.33±0.21; DST+CTLA4Ig+aCD25mAB (d+50): 0.42±0.20 (E) IDO IHC expression scores: No IS: 0; DST+CTLA4Ig: 1.83±0.30; DST+CTLA4Ig+aCD25mAb (d-5): 1.83±0.60; DST+CTLA4Ig+aCD25mAB (d+50): 0.25±0.17 (F) IDO activity assessed as serum kyn/trp ratio by HPLC in DST+CTLA4Ig+aCD25mAb (d-5) was statistically not significant different from (■). IDO activity in DST+CTLA4Ig+aCD25mAB (d+50) in contrast showed a significant decrease after Treg depletion as compared to (○). Data in C, D and E are presented as mean ± SD; all p<0.01, ANOVA.

CTLA4Ig Prevents Formation of Donor-reactive alloantibodies (DSA)

It has been previously shown that donor-reactive alloantibodies (DSA) can be generated by long-term renal allograft accepting mice at levels comparable to rejecting heart graft recipients (22). We therefore also tested in the current study for alloantibody persistence and the existence of DSA in serum of recipient animals. However, none, except one animal in the CTLA4Ig alone group developed DSA (Figure 6). This is in line with early findings by Linsley et al. who demonstrated that co-stimulation via B7 is essential for humoral responses to occur and that administration of CTLA4Ig suppressed antibody production (23). CTLA4Ig also prevented the production of alloantibodies in a non-human primate model for islet transplantation and has been shown to prevent development of chronic rejection (24).

Figure 6. Donor-reactive alloantibodies are not induced in DST+CTLA4Ig treated recipients.

Figure 6

Recipient serum obtained at the day of rejection or po day100 in long-term survivors was incubated with recipient- and donor-type thymocytes and analyzed by flow cytometry. Whereas primed B6 control mice showed strong Ab responses (49%) non except for one animal in the CTLA4Ig treated group showed weak DSA formation (2.17%) in either study group.

DISCUSSION

This study demonstrates for the first time mechanistic in vivo evidence that the development of immune regulation and tolerance by CTLA4Ig+DST towards vascularized cardiac allografts requires and depends on a concerted interplay of both IDO activity and Treg in addition to co-stimulatory blockade. It thereby appears, in contrast to previous studies, that CTLA4Ig does not directly activate IDO but rather induces Tregs that require IDO to facilitate long-term graft acceptance.

Multiple groups have demonstrated potent immunosuppressive properties of CTLA4Ig in vivo using various rodent models for transplantation and autoimmunity and results from this study confirm such previous data that CTLA4Ig+DST is a potent and promising means to induce long-term graft survival in fully MHC-mismatched cardiac allografts (23, 25-28).

However, despite the fact that CTLA4 can attenuate T-cell function by mainly three distinct mechanisms: (I) due to its higher avidity to B7 family members (CD80 and CD86) than CD28, CTLA4 can scavenge B7 molecules and thereby preventing them to ligate CD28 (2); (II) CTLA4 can actively inhibit T-cell receptor (TCR)-mediated signals; and (III) via reverse signaling into B7-expressing APCs CTLA4 can induce DC activation, IFN-γ production and finally IDO enzymatic activity, the exact tolerogenic mechanisms of CTLA4Ig still remain unclear. A similar mechanism to surface CTLA4 has been recently shown for a custom made form of a CTLA4Ig fusion protein in the immunologic specific setting of islet transplantation, which lead to transcriptional regulation and expression of IDO through the ligation of cell-surface CD80/CD86 molecules (6). Interestingly/in contrast in this current study using a vascularized solid organ transplant model as well as the clinically available CTLA4Ig antibody abatacept we found significantly increased IDO activity only in recipients receiving CTLA4Ig+DST whereas CTLA4Ig alone did not induce IDO and showed only a trend towards increased enzyme activity as compared to syngeneic controls. This suggests that CTLA4Ig in this model not only does not induce long-term graft survival but also is not able to directly induce IDO.

Localized tryptophan depletion due to IDO is important in inhibiting T-cell proliferation and specific tryptophan catabolites in the kynurenine metabolic pathway act as potent pro-apoptotic agents in T-cells (29). However, despite highly increased IDO expression in CTLA4Ig+DST-treated animals we did not observe an increased rate of apoptosis in these grafts. Our data rather indicate that IDO functions as a downstream mediator for certain tolerogenic effects of CTLA4Ig. In addition to co-stimulatory blockade and delivering inhibitory signals to the T-cell, CTLA4Ig also induced significant intragraft expression and activation of IDO. Subsequently, IDO finally generates an immunoregulatory microenvironment due to tryptophan depletion and production of kynurenine metabolites as well as changes DCs to acquire characteristics that no longer support T-cell activation and inhibit T-cell proliferation (30, 31). Thus, IDO-mediated tryptophan catabolism induced by CTLA4Ig results in an intragraft milieu that is poor in tryptophan, limiting T-cell growth and proliferation and contributes to the immunoregulatory effects of CTLA4Ig in addition to simple blockade of CD28.

The localization of IDO expression is known to be critical for its immunoregulatory effects. Anegon et al. showed that when adenoviral-mediated IDO gene transfer was performed in the graft, survival was significantly prolonged, whereas rejection was not inhibited when IDO gene transfer was performed at a distant site (32). In addition, Thebault et al. recently showed a key role for IFN-γ and IDO in the induction of local immune privilege in allograft tolerance with an interplay between CD4+CD25+Foxp3+ regulatory T cells and graft endothelial cells and Beutelspacher and coworker demonstrated that IDO expression in human EC inhibits allogeneic T-cell responses and induces anergy in alloreactive T-cells (33, 34). In line with these results we found IDO expression and IDO+ cells mainly in vascular EC and APC such as macrophages and DC within the graft upon CTLA4Ig treatment. This furthermore suggests an antigen-specific localized immunoregulatory phenomenon for CTLA4Ig induced IDO rather than a non-specific immunosuppression.

The role of cytokines in the induction of graft acceptance by means of co-stimulatory blockade is complex and still remains incompletely understood. IFN-γ plays an important role in some CTLA4Ig-induced tolerance models and it has been previously shown that IFN-γ is required to permit the graft-prolonging effect of CTLA4Ig+anti-CD154 to occur in skin and heart graft models (35). Moreover, IFN-γ has certain anti-inflammatory and tolerogenic roles in that it enables induced Treg to control alloimmune responses and that transplantation tolerance cannot be induced using co-stimulation blockade in IFN-γ knockout mice (36, 35). However, if these critical effects of IFN-γ towards CTLA4Ig-induced tolerance are mediated via its potent effects as the main activator of IDO warrants further investigation.

Data from this study also demonstrates that IDO activity is required for both the early induction of long-term cardiac allograft survival by CTLA4Ig+DST and for the maintenance phase of indefinite graft survival. In line with these results, IDO has been demonstrated to be critical to maintain graft survival in various models of spontaneous liver and kidney tolerance (37, 38). Laurence et al. found an increase in IDO expression in grafts of spontaneously accepted rat livers and that long-term graft survival was prevented by blocking IDO in the early post transplant period (19). Similar results were reported by Miki et al. in a mouse model of liver tolerance (39). Furthermore, spontaneous renal allograft acceptance was shown to evolve through a series of mechanisms including high intragraft IDO expression, regulatory DC and Treg, which combined facilitated robust tolerogenic immune regulation (37).

Recently Treg have been implicated in tolerance mechanisms involved in solid organ transplant models using treatment with CTLA4Ig and evidence for the in vivo generation of regulatory T-cells by CTLA4Ig has been hypothesized (14, 40). However, if the immunosuppressive effects of CTLA4Ig on T-cell alloresponses in the setting of vascularized solid organ transplants are mediated at least in part through the generation of Treg is still unknown. The finding of significantly increased Foxp3 levels and nodular infiltrates of Foxp3+ cells associated with IDO-positive arterial endothelium in CTLA4Ig+DST treated grafts suggests that at least to some extend the mechanism of action of CTLA4Ig is closely linked and operates in Treg in this model. Activated Treg up-regulate CTLA4 surface expression above the constitutive levels normally expressed by these cells and exposure of activated Treg to DC has been shown to result in IFN-γ and IDO production by the DC (2, 14, 30). In contrast B7-CD28 signals are also important for the homeostasis of CD4+CD25+ Treg and prolonged CTLA4Ig treatment has been shown to lead to depletion of Treg due to decreased IL-2 levels (41, 16). This may not be the case in the present study since only a short course of CTLA4Ig+DST was used to induce indefinite graft survival in this protocol.

Most of these data suggesting a pro-tolerogenic role of IDO, however, were generated in murine models. Whether similar DC subsets and immunoregulatory, mechanisms are also in effect in human DCs still remains controversial. Vacca et al. recently showed that matured human DCs are refractory to induction of IDO by CTLA4Ig and do not inhibit T-cell responses (42). Similarly, studies by Terness showed that human DCs do not suppress T-cell responses even if rendered IDO-positive with IFN-γ (43-45).

However, most strikingly Foxp3 staining and expression in grafts from IDO−/− animals, despite treatment with CTLA4Ig+DST, was rare and revealed scores similar to untreated controls whereas pharmacological inhibition of IDO with 1-MT did not impair the number of Foxp3+ Treg. This might argue for a constitutive requirement of IDO for de novo generation of Treg induced by CTLA4Ig that warrants further investigation.

In addition, previous data have shown that Treg are not only present in lymphoid organs, such as lymph node and spleen, but also infiltrate tolerated allografts where they hold effector cells in check and further reinforce a state of dominant tolerance (46). The high proportion of Foxp3+ Treg found in the grafts of long-term surviving animals in this study indicates also that these cells are actively recruited to or even might be expanded at this site and due to their constitutively high expression of CTLA4 can induce expression of IDO in DCs/ECs and promote tolerance via regulatory feedback loops. This is also substantiated by the fact that late depletion of Tregs with aCD25mAbs in recipients with long-term surviving grafts resulted in acute rejection and graft loss paralleled by a significant decrease in IDO expression and function. Furthermore, the finding of a significant increased Foxp3/GZMB gene expression ratio in the CTLA4Ig+DST group suggest that there is an increased load in intragraft tolerogenic Treg and fits well with previous studies in skin and islet transplant models showing a favorable balance of Foxp3/GZMB ratios towards a regulatory Foxp3+ Treg dominated profile (47, 48).

Therefore Treg may be instrumental within the graft to facilitate a concerted immunoregulatory mechanisms involving IDO to induce indefinite graft survival and are not only an epiphenomenon of this model. This dual IDO and Treg hypothesis for CTLA4Ig-induced long-term graft survival is also not mutually exclusive and there is more and more emerging data that suggest that there is a synergistic, complementary relationship between the two (2, 49). In fact, Treg have been demonstrated to interact with DCs to initiate IDO expression and conversely it has been shown that IDO+ DCs are capable of stimulating development of Treg (33, 50, 51). Immunohistochemistry data in this study clearly demonstrate both Foxp3 and IDO expression in accepted allografts, which is consistent with such a hypothesis of synergism. Similar results have been recently found in a model of spontaneous renal allograft acceptance by Orosz et al. and Thebault et al. showed in a cardiac allograft model that following transfer of Foxp3+ Treg to a secondary irradiated recipient that such cells accumulate in the graft and induce endothelial cell expression of IDO (33, 37). Our data, however, extend such previous findings and suggest that CTLA4Ig initiates and facilitates the interplay between IDO+ cells, Treg and effector cells within the graft microenvironment leading to local immune privilege and long-term graft acceptance.

In conclusion this study reveals that the development of immune regulation and indefinite acceptance by CTLA4Ig+DST towards vascularized cardiac allografts in addition to co-stimulatory blockade depends on both Treg and IDO. CTLA4Ig thereby does not directly activate IDO but induces Foxp3+ Treg that require IDO to mediate their regulatory pro-tolerogenic effects. In addition, these Tregs may serve to amplify or sustain intragraft IDO activity.

ACKNOWLEDGEMENTS

The authors thank Maria Gleisner, Astrid Haara, Petra Loitzl and Nina Madl for expert technical assistance.

GRANT SUPPORT

Funding sources: This work was supported by “Jubiläumsfonds der Österreichischen Nationalbank”(OeNB) Project 12239 (GB) and by the “Austrian Science Fund zur Förderung der wissenschaftlichen Forschung (FWF)” Project 22289 (ERW).

Footnotes

The authors have no conflicting financial interests

REFERENCES

  • 1.Lechler RI, Sykes M, Thomson AW, Turka LA. Organ transplantation-how much of the promise has been realized? Nat Med. 2005;11:605–613. doi: 10.1038/nm1251. [DOI] [PubMed] [Google Scholar]
  • 2.Alegre ML, Fallarino F. Mechanisms of CTLA-4-Ig in tolerance induction. Curr Pharm Des. 2006;12:149–160. doi: 10.2174/138161206775193046. [DOI] [PubMed] [Google Scholar]
  • 3.Larsen CP, Elwood ET, Alexander DZ, Ritchie SC, Hendrix R, Tucker-Burden C, Cho HR, Aruffo A, Hollenbaugh D, Linsley PS, Winn KJ, Pearson TC. Long-term acceptance of skin and cardiac allografts after blocking CD40 and CD28 pathways. Nature. 1996;381:434–438. doi: 10.1038/381434a0. [DOI] [PubMed] [Google Scholar]
  • 4.Kirk AD, Harlan DM, Armstrong NN, Davis TA, Dong Y, Gray GS, Hong X, Thomas D, Fechner JH, Jr, Knechtle SJ. CTLA4-Ig and anti-CD40 ligand prevent renal allograft rejection in primates. Proc Natl Acad Sci U S A. 1997;94:8789–8794. doi: 10.1073/pnas.94.16.8789. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Vincenti F, Larsen C, Durrbach A, Wekerle T, Nashan B, Blancho G, Lang P, Grinyo J, Halloran PF, Solez K, Hagerty D, Levy E, Zhou W, Natarajan K, Charpentier B, Belatacept Study Group Costimulation blockade with belatacept in renal transplantation. N Engl J Med. 2005;353:770–781. doi: 10.1056/NEJMoa050085. [DOI] [PubMed] [Google Scholar]
  • 6.Grohmann U, Orabona C, Fallarino F, Vacca C, Calcinaro F, Falorni A, Candeloro P, Belladonna ML, Bianchi R, Fioretti MC, Puccetti P. CTLA-4-Ig regulates tryptophan catabolism in vivo. Nat Immunol. 2002;3:1097–1101. doi: 10.1038/ni846. [DOI] [PubMed] [Google Scholar]
  • 7.Mellor AL, Baban B, Chandler P, Marshall B, Jhaver K, Hansen A, Koni PA, Iwashima M, Munn DH. Cutting edge: induced indoleamine 2,3 dioxygenase expression in dendritic cell subsets suppresses T cell clonal expansion. J Immunol. 2003;171:1652–1655. doi: 10.4049/jimmunol.171.4.1652. [DOI] [PubMed] [Google Scholar]
  • 8.Mellor AL, Chandler P, Baban B, Hansen AM, Marshall B, Pihkala J, Waldmann H, Cobbold S, Adams E, Munn DH. Specific subsets of murine dendritic cells acquire potent T cell regulatory functions following CTLA4-mediated induction of indoleamine 2,3 dioxygenase. Int Immunol. 2004;16:1391–1401. doi: 10.1093/intimm/dxh140. [DOI] [PubMed] [Google Scholar]
  • 9.Baban B, Hansen AM, Chandler PR, Manlapat A, Bingaman A, Kahler DJ, Munn DH, Mellor AL. A minor population of splenic dendritic cells expressing CD19 mediates IDO-dependent T cell suppression via type I IFN signaling following B7 ligation. Int Immunol. 2005;17:909–919. doi: 10.1093/intimm/dxh271. [DOI] [PubMed] [Google Scholar]
  • 10.Brandacher G, Margreiter R, Fuchs D. Implications of IFN-gamma-mediated tryptophan catabolism on solid organ transplantation. Curr Drug Metab. 2007;8:273–282. doi: 10.2174/138920007780362536. [DOI] [PubMed] [Google Scholar]
  • 11.Liu X, Shin N, Koblish HK, Yang G, Wang Q, Wang K, Leffet L, Hansbury MJ, Thomas B, Rupar M, Waeltz P, Bowman KJ, Polam P, Sparks RB, Yue EW, Li Y, Wynn R, Fridman JS, Burn TC, Combs AP, Newton RC, Scherle PA. Selective inhibition of IDO1 effectively regulates mediators of antitumor immunity. Blood. 2010;115:3520–3530. doi: 10.1182/blood-2009-09-246124. [DOI] [PubMed] [Google Scholar]
  • 12.Hainz U, Obexer P, Winkler C, Sedlmayr P, Takikawa O, Greinix H, Lawitschka A, Pötschger U, Fuchs D, Ladisch S, Heitger A. Monocyte-mediated T-cell suppression and augmented monocyte tryptophan catabolism after human hematopoietic stem-cell transplantation. Blood. 2005;105:4127–4134. doi: 10.1182/blood-2004-05-1726. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Curti A, Trabanelli S, Salvestrini V, Baccarani M, Lemoli RM. The role of indoleamine 2,3-dioxygenase in the induction of immune tolerance: focus on hematology. Blood. 2009;113:2394–2401. doi: 10.1182/blood-2008-07-144485. [DOI] [PubMed] [Google Scholar]
  • 14.Fallarino F, Grohmann U, Hwang KW, Orabona C, Vacca C, Bianchi R, Belladonna ML, Fioretti MC, Alegre ML, Puccetti P. Modulation of tryptophan catabolism by regulatory T cells. Nat Immunol. 2003;4:1206–1212. doi: 10.1038/ni1003. [DOI] [PubMed] [Google Scholar]
  • 15.Jürgens B, Hainz U, Fuchs D, Felzmann T, Heitger A. Interferon-gamma-triggered indoleamine 2,3-dioxygenase competence in human monocyte-derived dendritic cells induces regulatory activity in allogeneic T cells. Blood. 2009;114:3235–3243. doi: 10.1182/blood-2008-12-195073. [DOI] [PubMed] [Google Scholar]
  • 16.Wekerle T, Kurtz J, Bigenzahn S, Takeuchi Y, Sykes M. Mechanisms of transplant tolerance induction using costimulatory blockade. Curr Opin Immunol. 2002;14:592–600. doi: 10.1016/s0952-7915(02)00378-3. [DOI] [PubMed] [Google Scholar]
  • 17.Laich A, Neurauter G, Widner B, Fuchs D. More rapid method for simultaneous measurement of tryptophan and kynurenine by HPLC. Clin Chem. 2002;48:579–581. [PubMed] [Google Scholar]
  • 18.Brandacher G, Perathoner A, Ladurner R, Schneeberger S, Obrist P, Winkler C, Werner ER, Werner-Felmayer G, Weiss HG, Göbel G, Margreiter R, Königsrainer A, Fuchs D, Amberger A. Prognostic value of indoleamine 2,3-dioxygenase expression in colorectal cancer: effect on tumor-infiltrating T cells. Clin Cancer Res. 2006;12:1144–1151. doi: 10.1158/1078-0432.CCR-05-1966. [DOI] [PubMed] [Google Scholar]
  • 19.Laurence JM, Wang C, Park ET, Buchanan A, Clouston A, Allen RD, Mccaughan GW, Bishop GA, Sharland AF. Blocking indoleamine dioxygenase activity early after rat liver transplantation prevents long-term survival but does not cause acute rejection. Transplantation. 2008;85:1357–1361. doi: 10.1097/TP.0b013e31816fc27f. [DOI] [PubMed] [Google Scholar]
  • 20.Beutelspacher SC, Pillai R, Watson MP, Tan PH, Tsang J, McClure MO, George AJ, Larkin DF. Function of indoleamine 2,3-dioxygenase in corneal allograft rejection and prolongation of allograft survival by over-expression. Eur J Immunol. 2006;36:690–700. doi: 10.1002/eji.200535238. [DOI] [PubMed] [Google Scholar]
  • 21.Thomas SR, Salahifar H, Mashima R, Hunt NH, Richardson DR, Stocker R. Antioxidants inhibit indoleamine 2,3-dioxygenase in IFN-gamma-activated human macrophages: posttranslational regulation by pyrrolidine dithiocarbamate. J Immunol. 2001;166:6332–6340. doi: 10.4049/jimmunol.166.10.6332. [DOI] [PubMed] [Google Scholar]
  • 22.Bickerstaff AA, Wang JJ, Pelletier RP, Orosz CG. Murine renal allografts: spontaneous acceptance is associated with regulated T cell-mediated immunity. J Immunol. 2001;167:4821–4827. doi: 10.4049/jimmunol.167.9.4821. [DOI] [PubMed] [Google Scholar]
  • 23.Linsley PS, Wallace PM, Johnson J, Gibson MG, Greene JL, Ledbetter JA, Singh C, Tepper MA. Immunosuppression in vivo by a soluble form of the CTLA-4 T cell activation molecule. Science. 1992;257:792–795. doi: 10.1126/science.1496399. [DOI] [PubMed] [Google Scholar]
  • 24.Adams AB, Shirasugi N, Durham MM, Strobert E, Anderson D, Rees P, Cowan S, Xu H, Blinder Y, Cheung M, Hollenbaugh D, Kenyon NS, Pearson TC, Larsen CP. Calcineurin inhibitor-free CD28 blockade-based protocol protects allogeneic islets in nonhuman primates. Diabetes. 2002;51:265–270. doi: 10.2337/diabetes.51.2.265. [DOI] [PubMed] [Google Scholar]
  • 25.Lin H, Bolling SF, Linsley PS, Wei RQ, Gordon D, Thompson CB, Turka LA. Long-term acceptance of major histocompatibility complex mismatched cardiac allografts induced by CTLA4Ig plus donor-specific transfusion. J Exp Med. 1993;178:1801–1806. doi: 10.1084/jem.178.5.1801. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Akalin E, Chandraker A, Russell ME, Turka LA, Hancock WW, Sayegh MH. CD28-B7 T cell costimulatory blockade by CTLA4Ig in the rat renal allograft model: inhibition of cell-mediated and humoral immune responses in vivo. Transplantation. 1996;62:1942–1945. doi: 10.1097/00007890-199612270-00047. [DOI] [PubMed] [Google Scholar]
  • 27.Shiraishi T, Yasunami Y, Takehara M, Uede T, Kawahara K, Shirakusa T. Prevention of acute lung allograft rejection in rat by CTLA4Ig. Am J Transplant. 2002;2:223–228. doi: 10.1034/j.1600-6143.2002.20306.x. [DOI] [PubMed] [Google Scholar]
  • 28.Bolling SF, Lin H, Wei RQ, Turka LA. Preventing allograft rejection with CTLA4IG: effect of donor-specific transfusion route or timing. J Heart Lung Transplant. 1996;15:928–935. [PubMed] [Google Scholar]
  • 29.Fallarino F, Grohmann U, Vacca C, Bianchi R, Orabona C, Spreca A, Fioretti MC, Puccetti P. T cell apoptosis by tryptophan catabolism. Cell Death Differ. 2002;9:1069–1077. doi: 10.1038/sj.cdd.4401073. [DOI] [PubMed] [Google Scholar]
  • 30.Mellor AL, Munn DH. IDO expression by dendritic cells: tolerance and tryptophan catabolism. Nat Rev Immunol. 2004;4:762–774. doi: 10.1038/nri1457. [DOI] [PubMed] [Google Scholar]
  • 31.Orabona C, Puccetti P, Vacca C, Bicciato S, Luchini A, Fallarino F, Bianchi R, Velardi E, Perruccio K, Velardi A, Bronte V, Fioretti MC, Grohmann U. Toward the identification of a tolerogenic signature in IDO-competent dendritic cells. Blood. 2006;107:2846–2854. doi: 10.1182/blood-2005-10-4077. [DOI] [PubMed] [Google Scholar]
  • 32.Guillonneau C, Hill M, Hubert FX, Chiffoleau E, Hervé C, Li XL, Heslan M, Usal C, Tesson L, Ménoret S, Saoudi A, Le Mauff B, Josien R, Cuturi MC, Anegon I. CD40Ig treatment results in allograft acceptance mediated by CD8CD45RC T cells, IFN-gamma, and indoleamine 2,3-dioxygenase. J Clin Invest. 2007;117:1096–1106. doi: 10.1172/JCI28801. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Thebault P, Condamine T, Heslan M, Hill M, Bernard I, Saoudi A, Josien R, Anegon I, Cuturi MC, Chiffoleau E. Role of IFNgamma in allograft tolerance mediated by CD4+CD25+ regulatory T cells by induction of IDO in endothelial cells. Am J Transplant. 2007;7:2472–2482. doi: 10.1111/j.1600-6143.2007.01960.x. [DOI] [PubMed] [Google Scholar]
  • 34.Beutelspacher SC, Tan PH, McClure MO, Larkin DF, Lechler RI, George AJ. Expression of indoleamine 2,3-dioxygenase (IDO) by endothelial cells: implications for the control of alloresponses. Am J Transplant. 2006;6:1320–1330. doi: 10.1111/j.1600-6143.2006.01324.x. [DOI] [PubMed] [Google Scholar]
  • 35.Konieczny BT, Dai Z, Elwood ET, Saleem S, Linsley PS, Baddoura FK, Larsen CP, Pearson TC, Lakkis FG. IFN-gamma is critical for long-term allograft survival induced by blocking the CD28 and CD40 ligand T cell costimulation pathways. J Immunol. 1998;160:2059–2064. [PubMed] [Google Scholar]
  • 36.Wood KJ, Sawitzki B. Interferon gamma: a crucial role in the function of induced regulatory T cells in vivo. Trends Immunol. 2006;27:183–187. doi: 10.1016/j.it.2006.02.008. [DOI] [PubMed] [Google Scholar]
  • 37.Cook CH, Bickerstaff AA, Wang JJ, Nadasdy T, Della Pelle P, Colvin RB, Orosz CG. Spontaneous renal allograft acceptance associated with “regulatory” dendritic cells and IDO. J Immunol. 2008;180:3103–3112. doi: 10.4049/jimmunol.180.5.3103. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Lin YC, Chen CL, Nakano T, Goto S, Kao YH, Hsu LW, Lai CY, Jawan B, Cheng YF, Tateno C, Yoshizato K. Immunological role of indoleamine 2,3-dioxygenase in rat liver allograft rejection and tolerance. J Gastroenterol Hepatol. 2008;23:243–250. doi: 10.1111/j.1440-1746.2007.05036.x. [DOI] [PubMed] [Google Scholar]
  • 39.Miki T, Sun H, Lee Y, Tandin A, Kovscek AM, Subbotin V, Fung JJ, Valdivia LA. Blockade of tryptophan catabolism prevents spontaneous tolerogenicity of liver allografts. Transplant Proc. 2001;33:129–130. doi: 10.1016/s0041-1345(00)02792-5. [DOI] [PubMed] [Google Scholar]
  • 40.Lee RS, Rusche JR, Maloney ME, Sachs DH, Sayegh MH, Madsen JC. CTLA4Ig-induced linked regulation of allogeneic T cell responses. J Immunol. 2001;166:1572–1582. doi: 10.4049/jimmunol.166.3.1572. [DOI] [PubMed] [Google Scholar]
  • 41.Salomon B, Lenschow DJ, Rhee L, Ashourian N, Singh B, Sharpe A, Bluestone JA. B7/CD28 costimulation is essential for the homeostasis of the CD4+CD25+ immunoregulatory T cells that control autoimmune diabetes. Immunity. 2000;12:431–440. doi: 10.1016/s1074-7613(00)80195-8. [DOI] [PubMed] [Google Scholar]
  • 42.Vacca C, Fallarino F, Perruccio K, Orabona C, Bianchi R, Gizzi S, Velardi A, Fioretti MC, Puccetti P, Grohmann U. CD40 ligation prevents onset of tolerogenic properties in human dendritic cells treated with CTLA-4-Ig. Microbes Infect. 2005;7:1040–1048. doi: 10.1016/j.micinf.2005.03.030. [DOI] [PubMed] [Google Scholar]
  • 43.Terness P, Chuang JJ, Bauer T, Jiga L, Opelz G. Regulation of human auto- and alloreactive T cells by indoleamine 2,3-dioxygenase (IDO)-producing dendritic cells: too much ado about IDO? Blood. 2005;105:2480–2486. doi: 10.1182/blood-2004-06-2103. [DOI] [PubMed] [Google Scholar]
  • 44.Terness P, Chuang JJ, Opelz G. The immunoregulatory role of IDO-producing human dendritic cells revisited. Trends Immunol. 2006;27:68–73. doi: 10.1016/j.it.2005.12.006. [DOI] [PubMed] [Google Scholar]
  • 45.Löb S, Ebner S, Wagner S, Weinreich J, Schäfer R, Königsrainer A. Are indoleamine-2,3-dioxygenase producing human dendritic cells a tool for suppression of allogeneic T-cell responses? Transplantation. 2007;83:468–473. doi: 10.1097/01.tp.0000251646.09702.ec. [DOI] [PubMed] [Google Scholar]
  • 46.Graca L, Cobbold SP, Waldmann H. Identification of regulatory T cells in tolerated allografts. J Exp Med. 2002;195:1641–1646. doi: 10.1084/jem.20012097. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Yang H, Ding R, Sharma VK, Hilaire RS, Lagman M, Li B, Thomas DA, Luo X, Song P, Stauffer C, August P, Suthanthiran M. Hyperexpression of Foxp3 and IDO during acute rejection of islet allografts. Transplantation. 2007;83:1643–1647. doi: 10.1097/01.tp.0000263991.74052.46. [DOI] [PubMed] [Google Scholar]
  • 48.Zheng XX, Sánchez-Fueyo A, Sho M, Domenig C, Sayegh MH, Strom TB. Favorably tipping the balance between cytopathic and regulatory T cells to create transplantation tolerance. Immunity. 2003;19:503–514. doi: 10.1016/s1074-7613(03)00259-0. [DOI] [PubMed] [Google Scholar]
  • 49.Cobbold SP, Adams E, Nolan KF, Regateiro FS, Waldmann H. Connecting the mechanisms of T-cell regulation: dendritic cells as the missing link. Immunol Rev. 2010;236:203–218. doi: 10.1111/j.1600-065X.2010.00913.x. [DOI] [PubMed] [Google Scholar]
  • 50.Fallarino F, Grohmann U, You S, McGrath BC, Cavener DR, Vacca C, Orabona C, Bianchi R, Belladonna ML, Volpi C, Santamaria P, Fioretti MC, Puccetti P. The combined effects of tryptophan starvation and tryptophan catabolites down-regulate T cell receptor zeta-chain and induce a regulatory phenotype in naive T cells. J Immunol. 2006;176:6752–6761. doi: 10.4049/jimmunol.176.11.6752. [DOI] [PubMed] [Google Scholar]
  • 51.Chung DJ, Rossi M, Romano E, Ghith J, Yuan J, Munn DH, Young JW. Indoleamine 2,3-dioxygenase-expressing mature human monocyte-derived dendritic cells expand potent autologous regulatory T cells. Blood. 2009;114:555–563. doi: 10.1182/blood-2008-11-191197. [DOI] [PMC free article] [PubMed] [Google Scholar]

RESOURCES