Abstract
The duodenal ulcer promoting (dupA) gene, located in the plasticity region of Helicobacter pylori, is associated with duodenal ulcer development. dupA was predicted to form a type IV secretory system (T4SS) with vir genes around dupA (dupA cluster). We investigated the prevalence of dupA and dupA clusters and clarified associations between the dupA cluster status and clinical outcomes in the U.S. population. In all, 245 H. pylori strains were examined using PCR to evaluate the status of dupA and the adjacent vir genes predicted to form T4SS, in addition to the status of cag pathogenicity island (PAI). The associations between dupA cluster status and interleukin-8 (IL-8) and IL-12 production were also examined. The presence of dupA and all adjacent vir genes were defined as a complete dupA cluster. Many variations related to the status of dupA and dupA cluster genes were identified. Concurrent H. pylori infection and the presence of a complete dupA cluster increases duodenal ulcer risk compared to H. pylori infection with incomplete dupA cluster or without the dupA gene independent on the cag PAI status (adjusted odds ratio, 2.13; 95% confidence interval, 1.13 to 4.03). Gastric mucosal IL-8 levels were also significantly higher in the complete dupA cluster group than in other groups (P = 0.01). In conclusion, although the causal relationship between the dupA cluster and duodenal ulcer development is not proved, the presence of a complete dupA cluster but not dupA alone, is associated with duodenal ulcer development.
INTRODUCTION
Helicobacter pylori is a highly motile Gram-negative bacterium known to be important in the pathogenesis of gastric ulcer (GU), duodenal ulcer (DU), and gastric cancer (GC) (9, 28, 31). However, individuals with H. pylori infection do not always develop these diseases, and the possibility of an individual with H. pylori infection developing GC throughout his or her lifetime is estimated to be 1 to 3% (31). In addition to host factors and diet, virulence factors of H. pylori, such as cagA, vacA, oipA, babA, hopQ, homA, or homB, are predictors of gastric atrophy, intestinal metaplasia, and severe clinical outcomes (16, 21, 23, 29, 36, 37, 39). Although GC and DU are at the opposite ends of the disease spectrum, H. pylori infection promotes the development of both GC and DU, and most putative H. pylori virulence genes are typically associated with an increased risk of both diseases (36).
The duodenal-ulcer-promoting gene (dupA), located in the plasticity region, is reported to be associated with an increased DU risk and to confer protection against GC development (21). DupA pathogenesis appears to involve the induction of interleukin-8 (IL-8) production in the antrum, leading to antrum-predominant gastritis, a well-recognized characteristic of DU (21). In addition, H. pylori containing intact dupA without frameshift mutation induces IL-12 production from monocytes (12). Recent reviews state a worldwide prevalence of dupA of ca. 50% and confirm that dupA is a risk factor for DU (13, 27). However, several studies have failed to show a significant association between dupA status and gastroduodenal diseases (6, 14, 24). Another study showed that dupA is a risk factor not only for DU but also for GC in some geographic area (3).
Type IV secretion systems (T4SS) are involved in bacterial virulence and horizontal gene transfer (5, 8, 20). Three gene clusters coding for T4SS have been recognized in H. pylori: a protein translocation system encoded by the cag pathogenicity island (PAI) (30), a DNA uptake system encoded by the ComB cluster (17), and an unknown cluster in the plasticity region (19). dupA and virB4, which is one constituent of the T4SS, are highly homologous. A recent study suggested that dupA and the adjacent six vir gene homologues (virB8, virB9, virB10, virB11, virD4, and virD2) in the plasticity region were predicted to form the third T4SS (Fig. 1) (19, 33). At present, the dupA gene and 6 additional vir gene homologues have been observed in three complete H. pylori strain genomes (Shi470, Cuz20, and G27). Recently, a putative T4SS-containing dupA has been named type IV secretion 3a (tfs3a), whereas a putative T4SS containing a virB4 sequence, but not dupA, has been named tfs3b (19). Previous studies investigating the roles of dupA on clinical outcomes did not take care of the adjacent genes of dupA, and this might be the reason for some controversies over the real importance of dupA. Since H. pylori strains containing dupA and other vir gene homologues are in a mosaic pattern (35), we hypothesized that only strains with functional dupA and complete tfs3a are pathogenic and have the same action as the T4SS cluster, similarly to cag PAI and/or ComB.
Fig 1.
Predicted type IV secretion system (T4SS) in the H. pylori plasticity zone. The figure shows the gene arrangement in the plasticity region of H. pylori strains Shi470 and Cuz20, which have complete dupA clusters named tfs3a and a functional dupA gene sequence, in comparison to the corresponding regions of genome sequences of other H. pylori strains (G27, J99, P12, and 26695). Genes encoding the predicted T4SS components are represented by arrows, with frameshift mutations indicated by asterisks. Genes encoding proteins with 90 to 95% sequence similarity to the Shi470 proteins are shown in black, and genes encoding proteins with 50 to 75% sequence similarity are shown in white. Possibly, only H. pylori strains with both a functional dupA gene sequence and a complete tfs3a are pathogenic and have the same action as cag PAI and ComB T4SS.
We investigated the prevalence of dupA and vir gene homologues and the associations between the status of dupA clusters and clinical outcomes in the U.S. population.
MATERIALS AND METHODS
Patients and H. pylori strains.
H. pylori strains were obtained from the gastric mucosa of patients with epigastric discomfort and/or epigastralgia who underwent endoscopy at Michael E. DeBakey Veterans Affairs Medical Center (Houston, TX) between 1995 and 2005. Diagnosis of H. pylori-related gastroduodenal diseases was evaluated using endoscopic examination and histological findings, and diseases were divided into four categories: gastritis (n = 124), DU (n = 61), GU (n = 33), and GC (n = 27). The samples had never been evaluated in previous studies to assess the status of dupA. Gastritis was diagnosed with chronic histological gastritis without development of GU, DU, or GC. None of the patients had received nonsteroidal anti-inflammatory drugs and/or steroids for at least 3 months before endoscopy. No subject had received treatment for H. pylori infection. Written informed consent was obtained from all patients, and protocols were approved by the ethics committee of the Michael E. DeBakey Veterans Affairs Medical Center, Houston, TX.
Status of dupA, vir, and cagA genes.
Antral biopsy specimens were taken for isolation of H. pylori using standard culture methods (38). Chromosomal DNA was extracted from confluent plate cultures expanded from a single colony using a commercially available kit (Qiagen, Inc., Santa Clarita, CA) according to the manufacturer's instructions. Each genotype was determined using a PCR method.
There are no standard primer pairs to detect dupA. Therefore, we used eight PCR primer sets (seven from previous reports and one newly designed) to select the best primer set (Table 1) (2, 3, 10, 21). For this purpose, 28 H. pylori DNA samples (14 from East Asian strains and 14 from Western strains) from the bacteria bank of the Michael E. DeBakey Veterans Affairs Medical Center were randomly selected. H. pylori strain 26695 (ATCC 700392) and strain C142 were used as negative control and positive controls, respectively. PCR amplification was performed using previously described methods (2, 3, 10, 21).
Table 1.
Oligonucleotides primer sets and detection rate of dupA
| Primer set | Sequence (5′–3′) | Sequence mismatch (no. of bp)a | Product size (bp) | Detection of dupAb | Source or reference |
|---|---|---|---|---|---|
| A | TGGTTTCTACTGACAGRGCRC | 1A | 307 | 15/16 (93.8) | 21 |
| AACACGCTRACAGGACAATCYCCC | 1B | ||||
| B | CCTATATCGCTAACGCGCTCGC | 2C | 276 | 14/16 (87.5) | 21 |
| AAGCTGAAGCGTTTGTAACG | 1D | ||||
| C | GACGATTGAGCGATGGGAATAT | 0 | 970 | 15/16 (93.8) | 3 |
| CTGAGAAGCCTTATTATCTTGTTGG | 1E | ||||
| D | TAAAATCACAAGGGGAAAAGATC | 3F | 400 | 13/16 (81.3) | 3 |
| AAGCTGAAGCGTTTGTAACG | 1D | ||||
| E | CGTGATCAATATGGATGCTT | 2F | 214 | 12/16 (75.0) | 10 |
| GCAAAGTGTTCCGTTGATCT | 2G | ||||
| F | ATAGCGATAACCAACAAGAT | 1F | 662 | 14/16 (87.5) | 2 |
| AAGCTGAAGCGTTTGTAACG | 1D | ||||
| G | ATTCACGCCTAAGACCTCA | 0 | 1,115 | 13/16 (81.3) | 2 |
| AAGCTGAAGCGTTTGTAACG | 1D | ||||
| H | ATTCACGCCTAAGACCTCA | 0 | 487 | 15/16 (93.8) | This study |
| CTGAGAAGCCTTATTATCTTGTTGG | 1E |
Superscript letters: A, compared to strains 55c, 96c, and 118du; B, compared to strains 74c, 96c,118du, Shi470, and G27; C, compared to strains 55c, 74c, 96c ,118du, and Shi470; D, compared to strains 74c and 96c; E, compared to strains 96c and118du; F, compared to strains 55c, 74c, 96c,118du, Shi470, and G27; G, compared to strains 55c, 74c, 96c,118du, Shi470, G27, and c142.
Values are expressed as the number detected/the number examined. Percentages are indicated in parentheses.
To investigate the status of several vir genes of the dupA cluster, primer pairs were designed based on 4 published full sequences of H. pylori strains J99, Shi470, G27, and P12 (Table 2). Since some H. pylori should have two other T4SSs (cag PAI and ComB locus), primer specificity was verified by BLAST alignment (http://www.ncbi.nlm.nih.gov) to prevent the amplification of homologous genes in these other loci. The vir genes of virB8, virB9, virB10, virB11, virD4, and virD2 were amplified using primer pairs for each of the vir gene homologues. Positive results for reactions indicated the presence of the gene, whereas negative results were confirmed using primer pairs that could assay two adjacent vir gene homologues (virB8 and virB9, virB9 and virB10, virB10 and virB11, virB11 and virD4, and virD4 and virD2) (Table 2).
Table 2.
Oligonucleotide primers for vir genes in new dupA cluster
| Gene(s) | Sequence (5′–3′) | Product size (bp) | Annealing temp (°C) |
|---|---|---|---|
| virB8 | GCGTGATATGTTACAAAGC | 204 | 50 |
| GTAGCGTTTGAAAAGGTTAC | |||
| virB9 | TTCTTTTGAACATGGCAAAGA | 230 | 56 |
| TGGTAGTCATCGCATAGCG | |||
| virB10 | ACAAGAAATCAAAGAAAAAGC | 285 | 51 |
| TCTTCGTTAGCGGTATTGTA | |||
| virB11 | CCAAAAACGAAAGGGTGGTT | 227 | 58 |
| CATTCCGCTATGCCCAGTAT | |||
| virD4 | CGGCTGGTTACAGACAACAA | 204 | 58 |
| GCTGTGTCCAATGAGGGTCT | |||
| virD2 | CATTCAAAAAAACGCTTTGAG | 267 | 55 |
| CTTTTTCATTTCAAACCTAGCA | |||
| virB8andvirB9 | AGCCAATATTGAAATATCCGC | 1,465 | 57 |
| CTTTCATGGCTTCATCTTGC | |||
| virB9andvirB10 | TGGACTTTAAGGAGCGGTAAG | 1,539 | 58 |
| TCGTCATTTGCATCATCATG | |||
| virB10andvirB11 | CTTACTAGCGGTCTTACCGAA | 1,402 | 56 |
| CTAAAAATGGCTAATTGCTCAC | |||
| virB11andvirD4 | TTCTCAAAGCATTATCAATGC | 1,395 | 55 |
| CACACAAATCATAAAGAGCGT | |||
| virD4andvirD2 | GCTTTTTAAAAATCGCTTTCT | 1,488 | 54 |
| GTAAAGCGCAATTTTTAACAC |
To investigate the status of the cag PAI, we examined the status of seven loci in the cag PAI (four loci in the cag I region—cagA, cagE [virB4], cagG, and cagM—and three loci in the cag II region—cagT, cagY [virB10], and cagB [virD4]) using PCR as previously described (11). PCR for the empty site was performed to confirm the absence of the entire cag PAI (11).
Gastric histology.
Gastric mucosal biopsy specimens were taken from the antrum and body mucosa and fixed in 10% buffered formalin, embedded in paraffin, cut in sequential 4-μm sections, and stained with Genta stain or El-Zimaity triple stain (7). Each specimen obtained from all 245 patients was scored for H. pylori density, the degree of inflammation cell infiltration, intestinal metaplasia, and gastric mucosal atrophy. Each strip of gastric mucosa was scored, and the results were averaged. All variables were graded by using a visual analogue scale graded from 0 (absent/normal) to 5 (maximal intensity).
Mucosal IL-8 and IL-12 levels.
IL-8 and IL-12 levels in the antral biopsy specimens were measured by using an enzyme-linked immunosorbent assay (ELISA; R&D Systems, Minneapolis, MN, for IL-8 and BD Biosciences Pharmingen, San Diego CA, for IL-12p70) according to the manufacturer's instructions (36). Briefly, aliquots of supernatants from homogenized tissues were obtained by centrifugation (10,000 × g for 10 min), and the total protein in the supernatants was measured by using the Bradford assay (Bio-Rad, Richmond, CA). ELISA sensitivities were approximately 5 pg/ml for IL-8 and 10 pg/ml for IL-12. The mucosal levels of the cytokines are expressed as pg/mg of protein in the biopsy specimens.
IL-8 levels from the gastric cancer cell line cultured with H. pylori.
To measure in vitro IL-8 secretion from gastric epithelial cells, the gastric cancer cell line MKN45 (Japanese Cancer Research Resource Bank, Tsukuba, Japan) was plated at 5 × 105/ml into 24-well plates and cultured for 2 days. H. pylori (multiplicity of infection [MOI] of 100) or brain heart infusion broth (negative control) were added to cultured cells for 20 h, and the IL-8 levels in the supernatant were assayed in duplicate using ELISA.
Data analysis.
Statistical differences in demographic characteristics among different disease groups were determined by one-way analysis of variance or the chi-square test. The univariate association between each genotype status and clinical outcomes was quantified by the chi-square test. A multivariate logistic regression model adjusted by H. pylori genotypes was used to calculate the odds ratio (OR) and 95% confidence interval (CI). P values of <0.05 were accepted as statistically significant. Calculations were carried out using the StatView 5.0 statistical software (SAS Institute, Inc., Cary, NC) and SPSS statistical software package version 15.0 (SPSS, Inc., Chicago, IL).
RESULTS
Selection of optimal PCR primer pairs for dupA.
Eight complete sequences of dupA deposited in the GenBank (H. pylori strains J99, Shi470, G27, C142, 118du, 55c, 74c, and 96c) were compared to those of primer pairs we used; most of the primers were found to have sequence mismatches of 1 to 3 bp in the eight sequenced strains (Table 1). Of the randomly selected 28 H. pylori DNA samples, 16 strains (57.1%, 16/28) yielded positive results using at least one of the eight primer pairs, which were regarded as dupA positive in the present study. H. pylori strain 26695 (ATCC 700392) yielded negative results for all eight primer pairs, whereas strain C142 yielded positive results for these primer pairs. The primer pairs A, C, and H detected the dupA status relatively well compared to other primer sets (Table 1). Strains yielding false-negative results using these three primer sets were different from each other. Therefore, we initially used primer set H to assess the presence of dupA; when the result was negative, samples were tested using primer sets A and C.
Characteristics of patients and prevalence of vir gene homologues in the dupA cluster and the cag PAI.
A total of 245 H. pylori-infected patients, including 124 with gastritis, 61 with DU, 33 with GU, and 27 with GC, were enrolled in the present study. Demographic characteristics of patients and distribution of the cag PAI status among each disease are shown in Table 3. There were significant differences in age (P = 0.026) and sex (P < 0.001) among the four disease groups (Table 3). The average age of GC patients was significantly higher than that of those with other diseases. The average age of DU, GU, and GC patients was significantly higher than that of those with gastritis.
Table 3.
Demographic characteristics and prevalence of dupA and vir genes
| Demographic characteristic | Disease groupa |
||||
|---|---|---|---|---|---|
| All | Gastritis | Duodenal ulcer | Gastric ulcer | Gastric cancer | |
| No. of patients | 245 | 124 | 61 | 33 | 27 |
| Mean age (yr) ± SD | 50.8 ± 0.9 | 44.3 ± 1.2 | 53.5 ± 1.6 | 56.6 ± 2.0 | 67.8 ± 1.3 |
| No. male/no. female | 201/44 | 93/31 | 54/7 | 31/2 | 23/4 |
| No. (%) | |||||
| cagA | 207 (84.5) | 96 (77.4) | 55 (90.2)* | 31 (93.9)* | 25 (92.6) |
| Complete cag PAI | 191 (78.0) | 88 (71.0) | 52 (85.2)* | 27 (81.8) | 24 (88.9) |
| Incomplete cag PAI | 18 (7.3) | 10 (8.1) | 3 (4.9) | 4 (12.1) | 1 (3.7) |
| cag PAI negative | 35 (14.3) | 26 (21.0) | 5 (8.2) | 2 (6.0) | 2 (7.4) |
| dupA | 170 (69.4) | 83 (66.9) | 45 (73.8) | 23 (69.7) | 19 (70.4) |
| virB8 | 160 (65.3) | 77 (62.1) | 42 (68.9) | 22 (66.7) | 19 (70.4) |
| virB9 | 142 (58.0) | 65 (52.4) | 42 (68.9)* | 20 (60.6) | 15 (55.6) |
| virB10 | 134 (54.7) | 62 (50.0) | 38 (62.3) | 19 (57.6) | 15 (55.6) |
| virB11 | 145 (59.2) | 71 (57.3) | 40 (65.6) | 19 (57.6) | 15 (55.6) |
| virD4 | 166 (67.8) | 78 (62.9) | 47 (77.0)* | 22 (66.7) | 19 (70.4) |
| virD2 | 157 (64.1) | 76 (61.3) | 45 (73.8) | 20 (60.6) | 16 (59.3) |
| Complete dupA cluster | 116 (47.3) | 51 (41.1) | 37 (60.7)* | 15 (45.5) | 13 (48.1) |
| Incomplete dupA cluster | 54 (22.0) | 32 (25.8) | 8 (13.1) | 8 (24.2) | 6 (22.2) |
| dupA negative | 75 (30.6) | 41 (33.1) | 16 (26.2) | 10 (30.3) | 8 (29.6) |
*, P < 0.05 versus the gastritis group.
The prevalence of genes in the cag PAI was 84.5% (207/245) in cagA, 84.1% in cagE (206/245), 82.9% in cagG (203/245),82.0% in cagM (201/245), 83.3% in cagT (204/245), 82.4% in cagY (202/245), and 83.7% in cagβ (205/245). Overall, 191 strains (78.9%) contained complete cag PAI, 18 (7.3%) had partial deletions within the cag PAI (one or more of the vir genes were missing; incomplete cag PAI), and 35 (14.3%) lacked the entire cag PAI (Table 3).
The prevalence of dupA was 69.4% (170/245) and those of other vir gene homologues were 65.3% in virB8 (160/245), 58.0% in virB9 (142/245), 54.7% in virB10 (134/245), 59.2% in virB11 (145/245), 67.8% in virD4 (166/245), and 64.1% in virD2 (157/245) (Table 3). A total of 116 H. pylori strains (47.3%) possessed all of six vir gene homologues, including dupA, while 46 strains (18.8%) possessed no vir gene homologues. The remaining 83 strains (33.9%) showed various combinations of vir gene homologues while lacking some of vir genes. The prevalence of each vir gene homologues in the dupA cluster was significantly higher in dupA-positive strains than in dupA-negative strains (68.2% versus 0%, P < 0.001). There were some vir gene homologue-positive strains even among the dupA-negative strains. Therefore, we divided homologues into three types according to the combination of dupA and vir gene homologues: (i) the complete dupA cluster group (both positive for dupA and all six vir gene homologues); (ii) the incomplete dupA group (positive for dupA, but positive in only some vir gene homologues); and (iii) the dupA-negative group. We tried to find the key gene to form the complete dupA cluster. However, we could not find the decisive gene for complete dupA cluster.
Correlation between dupA cluster and cag PAI status.
In dupA cluster gene homologues, although there was weak, but significant relationship between the presence of complete cag PAI and virD4 (ϕ = 0.12, P = 0.04), the presence of complete cag PAI did not correlate with dupA (ϕ = 0.08, P = 0.20), virB8 (ϕ = 0.05, P = 0.39), virB9 (ϕ = 0.07, P = 0.24), virB10 (ϕ = 0.07, P = 0.21), virB11 (ϕ = 0.007, P = 0.90), and virD2 (ϕ = −0.08, P = 0.19). There was no correlation between the presence of complete dupA cluster and that of the complete cag PAI (ϕ = 0.08, P = 0.20).
Association between cag PAI and clinical outcomes.
The prevalence of cagA was significantly higher in strains obtained from patients with DU and GU than that from gastritis (90.2 and 93.9 versus 77.4, P = 0.035 and 0.032, respectively) (Table 3). The prevalence of complete cag PAI was 85.2% in strains obtained from patients with DU, which was significantly higher than that in the strain obtained from patients with gastritis (71.0%, P = 0.017). Although the prevalence of a complete cag PAI was high in strains from the patients with GC than that from those with gastritis, the difference did not reach the statistical significance (88.9 versus 71.0%, P = 0.056). There was no difference in the prevalence between GU and gastritis (81.8 versus 71.0%, P = 0.21).
Association between dupA and vir gene homologues and clinical outcomes.
There was no significant association between the presence of dupA and clinical outcome (P > 0.05) (Table 3). However, the prevalences of virB9 and virD4 were significantly higher in strains from DU patients than in those from gastritis patients (P = 0.03 and P = 0.049, respectively). The prevalence of other virB genes (virB8, virB10, virB11, and virD2) was not associated with clinical outcomes.
Interestingly, the prevalence of a complete dupA cluster was significantly higher in strains from the patients with DU than that from those with gastritis (60.7 versus 41.1%, P = 0.012). On the other hand, the prevalence of incomplete dupA cluster was not different between DU and gastritis. The prevalence of a complete dupA cluster was not different between DU and GU or GC. Multivariate analysis, adjusted according to the presence of complete cag PAI, showed that the presence of a complete dupA cluster was an independent risk factor for DU compared to gastritis (adjusted OR = 2.13, 95% CI = 1.13 to 4.03, P = 0.019). However, the prevalence of a complete dupA cluster was similar in strains from patients with GU or GC compared to those with gastritis.
Histological findings of H. pylori density, inflammatory cell infiltration, and atrophy.
Mucosal atrophy in the antrum and the corpus was significantly higher in patients with dupA-positive H. pylori, including H. pylori with complete dupA cluster and incomplete dupA cluster than in patients with dupA-negative strain (P = 0.009 and P = 0.015, respectively), whereas there was no difference between patients infected with H. pylori with either a complete or an incomplete dupA cluster, suggesting that the status of dupA but not dupA cluster is associated with progression of gastric mucosal atrophy in the antrum and in the corpus (Table 4). However, there were no significant differences in the grade of H. pylori density and inflammatory cell infiltration in the antrum and the corpus according to the status of dupA or dupA cluster (Table 4).
Table 4.
Histological differences among each group
| Parameter | Antrum or corpus | Mean ± SDa |
||
|---|---|---|---|---|
| Complete dupA cluster (n = 116) | Incomplete dupA cluster (n = 54) | dupA negative (n = 75) | ||
| H. pylori density | Antrum | 2.36 ± 0.11 | 2.26 ± 0.17 | 2.56 ± 0.13 |
| Corpus | 2.06 ± 0.09 | 2.05 ± 0.14 | 2.16 ± 0.11 | |
| Inflammatory cell infiltration | Antrum | 2.59 ± 0.13 | 2.20 ± 0.18 | 2.56 ± 0.12 |
| Corpus | 1.56 ± 0.12 | 1.72 ± 0.18 | 1.57 ± 0.14 | |
| Atrophy | Antrum | 1.21 ± 0.14* | 1.21 ± 0.15* | 0.74 ± 0.12 |
| Corpus | 0.52 ± 0.10* | 0.49 ± 0.16* | 0.19 ± 0.06 | |
n, number of patients. *, P < 0.05 versus the dupA-negative group.
dupA cluster and cytokines levels.
We randomly selected 27 patients with gastritis infected with the complete cag PAI-positive strains and measured gastric mucosal IL-8 and IL-12 levels using antral biopsy specimens to clarify the role of the dupA cluster in inducing gastric mucosal inflammation. The gastric mucosal IL-8 levels in patients with dupA-positive H. pylori were 79.9 × 10.3 pg/mg, which was significantly higher than that in patients containing the dupA-negative strain (P = 0.04). Particularly, this value was significantly higher in patients infected with H. pylori with a complete dupA cluster compared to those with an incomplete dupA cluster and those that were dupA negative (92.2 ± 14.8, 59.8 ± 9.4, and 38.6 ± 11.3 pg/mg, respectively, P = 0.013) (Table 5). These results suggested that the status of a complete dupA cluster rather than only dupA is important in inducing IL-8 production in gastric cells. On the other hand, gastric mucosal IL-12 levels were not different among the groups (Table 5).
Table 5.
Cytokine levels in gastric mucosa (in vivo) and MKN45 cells (in vitro)
| Cytokine | Site | Mean cytokine level ± SD (pg/ml)a |
||
|---|---|---|---|---|
| Complete dupA cluster (n = 13) | Incomplete dupA cluster (n = 8) | dupA negative (n = 7) | ||
| IL-8 | Gastric mucosa | 92.2 ± 14.8* | 59.8 ± 9.4 | 38.6 ± 11.3 |
| IL-12 | Gastric mucosa | 33.8 ± 5.7 | 21.9 ± 6.2 | 16.5 ± 6.8 |
| IL-8 | MKN45 cells | 2,012 ± 127* | 1,616 ± 114 | 1,608 ± 85 |
*, P <0.05 versus the incomplete dupA cluster and dupA-negative group. n, number of patients.
IL-8 production in gastric cancer cells.
IL-8 production in MKN45 cells cocultured in vitro with H. pylori obtained from gastritis patients used for measuring cytokines levels from gastric mucosa was also examined. There was no difference in IL-8 production between dupA-positive and dupA-negative strains. However, IL-8 production was significantly higher (2,012 ± 127 pg/ml) in strains with a complete dupA cluster than in those with an incomplete dupA cluster (1,616 ± 114 pg/ml, P = 0.010) or those that were dupA negative (1,608 ± 85 pg/ml, P = 0.010) (Table 5).
DISCUSSION
In 2005, we reported for the first time that the prevalence of dupA was significantly higher in patients with DU than in patients with GC, regardless of the patients' nationality (Japan, Korea, and Colombia) (42% versus 9%, on average) (21). However, many controversial results have been reported worldwide, and the association between the presence of dupA and gastroduodenal diseases has appeared in some populations but not in others (2, 3, 6, 10, 14, 21, 22, 26, 40, 41). The status of dupA is generally more prevalent in Western strains than in Asian strains. In a recent review, the dupA prevalence in patients with gastritis worldwide was reported to be 44.8%, and this value differed significantly between nationalities/ethnicities; H. pylori isolates from South America were significantly more likely to possess dupA (79.21% [160/202]) than those from East Asian (36.62% [130/355]), Middle Eastern (40.21% [39/97]), or European (43.75% [42/96]) countries (13). The association between dupA status and disease development is primarily observed in Asian country such as China, Korea, Iraq, and North India. Our meta-analysis showed that infection with dupA-positive H. pylori increased the DU risk (OR = 1.41, 95% CI = 1.12 to 1.76), particularly in Asian countries (OR = 1.57, 95% CI = 1.19 to 2.06), but not in Western countries (OR = 1.09, CI = 0.73 to 1.62) (27). In the present study, although the data regarding gastritis in the U.S. population are limited (3), we showed that the prevalence of dupA in the U.S. population was 69.4%, which is relatively higher than that reported in other countries (13, 27). In the present study, we did not observe an association between the status of the dupA gene alone and clinical outcomes in the U.S. population; this result is consistent with results from other Western countries.
Thus far, there is no evidence directly showing that dupA cluster forms a functional T4SS. However, the vir genes exist before and after the region of the dupA locus and the surrounding six vir gene homologues (virB8, virB9, virB10, virB11, virD4, and virD2) are important in forming a novel putative T4SS (tfs3a). This suggests that strains containing dupA and a complete tfs3a may be pathogenic strains and have the same action as that of other T4SSs (19). As shown in the present study, many mosaic patterns in vir gene homologues exist near dupA. Therefore, this mosaic pattern is considered to be related with various degrees of virulence. In the present study, we divided these strains into three groups: a complete dupA cluster (dupA positive and all virB gene positive), an incomplete dupA cluster (dupA positive but incomplete cluster), and a dupA-negative group. We first showed that the presence of a complete dupA cluster increased the DU risk compared to the presence of other clusters. Furthermore, gastric mucosal IL-8 levels were the highest in patients infected with H. pylori possessing a complete dupA cluster. These findings suggested that a complete dupA cluster, rather than dupA itself, is important in DU development and IL-8 production in gastric cells. A complete dupA cluster may be necessary in promoting DU formation, just as an intact cag PAI is thought to be important in H. pylori pathogenesis of related diseases (1, 15, 18). Therefore, the presence of dupA, without the presence of complete vir gene homologues, may explain the contradictory association between dupA and clinical outcomes. However, we also found that the status of dupA, but not dupA cluster is associated with progression of gastric mucosal atrophy. Our previous in vitro studies showed that the dupA plays roles in increased survivability at low pH in gastric epithelial cells using dupA deletion and dupA-complemented mutants (21). DupA itself might have function for protecting against gastric acidity. Further studies will be necessary for investigating the roles of DupA in gastric acidic condition.
Of Vir proteins encoded by vir gene homologues in the dupA cluster, VirB8, VirB9, and VirB10 are thought to form a membrane traversing transporter channel, and VirB4, VirB11, and VirD4 may be localized to the inner bacterial membrane and encode proteins with ATPase activity, similarly to cag PAI and T4SS of Agrobacterium tumefaciens (4, 32). In A. tumefaciens, the VirD4 protein links the T-DNA complex directly to the exporting membrane channel in Ti-plasmid and conjugative plasmid DNA-transfer systems, and VirD2 plays an important role in carrying nuclear targeting signals and mediating the transport of the transferred DNA (T-DNA) complex into the nucleus, where the T-DNA integrates into the plant cell genome (4, 32). Interestingly, dupA cluster has virD2 gene that is not in the cag PAI and ComB T4SSs. A complete dupA cluster might be associated with normal bacterial conjugation processes and/or the transfer of DNA to infected gastric epithelial cells through T-DNA transport. In addition, like CagA that is injected into the host epithelial cells by cag PAI, the dupA cluster might be responsible for transport of some new effectors to the host cells.
Our study has several limitations. There was no ideal primer set for detecting the dupA gene, even though the sample size was small. Therefore, one primer set is not sufficient to detect the dupA gene. Moreover, Gomes et al. reported the presence of frameshift mutations in 14/86 (16%) of dupA (10) and a single adenine insertion after position 1,426 of dupA or at position 2,998 of the jhp0917-jhp0918 gene of the J99 strain, creating a premature stop codon; this may have considerable effects on protein expression or function. Strains with these mutated sequences are not able to produce intact DupA protein. Intriguingly, the presence of dupA without a stop codon was more frequently observed in strains from patients with DU than those from patients with gastritis or GC (25). According to these results, the G27 strain, which possesses a tfs3a, might not produce DupA protein due to the presence of a stop codon in dupA (33). Similarly to DupA, expression of the blood group antigen binding adhesin (BabA) protein is not always correlated with babA gene expression (34). Further analysis of the dupA DNA sequence is necessary to clarify the significance of intact dupA. In addition, intact dupA should be detected by measuring intact DupA protein using immunoblotting techniques.
In conclusion, the presence of a complete dupA cluster seemed to be important in DU development; however, dupA itself is not sufficient for DU development. H. pylori infection with a complete dupA cluster are associated with an inflammatory response.
ACKNOWLEDGMENTS
The authors declare no competing interests.
This report is based on work supported in part by grants from the National Institutes of Health (grant DK62813) and Grants-in-Aid for Scientific Research from the Ministry of Education, Culture, Sports, Science, and Technology of Japan (grants 22390085 and 22659087).
Footnotes
Published ahead of print 28 October 2011
REFERENCES
- 1. Ali M, et al. 2005. Association between cag-pathogenicity island in Helicobacter pylori isolates from peptic ulcer, gastric carcinoma, and non-ulcer dyspepsia subjects with histological changes. World J. Gastroenterol. 11: 6815–6822 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2. Arachchi HS, et al. 2007. Prevalence of duodenal ulcer-promoting gene (dupA) of Helicobacter pylori in patients with duodenal ulcer in North Indian population. Helicobacter 12: 591–597 [DOI] [PubMed] [Google Scholar]
- 3. Argent RH, Burette A, Miendje Deyi VY, Atherton JC. 2007. The presence of dupA in Helicobacter pylori is not significantly associated with duodenal ulceration in Belgium, South Africa, China, or North America. Clin. Infect. Dis. 45: 1204–1206 [DOI] [PubMed] [Google Scholar]
- 4. Backert S, Von Nickisch-Rosenegk E, Meyer TF. 1998. Potential role of two Helicobacter pylori relaxases in DNA transfer? Mol. Microbiol. 30: 673–674 [DOI] [PubMed] [Google Scholar]
- 5. Christie PJ. 2001. Type IV secretion: intercellular transfer of macromolecules by systems ancestrally related to conjugation machines. Mol. Microbiol. 40: 294–305 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6. Douraghi M, et al. 2008. dupA as a risk determinant in Helicobacter pylori infection. J. Med. Microbiol. 57: 554–562 [DOI] [PubMed] [Google Scholar]
- 7. el-Zimaity HM, et al. 1996. Interobserver variation in the histopathological assessment of Helicobacter pylori gastritis. Hum. Pathol. 27: 35–41 [DOI] [PubMed] [Google Scholar]
- 8. Fischer W, Haas R, Odenbreit S. 2002. Type IV secretion systems in pathogenic bacteria. Int. J. Med. Microbiol. 292: 159–168 [DOI] [PubMed] [Google Scholar]
- 9. Fukase K, et al. 2008. Effect of eradication of Helicobacter pylori on incidence of metachronous gastric carcinoma after endoscopic resection of early gastric cancer: an open-label, randomised controlled trial. Lancet 372: 392–397 [DOI] [PubMed] [Google Scholar]
- 10. Gomes LI, et al. 2008. Lack of association between Helicobacter pylori infection with dupA-positive strains and gastroduodenal diseases in Brazilian patients. Int. J. Med. Microbiol. 298: 223–230 [DOI] [PubMed] [Google Scholar]
- 11. Hsu PI, et al. 2002. Clinical presentation in relation to diversity within the Helicobacter pylori cag pathogenicity island. Am. J. Gastroenterol. 97: 2231–2238 [DOI] [PubMed] [Google Scholar]
- 12. Hussein N, et al. 2010. Helicobacter pylori dupA is polymorphic, and its active form induces proinflammatory cytokine secretion by mononuclear cells. J. Infect. Dis. 202: 261–269 [DOI] [PubMed] [Google Scholar]
- 13. Hussein NR. 2010. The association of dupA and Helicobacter pylori-related gastroduodenal diseases. Eur. J. Clin. Microbiol. Infect. Dis. 29: 817–821 [DOI] [PubMed] [Google Scholar]
- 14. Hussein NR, et al. 2008. Differences in virulence markers between Helicobacter pylori strains from Iraq and those from Iran: potential importance of regional differences in H. pylori-associated disease. J. Clin. Microbiol. 46: 1774–1779 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15. Ikenoue T, et al. 2001. Determination of Helicobacter pylori virulence by simple gene analysis of the cag pathogenicity island. Clin. Diagn. Lab. Immunol. 8: 181–186 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16. Jung SW, Sugimoto M, Graham DY, Yamaoka Y. 2009. homB status of Helicobacter pylori as a novel marker to distinguish gastric cancer from duodenal ulcer. J. Clin. Microbiol. 47: 3241–3245 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17. Karnholz A, et al. 2006. Functional and topological characterization of novel components of the comB DNA transformation competence system in Helicobacter pylori. J. Bacteriol. 188: 882–893 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18. Kauser F, et al. 2004. The cag pathogenicity island of Helicobacter pylori is disrupted in the majority of patient isolates from different human populations. J. Clin. Microbiol. 42: 5302–5308 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19. Kersulyte D, et al. 2009. Helicobacter pylori's plasticity zones are novel transposable elements. PLoS One 4: e6859. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20. Lee VT, Schneewind O. 2001. Protein secretion and the pathogenesis of bacterial infections. Genes Dev. 15: 1725–1752 [DOI] [PubMed] [Google Scholar]
- 21. Lu H, Hsu PI, Graham DY, Yamaoka Y. 2005. Duodenal ulcer promoting gene of Helicobacter pylori. Gastroenterology 128: 833–848 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22. Matteo MJ, et al. 2010. Helicobacter pylori oipA, vacA, and dupA genetic diversity in individual hosts. J. Med. Microbiol. 59: 89–95 [DOI] [PubMed] [Google Scholar]
- 23. Ohno T, et al. 2009. Relationship between Helicobacter pylori hopQ genotype and clinical outcome in Asian and Western populations. J. Gastroenterol. Hepatol. 24: 462–468 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24. Pacheco AR, et al. 2008. Involvement of the Helicobacter pylori plasticity region and cag pathogenicity island genes in the development of gastroduodenal diseases. Eur. J. Clin. Microbiol. Infect. Dis. 27: 1053–1059 [DOI] [PubMed] [Google Scholar]
- 25. Queiroz DM, et al. 2011. dupA polymorphisms and risk of Helicobacter pylori-associated diseases. Int. J. Med. Microbiol. 301: 225–228. [DOI] [PubMed] [Google Scholar]
- 26. Schmidt HM, et al. 2009. The prevalence of the duodenal ulcer promoting gene (dupA) in Helicobacter pylori isolates varies by ethnic group and is not universally associated with disease development: a case-control study. Gut Pathog. 1: 5. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27. Shiota S, Matsunari O, Watada M, Hanada K, Yamaoka Y. 2010. Systematic review and meta-analysis: the relationship between the Helicobacter pylori dupA gene and clinical outcomes. Gut Pathog. 2: 13. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28. Suerbaum S, Michetti P. 2002. Helicobacter pylori infection. N. Engl. J. Med. 347: 1175–1186 [DOI] [PubMed] [Google Scholar]
- 29. Sugimoto M, Zali MR, Yamaoka Y. 2009. The association of vacA genotypes and Helicobacter pylori-related gastroduodenal diseases in the Middle East. Eur. J. Clin. Microbiol. Infect. Dis. 28: 1227–1236 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30. Tanaka J, Suzuki T, Mimuro H, Sasakawa C. 2003. Structural definition on the surface of Helicobacter pylori type IV secretion apparatus. Cell Microbiol. 5: 395–404 [DOI] [PubMed] [Google Scholar]
- 31. Uemura N, et al. 2001. Helicobacter pylori infection and the development of gastric cancer. N. Engl. J. Med. 345: 784–789 [DOI] [PubMed] [Google Scholar]
- 32. Vergunst AC, et al. 2000. VirB/D4-dependent protein translocation from Agrobacterium into plant cells. Science 290: 979–982 [DOI] [PubMed] [Google Scholar]
- 33. Yamaoka Y. 2010. Mechanisms of disease: Helicobacter pylori virulence factors. Nat. Rev. Gastroenterol. Hepatol. 7: 629–641 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34. Yamaoka Y. 2008. Roles of Helicobacter pylori BabA in gastroduodenal pathogenesis. World J. Gastroenterol. 14: 4265–4272 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35. Yamaoka Y. 2008. Roles of the plasticity regions of Helicobacter pylori in gastroduodenal pathogenesis. J. Med. Microbiol. 57: 545–553 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36. Yamaoka Y, et al. 2002. Importance of Helicobacter pylori oipA in clinical presentation, gastric inflammation, and mucosal interleukin 8 production. Gastroenterology 123: 414–424 [DOI] [PubMed] [Google Scholar]
- 37. Yamaoka Y, Kodama T, Kashima K, Graham DY, Sepulveda AR. 1998. Variants of the 3′ region of the cagA gene in Helicobacter pylori isolates from patients with different H. pylori-associated diseases. J. Clin. Microbiol. 36: 2258–2263 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38. Yamaoka Y, et al. 1998. Relationship of vacA genotypes of Helicobacter pylori to cagA status, cytotoxin production, and clinical outcome. Helicobacter 3: 241–253 [DOI] [PubMed] [Google Scholar]
- 39. Yamaoka Y, Kwon DH, Graham DY. 2000. A M(r) 34,000 proinflammatory outer membrane protein (oipA) of Helicobacter pylori. Proc. Natl. Acad. Sci. U. S. A. 97: 7533–7538 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40. Yeh YC, Cheng HC, Chang WL, Yang HB, Sheu BS. 2010. Matrix metalloproteinase-3 promoter polymorphisms but not dupA-Helicobacter pylori correlate to duodenal ulcers in H. pylori-infected females. BMC Microbiol. 10: 218. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41. Zhang Z, et al. 2008. The Helicobacter pylori duodenal ulcer-promoting gene, dupA in China. BMC Gastroenterol. 8: 49. [DOI] [PMC free article] [PubMed] [Google Scholar]