Skip to main content
Applied and Environmental Microbiology logoLink to Applied and Environmental Microbiology
. 2012 Jan;78(2):581–585. doi: 10.1128/AEM.06611-11

Controlled Gene Expression in Bifidobacteria by Use of a Bile-Responsive Element

Lorena Ruiz 1, Pablo Álvarez-Martín 1, Baltasar Mayo 1, Clara G de los Reyes-Gavilán 1, Miguel Gueimonde 1, Abelardo Margolles 1,✉
PMCID: PMC3255758  PMID: 22081575

Abstract

The promoter activity of the upstream region of the bile-inducible gene betA from Bifidobacterium longum subsp. longum NCC2705 was characterized. DNA fragments were cloned into the reporter vector pMDYAbfB, and the arabinofuranosidase activity was determined under different in vitro conditions. A segment of 469 bp was found to be the smallest operational unit that retains bile inducibility. The reporter activity was strongly affected by the presence of ox gall, cholate, and conjugated cholate, but not by other bile salts and cell-surface-acting compounds. Remarkably, this bile-inducible system was also active in other bifidobacteria containing betA homologs.

TEXT

The organism Bifidobacterium longum, a commensal bacterium which is dominant in the gut microbiota of humans (7, 8, 21, 22), is one of the Bifidobacterium species for which health-promoting effects have been attributed to particular probiotic strains (3). In the intestine, bifidobacteria are exposed to bile salts, detergent-like biological molecules synthesized from cholesterol in the liver, whose major physiological function is to facilitate fat absorption during digestion. Apart from this, bile salts perform a key ecological role in the establishment of the intestinal microbiota, since they display antimicrobial activity, mainly through cell membrane damage caused by their amphipathic properties (13). Thus, only those microorganisms able to cope with physiological concentrations of bile salts will be able to survive or transiently colonize the gut. A common strategy used by enteric bacteria to counteract the deleterious effect of bile salts is the synthesis of bile efflux systems (14, 20). By modulating the expression of these transporters, bacteria are able to regulate the intracellular concentration of bile and diminish its biological damage.

Due to the limitations and the scarcity of effective molecular tools for bifidobacteria, functional genomics in this genus could not be exploited until very recently (16, 17, 25). While several authors have characterized gene regulation in intestinal lactobacilli under gastrointestinal conditions (i.e., pH and bile) (4, 11, 18, 23), and even some pH-inducible expression systems are available (12), inducible gene expression systems have not been developed in bifidobacteria yet. Furthermore, bifidobacteria are much more abundant than lactobacilli in the human gut; thus, they are thought to be a promising alternative for the local delivery of therapeutic agents. In this respect, some progress has been made using B. longum as a delivery vector of tumor-suppressing proteins (5, 24). However, to the best of our knowledge, bacterial delivery systems triggered by an intestinal signal to specifically release bioactive proteins into the intestine have not been developed yet.

Gene expression in bifidobacteria has been the subject of some studies, but only a few regulated promoters have been identified (26). During the course of our research on bile response of bifidobacteria, we have discovered a bile-inducible transporter, BetA, from B. longum NCC2705 (GenBank accession no. AE014295.3) (6). In the present work, we have characterized the upstream region of betA in order to explore its suitability for developing controlled gene expression systems specifically induced in the intestinal tract.

Previous experiments have shown that the expression of the gene betA was induced more than 30 times when B. longum NCC2705 was grown in the presence of subinhibitory concentrations of bile, compared with conditions in which bile was absent (6). In order to find out if gene induction increased in a concentration-dependent manner, we grew B. longum strain NCC2705 in DeMan, Rogosa, Sharpe broth (MRS; Difco) supplemented with 0.25% l-cysteine (Sigma) (MRSc) at 37°C in a Mac500 anaerobic chamber (Don Whitley Scientific). Unless specified otherwise, these growth conditions were used throughout. Also, at least three biological replicates were carried out for all growth experiments described in the present study. Ox bile extract (ox gall; Sigma) was added to the medium at 0, 0.02, 0.10, and 0.14% (wt/vol), and betA expression was quantified by quantitative real-time PCR (qRT-PCR), using the primers BL0920F and BL0920R (Table 1), as previously described (6). We found that the expression of the gene increased linearly in this bile concentration range (R2 = 0.918), betA was induced more than 90 times at the highest concentration tested and about 13 times at the lowest (see Fig. S1 in the supplemental material). These results seem to indicate that the expression of the gene is tightly regulated by the presence of bile and that it can be modulated by using increasing amounts of bile. It is worth mentioning that the bile concentrations used for this analysis are within the physiological range that can be found in the human intestine (2).

Table 1.

Vectors and primers used in this study

Vector or primer Characteristicsa Reference or source
Vectors
    pMDY23 Spr, general reporter vector, gusA reporter gene 10
    pMDYAbfB Spr, general reporter vector, abfB reporter gene This work
    pMDYP573AbfB pMDYAbfB derivative, 573-bp fragment cloned upstream of NsiI site This work
    pMDYP469AbfB pMDYAbfB derivative, 469-bp fragment cloned upstream of NsiI site This work
    pMDYP367AbfB pMDYAbfB derivative, 367-bp fragment cloned upstream of NsiI site This work
    pMDYP267AbfB pMDYAbfB derivative, 267-bp fragment cloned upstream of NsiI site This work
    pMDYP167AbfB pMDYAbfB derivative, 167-bp fragment cloned upstream of NsiI site This work
Primers
    BL0920F GCCGCCTCCCTGTTCAA 6
    BL0920R TAGGGCTGATCGTCCATGATTC 6
    pMDY23AbfBF TCTAGACCAATGCATACCACTCACAACAGCCAGTATTC (NsiI) This work
    pMDY23AbfBR TCTAGACCAAAGCTTTTATTAGCCGTGGAATTCCACGCTG (HindIII) This work
    Prom573F GCTCGTAGATCTGCCTCGCATGTTCAGCTTCAC (BglII) This work
    Prom469F TCAGGCAGATCTTATGCGGTAAGCCCAATC (BglII) This work
    Prom367F TCAGGCAGATCTTACGAAGACCCCATCAAGGAG (BglII) This work
    Prom267F TCAGGCAGATCTCAATCCACGAATGGCCCTATTC (BglII) This work
    Prom167F TCAGGCAGATCTCTCACCATAGCCATCAACTTAC (BglII) This work
    Pro-T GCGTTTTTCTGTGAGATGCATAGCATTTCCTTCTGTTGGTAACG (NsiI) This work
a

Restriction enzyme sites are underlined, and the corresponding restriction enzyme is shown in parentheses.

A fragment of 573 bp and shorter fragments derived from it by deleting bases in the 5′ region were cloned upstream from the reporter gene abfB (GenBank accession no. AY259087) in the plasmid pMDYAbfB (Fig. 1). This plasmid is a derivative of the reporter vector pMDY23 (10), in which the original gusA gene was replaced by abfB from B. longum (15). To do that, abfB was amplified with Pfx DNA polymerase (Invitrogen), using total DNA from B. longum NB667 as a template, and the primers pMDY23AbfBF and pMDY23AbfBR. The resulting PCR product was digested with NsiI and HindIII and ligated into pMDY23 vector, previously digested with the same enzymes, to yield pMDYAbfB. To our knowledge, this is the first vector using a bifidobacterial gene as a reporter. AbfB displays a very high arabinofuranosidase activity that can be monitored, by using pNP-arabinofuranoside as a synthetic substrate, through a wide pNP concentration range (1, 15). Afterwards, different DNA fragments, ranging from 573 bp to 167 bp, were cloned upstream from the NsiI site of pMDYAbfB (ATGCAT, containing the start codon of abfB). Fragments were amplified by PCR using the corresponding Prom forward primers and the reverse primer Pro-T (Table 1) and subsequently digested with the enzymes BglII and NsiI according to the manufacturer′s instructions. The PCR products were cloned into the promoter reporter vector pMDYAbfB, similarly digested, to generate pMDYP573AbfB, pMDYP469AbfB, pMDYP367AbfB, pMDYP267AbfB, and pMDYP167AbfB. For plasmid construction details, see Fig. 1.

Fig 1.

Fig 1

Schematic representation of the constructs used in this work. (A) Main features of the betA upstream region (unpublished data) deduced after the analysis with Softberry and Neural Network Promoter Prediction. Pin-like symbols represent potential inverted repeats. (B) Sizes of the different fragments of the betA upstream region. (C) Construction of pMDY23-derived vectors.

Once all of the constructs were obtained, the vectors were introduced into B. longum NCC2705 cells by electrotransformation, according to Álvarez-Martín et al. (1), and the reporter activity was determined under different in vitro conditions. Previous experiments have shown that cholate, a primary bile salt, strongly induces betA expression (data not shown). Protein extracts of B. longum NCC2705 transformants grown in the absence of cholate and in the presence of 0.06% cholate, harboring pMDYAbfB and the derived plasmids, were obtained as previously described (1), and the arabinofuranosidase activity was determined on cell extracts using pNP-arabinofuranoside. Briefly, cells from 10 ml of cultures were harvested by centrifugation, washed twice with 100 mM potassium phosphate buffer (pH 6.8), and resuspended in 2 ml of the same buffer. The cell suspensions were transferred to tubes containing glass beads (acid washed, ≤106 μm in diameter; Sigma), and cells were lysed using a FastPrep FP120 cell disrupter (Thermo Savant). Following 30 s of disruption at a speed of 4.5, samples were held on ice for 1 min, and this step was repeated 3 times. Cell debris was removed by centrifugation, the protein content of cell extracts was determined using the bicinchoninic acid (BCA) protein assay kit (Pierce), and the enzymatic activity was measured according to Margolles and de los Reyes-Gavilán (15) (Fig. 2). The constructs containing the two larger DNA fragments (469 and 573 bp) displayed some arabinofuranosidase activity in the absence of cholate that was increased several times when cholate was present in the medium (Fig. 2). The remaining shorter versions displayed low or almost undetectable activity, similar to that displayed by the construct containing the control plasmid (pMDYAbfB), and did not show any induction. The arabinofuranosidase activity of B. longum NCC2705 extracts coming from cells without vector was negligible.

Fig 2.

Fig 2

Arabinofuranosidase activity of total protein extracts of B. longum NCC2705 derivatives, containing the vectors with the betA upstream regions with different sizes or the empty vector (control). The bars indicate the results from protein extracts from cells grown in the absence (dark gray) or presence (gray) of 0.06% cholate. AU, arbitrary units of arabinofuranosidase activity. One unit of enzyme activity was defined as the amount of protein that releases 1 nmol of pNP per min.

Since the B. longum NCC2705 derivatives containing pMDYP469AbfB and pMDYP573AbfB showed similar reporter activity, we considered the 469-bp DNA fragment to be the shortest functional unit that retains bile inducibility. Thus, the arabinofuranosidase activity was determined in the presence of subinhibitory concentrations of different bile salts commonly found in human bile (19), as well as in the presence of other known membrane- and cell-wall-damaging agents, in order to ascertain whether the bile-responsive element was also affected by other compounds acting on the cell surface (Fig. 3). In this respect, there are remarkable findings showing that some bacteria sense the effect of bile on the cell surface, by using two-component regulatory systems or other specific cell surface sensors for the perception of external stimuli, able to trigger gene expression upon contact with the compounds (9, 18). Therefore, we also tested the effect of some detergents (SDS and Tween 80), antibiotics acting on the cell wall (bacitracin and vancomycin), ionophores (valinomycin), and cholesterol. Previous growth experiments were performed to determine the higher compound concentrations that did not affect growth rate (data not shown), and the corresponding subinhibitory concentrations were used in this experiment. Different percentages of cecum juice were included as well in this experiment. Ox gall, cholate, glycocholate, and taurocholate, but not other bile salts, strongly induced the arabinofuranosidase activity (more than 25 times with cholate and taurocholate) (Fig. 3). Finally, all of the other compounds did not significantly affect the reporter activity, suggesting that this 469-bp DNA fragment is specifically responding to bile salts (mainly cholate and conjugated salts) but not to other compounds acting on the cell surface.

Fig 3.

Fig 3

Arabinofuranosidase activity of total protein extracts of B. longum NCC2705 containing pMDYP469AbfB in the presence of potential inducers. AU, arbitrary units; GC, glycocholate; TC, taurocholate; GDC, glycodeoxycholate; TDC, taurodeoxycholate; CJ, cecum juice.

Finally, in order to test the suitability of the vector to be used in different bifidobacterial hosts, we transformed pMDYP469AbfB into Bifidobacterium breve NCIMB8807, Bifidobacterium pseudolongum subsp. pseudolongum LMG11571, Bifidobacterium animalis subsp. lactis IPLAIC4, Bifidobacterium longum subsp. infantis CECT4551, Bifidobacterium adolescentis LMG10502, and Bifidobacterium pseudocatenulatum M115. We were able to detect induction of arabinofuranosidase activity, in the presence of cholic acid, in B. longum subsp. longum, B. longum subsp. infantis, B. breve, B. pseudocatenulatum, and B. adolescentis. However, the activity was extremely low in B. pseudolongum and B. animalis, two species belonging to the B. pseudolongum phylogenetic group that seem to be less evolutionarily adapted to the human intestinal tract (21). In addition, the presence of cholic acid did not increase the reporter activity in these two species (Fig. 4). It is worth mentioning that betA homologs are present in B. breve, B. longum subsp. infantis, B. pseudocatenulatum, and B. adolescentis, but not in species belonging to the B. pseudolongum group (6), thus suggesting that the signal able to trigger gene induction is only sensed in those bifidobacterial hosts containing betA orthologs.

Fig 4.

Fig 4

Arabinofuranosidase activity of total protein extracts of Bifidobacterium strains from different species, containing pMDYP469AbfB, grown in the presence of 0.025% (black) or 0.05% (gray) cholic acid. The y axis indicates the fold increase of arabinofuranosidase activity compared with activity in the absence of cholic acid.

In conclusion, we have characterized a bile-responsive DNA element located upstream from the betA gene of B. longum NCC2705. The minimal functional unit needed for gene inducibility seems to be located between 367 and 469 bp upstream of the coding region. The inclusion of this DNA fragment in delivery vectors, in order to target bioactive proteins to the intestine, is a very promising application. To the best of our knowledge, bacterial vectors specifically activated in the presence of intestinal signals have not been developed yet. Our next step is to validate the application of this system under in vivo conditions.

Supplementary Material

Supplemental material

ACKNOWLEDGMENTS

This work was supported by grant AGL2007-61805 from the Spanish Ministry of Education and Science. Lorena Ruiz was supported by an I3P predoctoral contract granted by CSIC and FEDER funds.

We acknowledge the gift of B. longum strain NCC2705 and plasmid pMDY23 from Fabrizio Arigoni (Nestlé Research Center, Lausanne, Switzerland). Cecum juice was kindly provided by Adolfo Suárez, Gastroenterology Unit, Cabueñes Hospital, Gijón, Spain. We acknowledge Mary O'Connell Motherway and Douwe van Sinderen for sharing of unpublished data.

Footnotes

Published ahead of print 11 November 2011

Supplemental material for this article may be found at http://aem.asm.org/.

REFERENCES

  • 1. Alvarez-Martín P, Flórez AB, Margolles A, del Solar G, Mayo B. 2008. Improved cloning vectors for bifidobacteria, based on the Bifidobacterium catenulatum pBC1 replicon. Appl. Environ. Microbiol. 74:4656–4665. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2. Begley M, Gahan CG, Hill C. 2005. The interaction between bacteria and bile. FEMS Microbiol. Rev. 29:625–651 [DOI] [PubMed] [Google Scholar]
  • 3. Bergogne-Bérézin E. 2000. Treatment and prevention of antibiotic associated diarrhea. Int. J. Antimicrob. Agents 16:521–526 [DOI] [PubMed] [Google Scholar]
  • 4. Bron PA, et al. 2004. Genetic characterization of the bile salt response in Lactobacillus plantarum and analysis of responsive promoters in vitro and in situ in the gastrointestinal tract. J. Bacteriol. 186:7829–7835 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5. Cronin M, et al. 2010. Orally administered bifidobacteria as vehicles for delivery of agents to systemic tumors. Mol. Ther. 18:1397–1407 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6. Gueimonde M, Garrigues C, van Sinderen D, de los Reyes-Gavilán CG, Margolles A. 2009. Bile-inducible efflux transporter from Bifidobacterium longum NCC2705, conferring bile resistance. Appl. Environ. Microbiol. 75:3153–3160 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7. Haarman M, Knol J. 2005. Quantitative real-time PCR assays to identify and quantify fecal Bifidobacterium species in infants receiving a prebiotic infant formula. Appl. Environ. Microbiol. 71:2318–2324 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8. Hill JE, et al. 2010. Improvement of the representation of bifidobacteria in fecal microbiota metagenomic libraries by application of the cpn60 universal primer cocktail. Appl. Environ. Microbiol. 76:4550–4552 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9. Jordan S, Hutchings MI, Mascher T. 2008. Cell envelope stress response in Gram-positive bacteria. FEMS Microbiol. Rev. 32:107–146 [DOI] [PubMed] [Google Scholar]
  • 10. Klijn A, et al. 2006. Construction of a reporter vector for the analysis of Bifidobacterium longum promoters. Appl. Environ. Microbiol. 72:7401–7405 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11. Kullen MJ, Klaenhammer TR. 1999. Identification of the pH-inducible, proton-translocating F1F0-ATPase (atpBEFHAGDC) operon of Lactobacillus acidophilus by differential display: gene structure, cloning and characterization. Mol. Microbiol. 33:1152–1161 [DOI] [PubMed] [Google Scholar]
  • 12. Kullen MJ, Klaenhammer TR. December 2000. Acid-inducible promoters for gene expression. Patent WO/2000/078922 [Google Scholar]
  • 13. Kurdi P, Kawanishi K, Mizutani K, Yokota A. 2006. Mechanism of growth inhibition by free bile acids in lactobacilli and bifidobacteria. J. Bacteriol. 188:1979–1986 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14. Lin J, et al. 2005. Bile salts modulate expression of the CmeABC multidrug efflux pump in Campylobacter jejuni. J. Bacteriol. 187:7417–7424 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15. Margolles A, de los Reyes-Gavilán CG. 2003. Purification and functional characterization of a novel alpha-l-arabinofuranosidase from Bifidobacterium longum B667. Appl. Environ. Microbiol. 69:5096–5103 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16. O'Connell-Motherway M, et al. 2008. Characterization of ApuB, an extracellular type II amylopullulanase from Bifidobacterium breve UCC2003. Appl. Environ. Microbiol. 74:6271–6279 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17. O'Connell-Motherway M, O'Driscoll J, Fitzgerald GF, van Sinderen D. 2009. Overcoming the restriction barrier to plasmid transformation and targeted mutagenesis in Bifidobacterium breve UCC2003. Microb. Biotechnol. 2:321–332 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18. Pfeiler EA, Azcarate-Peril MA, Klaenhammer TR. 2007. Characterization of a novel bile-inducible operon encoding a two-component regulatory system in Lactobacillus acidophilus. J. Bacteriol. 189:4624–4634 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19. Ridlon JM, Kang DJ, Hylemon PB. 2006. Bile salt biotransformations by human intestinal bacteria. J. Lipid Res. 47:241–259 [DOI] [PubMed] [Google Scholar]
  • 20. Thanassi DG, Cheng LW, Nikaido H. 1997. Active efflux of bile salts by Escherichia coli. J. Bacteriol. 179:2512–2518 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21. Turroni F, van Sinderen D, Ventura M. 2009. Bifidobacteria: from ecology to genomics. Front. Biosci. 14:4673–4684 [DOI] [PubMed] [Google Scholar]
  • 22. Turroni F, et al. 2009. Microbiomic analysis of the bifidobacterial population in the human distal gut. ISME J. 3:745–751 [DOI] [PubMed] [Google Scholar]
  • 23. Whitehead K, Versalovic J, Roos S, Britton RA. 2008. Genomic and genetic characterization of the bile stress response of probiotic Lactobacillus reuteri ATCC 55730. Appl. Environ. Microbiol. 74:1812–1819 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24. Xu YF, et al. 2007. A new expression plasmid in Bifidobacterium longum as a delivery system of endostatin for cancer gene therapy. Cancer Gene Ther. 14:151–157 [DOI] [PubMed] [Google Scholar]
  • 25. Yasui K, et al. 2009. Improvement of bacterial transformation efficiency using plasmid artificial modification. Nucleic Acids Res. 37:e3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26. Zomer A, et al. 2009. An interactive regulatory network controls stress response in Bifidobacterium breve UCC2003. J. Bacteriol. 191:7039–7049 [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplemental material

Articles from Applied and Environmental Microbiology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES