Skip to main content
Applied and Environmental Microbiology logoLink to Applied and Environmental Microbiology
. 2012 Feb;78(3):744–751. doi: 10.1128/AEM.05741-11

Reversing Bacterial Resistance to Antibiotics by Phage-Mediated Delivery of Dominant Sensitive Genes

Rotem Edgar 1,*, Nir Friedman 1,*, Shahar Molshanski-Mor 1, Udi Qimron 1,✉
PMCID: PMC3264097  PMID: 22113912

Abstract

Pathogen resistance to antibiotics is a rapidly growing problem, leading to an urgent need for novel antimicrobial agents. Unfortunately, development of new antibiotics faces numerous obstacles, and a method that resensitizes pathogens to approved antibiotics therefore holds key advantages. We present a proof of principle for a system that restores antibiotic efficiency by reversing pathogen resistance. This system uses temperate phages to introduce, by lysogenization, the genes rpsL and gyrA conferring sensitivity in a dominant fashion to two antibiotics, streptomycin and nalidixic acid, respectively. Unique selective pressure is generated to enrich for bacteria that harbor the phages carrying the sensitizing constructs. This selection pressure is based on a toxic compound, tellurite, and therefore does not forfeit any antibiotic for the sensitization procedure. We further demonstrate a possible way of reducing undesirable recombination events by synthesizing dominant sensitive genes with major barriers to homologous recombination. Such synthesis does not significantly reduce the gene's sensitization ability. Unlike conventional bacteriophage therapy, the system does not rely on the phage's ability to kill pathogens in the infected host, but instead, on its ability to deliver genetic constructs into the bacteria and thus render them sensitive to antibiotics prior to host infection. We believe that transfer of the sensitizing cassette by the constructed phage will significantly enrich for antibiotic-treatable pathogens on hospital surfaces. Broad usage of the proposed system, in contrast to antibiotics and phage therapy, will potentially change the nature of nosocomial infections toward being more susceptible to antibiotics rather than more resistant.

INTRODUCTION

Bacteria have evolved to overcome a wide range of antibiotics, and resistance mechanisms against most of the conventional antibiotics have been identified in some bacteria (7). Accelerated development of newer antibiotics is being overtaken by the pace of bacterial resistance. In the United States, for example, over 70 of hospital-acquired infections involve bacteria resistant to at least one antibiotic, and in Japan, over 50 of the clinical isolates of Staphylococcus aureus are multidrug resistant (11).

This increasing threat has revived research into phage therapy. For example, a clinical phase I and II control trial was recently completed successfully for the treatment of chronic bacterial ear infections (21). Nevertheless, although phage therapy has been practiced for several decades in some of the former Soviet Union countries and Poland, there are still many doubts as to its ability to replace antibiotics. Major concerns over the use of phage therapy include neutralization of phages by the spleen/liver and by the immune system, their narrow host range, bacterial resistance to the phage, and lack of sufficient pharmacokinetic and efficacy studies in humans and animals (1, 11).

A recent study used phages as a genetic tool to increase bacterial susceptibility to antibiotics. The study used phage M13 of the Gram-negative bacterium Escherichia coli to genetically target several gene networks, thus rendering the bacteria more sensitive to antibiotics (10). It demonstrated that disrupting the SOS response by M13-mediated gene targeting renders the bacteria severalfold more sensitive to a variety of antibiotics. It also demonstrated that phage-mediated gene transfer combined with antibiotics increases the survival of mice infected with pathogenic E. coli. Overall, the study showed that transferring genes by phage M13 weakens the bacteria and renders them more susceptible to killing by antibiotics. We believed that some aspects of that study required further modification. First, the transferred genes target a beneficial pathway in bacteria and therefore significantly reduce the fitness of the bacteria harboring the phage. Consequently, negative selection pressure is constantly being applied against transfer of these genes by the M13 phage. Second, no mechanism to facilitate genetic transfer of the M13 genes was used: a high multiplicity of infection in the experimental settings compensated for this shortcoming. Nevertheless, such settings cannot be used in field experiments. Third, the phage was experimentally tested in vivo in mice, but immune responses against it were not examined. Therefore, despite the novelty of that study in terms of unique genetic targeting by phage, the result is very similar to conventional phage therapy practices, in which phage are used to directly kill the pathogen.

Different approaches make use of phages as “disinfectants” of pathogens present on edible foods, plants, and farm animals. In addition to increasing the shelf life of these products, the treatment is intended to prevent occasional outbreaks of disease. The U.S. Food and Drug Administration recently approved the use of an anti-Listeria phage cocktail for application on meat and poultry as a preventive measure against Listeria (5). Other phage cocktails have been approved as food additives in Europe, and many are currently being developed by phage biotechnology companies. These applications demonstrate that phages can be dispersed in the environment and efficiently target pathogens in their surroundings.

Here, we present a proof of principle for genetic delivery of constructs using phages to target pathogens in the environment. In the described system, phages are genetically engineered to reverse the pathogens' drug resistance, thereby restoring their sensitivity to antibiotics. The transfer of phages into the pathogens, by lysogenization, a drug-sensitizing DNA cassette that was previously shown to render bacteria sensitive to agents to which they had acquired resistance (6). Pathogens that are lysogenized by the designed phage are selected by tellurite, because the phage is engineered to contain a DNA element conferring resistance to the bactericidal agent. Rather than being administered to patients, the phage are intended for dispersion on hospital surfaces, thus gradually reversing the occurrence of drug-resistant pathogens and competing with the resistant pathogens residing in hospitals. This method would thus enable the use of well-established antibiotics against which resistance has been acquired.

MATERIALS AND METHODS

Bacterial strains.

The bacterial strains used in this study are listed in Table S1 in the supplemental material, as well as in Tables 1 and 2.

Table 1.

E. coli K-12 streptomycin-resistant mutants, Sm1 to Sm22, isolated on 50 μg/ml streptomycin

Streptomycin-resistant mutant Substitution in RpsL Streptomycin MIC (μg/ml)
Sm1 P42S ≥50
Sm2 K43L 800
Sm3 K43N ≥50
Sm4 R54S ≥50
Sm5 R86S ≥50
Sm6 R86S 100
Sm7 R86S ≥50
Sm8 R86S ≥50
Sm9 R86S ≥50
Sm10 R86S ≥50
Sm11 K88E ≥50
Sm12 K88R 400
Sm13 K88R 400
Sm14 K88R 400
Sm15 K88R 400
Sm16 K88R 400
Sm17 K88R 400
Sm18 K88R 400
Sm19 K88R 400
Sm20 K88R 400
Sm21 K88R 400
Sm22 none ≥50

Table 2.

E. coli K-12 nalidixic acid-resistant mutants, Nal1 to Nal8, isolated on 50 μg/ml nalidixic acid

Nalidixic acid-resistant mutant Substitution in GyrA Nalidixic acid MIC (μg/ml)
Nal1 S83L ≥50
Nal2 S83L ≥50
Nal3 S83L ≥50
Nal4 D87G 128
Nal5 D87G 128
Nal6 D87G 128
Nal7 D87G 128
Nal8 D87G 128

Oligonucleotides.

The oligonucleotides used in this study are listed in Table S2 in the supplemental material.

Isolation of resistant mutants.

Over 20 different overnight cultures of a total of ∼1011 E. coli K-12 cells were inoculated on Luria-Bertani (LB) agar plates containing 50 μg/ml streptomycin or 50 μg/ml nalidixic acid. Resistant mutants emerged, in both cases, at a median frequency of ∼1 in 109 CFU and were picked from different cultures to reduce the occurrence of sibling mutants. These bacteria were streaked on an agar plate containing the appropriate antibiotic. The rpsL or gyrA genes of resistant mutants emerging on the plate were PCR amplified, followed by DNA sequencing.

Plasmid construction.

Plasmids were constructed using standard molecular biology techniques. DNA segments were amplified by PCR. Standard digestion of the PCR products and vector by restriction enzymes was carried out according to the manufacturer's instructions. Plasmid sequences are provided in the supplemental material.

Phages.

Genetic engineering of the different phages was carried out using a λgt11/EcoRI/Gigapack III Gold Cloning Kit (Stratagene) according to the manufacturer's protocols. Briefly, EcoRI-digested arms of phage λgt11 were used to construct the lysogenizing phages carrying the different DNA inserts, including a chloramphenicol resistance gene. DNA inserts were PCR amplified from plasmids pRpsL-wt, pRpsL-sil, and pRpsLΔ4 (Fig. 1A) using primers 231F/R (see Table S2 in the supplemental material) and digested with the MfeI restriction enzyme, which produces ends that are compatible with EcoRI. Ligation was carried out using T4 DNA ligase (New England BioLabs). The ligated products were transformed into E. coli strain Y1088, which supports λgt11 growth. The generated plaques were propagated in E. coli Y1088 or E. coli Ymel, which were then used to lysogenize the hosts. In several cases, phage were further manipulated in a host that lacks supE, a suppressor gene necessary for phage growth. In such cases, the phage was transferred by P1-mediated transduction to a permissive host and propagated there. Phages carrying tellurite resistance were constructed by homologous recombination-based genetic engineering of the tellurite resistance marker instead of the chloramphenicol resistance gene. The tellurite resistance genes tehAB were amplified from the E. coli chromosome using primers N1/N2 (see Table S2 in the supplemental material) for λ-RpsLΔ4-tell, λ-RpsL-wt-tell, λ-RpsL-sil-tell, λ-Ctrl-tell, and λ-GyrA-tell (Fig. 1B). Primers RE22/N2 (see Table S2 in the supplemental material) were used for construction of λ-2xRpsL-tell. The obtained PCR products were used for homologous recombination-based genetic engineering as described below. The sequences of the phage inserts are presented in the supplemental material.

Fig 1.

Fig 1

Plasmid (A) and phage (B) maps. The inserts are drawn to scale, with the relevant genes and genetic elements indicated. CAT, chloramphenicol acetyltransferase, conferring chloramphenicol resistance; P amp, bla promoter; P A1*, mutated T7-A1 promoter of the T7 phage. The promoter could not be cloned without a mutation, and therefore, we proceeded with the following 1-bp deletion in the promoter sequence (boldface): T7-A1, AAAAGAGTATTGACTTAAAGTCTAACCTATAGGATACTand TACAGCCAT;T7-A1*, AAAAGAGTATTGACTTAAAGTCTAACTATAGGATACTTACAGCCAT (−35 and −10 boxes are underlined). rpsLΔ4 encodes a truncated RpsL protein; rpsL-wt encodes the RpsL protein; rpsL-sil encodes an RpsL protein, harboring numerous silent mutations, with only 62 identity to the wt sequence; tehA and tehB encode proteins which confer tellurite resistance; and gyrA-wt encodes the gyrase A protein.

Homologous-recombination-based genetic engineering.

Homologous recombination using short-homology flanking ends was performed as described previously (13). Briefly, an overnight culture of lysogens carrying different DNA inserts was diluted 75-fold in 25 ml LB medium with appropriate antibiotics and grown at 32°C in a shaking water bath to an optical density at 600 nm (OD600) of 0.6. Then, half of the culture was heat induced for the recombination function of the prophage at 42°C for exactly 4 min in a shaking water bath. The remaining culture was left at 32°C as the uninduced control. The induced and uninduced samples were immediately cooled on ice slurry and then pelleted at 3,600 × g at 0°C for 10 min. The pellet was washed twice in ice-cold double-distilled H2O (ddH2O) and then resuspended in 200 μl ice-cold ddH2O and kept on ice until electroporation with ∼500 ng of a gel-purified PCR product including the tellurite resistance genes. A 25-μl aliquot of electrocompetent cells was used for each electroporation in a 0.1-cm cuvette at 25 μF, 1.75 kV, and 200 Ω. After electroporation, the bacteria were recovered in 1 ml LB for 1 h in a 32°C shaking water bath and inoculated on selection plates containing 1 to 4 μg/ml tellurite. The DNA insertion into the resulting phages, λ-RpsLΔ4-tell, λ-RpsL-wt-tell, λ-RpsL-sil-tell, λ-Ctrl-tell, λ-GyrA-tell, and λ-2xRpsL-tell, was confirmed by PCR using primer 233F, along with 232F or 232R.

Lysogenization.

An overnight culture of the resistant mutants was diluted 1:100 in LB with the appropriate antibiotics, 10 mM MgSO4, and 0.2 (wt/vol) maltose. When the culture reached an OD600 of 0.6 to 0.8, 100 μl was mixed with 10 μl phage λ, carrying a resistance gene, in a 1.5-ml tube and incubated at room temperature for 20 min. The cells were inoculated on appropriate selection plates and incubated overnight at 32°C. Lysogens emerged on selection plates to which the phage carried a resistance gene. Lysogenization was validated by plating the lysogens at 42°C: lysogens cannot grow at this temperature because the prophage is induced to its lytic cycle (see Materials and Methods).

Transductions.

Transductions were used to transfer antibiotic resistance markers or complete λ phage between strains (in cases where the strain did not carry suppressor genes required for λ growth). P1 lysate was prepared as follows: overnight cultures of the donor strain were diluted 1:100 in 2.5 ml LB, 5 mM CaCl2, 0.2 (wt/vol) glucose. After 1 h of shaking at 37°C (or 32°C for lysogens), 107 to 108 PFU of phage P1 was added. The cultures were aerated for 1 to 3 h until lysis occurred. The obtained P1 lysate was used in transduction, where 100 μl fresh overnight culture was mixed with 1.25 μl of 1 M CaCl2 and 0 to 100 μl P1 phage lysate. After incubation for 30 min at 30°C without shaking, 100 μl Na citrate and 500 μl LB were added. The cultures were incubated at 37°C or 32°C for 45 or 60 min, respectively, and then 3 ml of warm LB supplemented with 0.7 agar was added and the suspension was poured onto a plate containing the appropriate drug. Transductants obtained on antibiotic plates were streaked several times on selection plates and verified by PCR for the presence of the transduced DNA fragment.

MIC determinations.

MIC determination was carried out by following the procedure described by Wiegand et al. (19). Briefly, bacterial cells were grown overnight at 32°C in LB and diluted to 107 to 109 CFU/ml. The obtained suspension was serially diluted 10-fold for different spot concentrations, as indicated. Approximately 1 μl of bacterial suspension was then spotted onto selection plates containing different concentrations of either streptomycin or nalidixic acid, along with the appropriate selection agent (chloramphenicol or tellurite), as indicated, using a 48-pin replicator. The plates were incubated overnight and photographed using MiniBis Pro (Bio-Imaging Systems). The photographs were digitally manipulated using GIMP2 software to adjust the contrast. Liquid-based MIC determination assays were carried out by inoculating serial dilutions of an antibiotic in liquid LB broth with bacterial cultures (OD600, ∼0.05) in 96-well microtiter plates. The plates were incubated overnight at 32°C, and the OD600 was then measured. The lowest antibiotic concentration at which the relative growth compared to the “no-drug” control was below 10 was determined to be the MIC.

RESULTS AND DISCUSSION

Mutations in the target gene, rpsL, constitute a major mechanism of resistance to streptomycin.

Our overall goal in this study is to provide a proof of principle for a genetic system that is able to restore drug sensitivity to drug-resistant pathogens residing on hospital surfaces. We chose, as a first step, to use streptomycin as the model drug. Streptomycin is highly useful as an effective antibiotic against both Gram-negative and Gram-positive bacteria. For example, streptomycin is a mainstay of tuberculosis therapy. However, streptomycin-resistant Mycobacterium tuberculosis bacteria emerge during treatment, and 24 to 85.2 of them have mutations in either rpsL or rrs (15). The rpsL gene product, S12, is an essential, highly conserved protein of the 30S small ribosomal subunit. Most of the acquired resistance to streptomycin is due to specific mutations in rpsL that prevent the inhibitory binding of streptomycin to the essential rpsL gene product. We wanted to reproduce these findings in a model bacterium, E. coli, and then to restore its sensitivity to streptomycin. We therefore inoculated E. coli K-12 on LB agar plates containing 50 μg/ml streptomycin and selected for resistant mutants. This procedure simulates the selection of spontaneous drug-resistant-mutant evolution in hospitals following streptomycin treatment. Resistant colonies emerged with a median frequency of 1 in 109 CFU. Mutations in rpsL were found in 21 out of 22 resistant mutants, a frequency that correlates with that in clinical isolates. As listed in Table 1, 10 mutants harbored a K88R substitution in RpsL; 6 had an R86S substitution; and P42S, K43L, K43N, R54S, and K88E substitutions were each identified once. These mutation types also correlate with previous studies, confirming that a major mechanism for streptomycin resistance relies on mutations in rpsL (16, 18). Therefore, targeting this resistance mechanism or reversing its effect should prove highly beneficial in controlling drug-resistant pathogens.

Wild-type (wt) rpsL transformed on a plasmid dominantly confers streptomycin sensitivity.

Lederberg first reported in 1951 that wt rpsL is a dominant sensitive allele with regard to streptomycin resistance (6). This means that introduction of a sensitive allele of wt rpsL into a streptomycin-resistant bacterial cell will result in sensitivity of the bacterium despite the presence of a resistant rpsL allele. These findings were never exploited for clinical practice. To use the dominant sensitivity of rpsL as a platform for the next sets of experiments, which provide proof of principle for use of the constructs in medical settings in the future, we first established the system with our model strains and plasmids. The MICs of streptomycin were determined by agar plate assay (19). In this assay, ∼104 cells are replica plated on plates with different drug concentrations. The lowest concentration at which there is no visible colony formation is defined as the MIC. The MICs throughout the study were also measured in a complementary liquid determination assay, giving a similar readout (not shown). Two representatives of the most common streptomycin-resistant strains obtained as described above were taken for further study: strains Sm6 and Sm13, harboring mutations in rpsL leading to R86S and K88R substitutions, respectively. Their streptomycin MICs were 100 μg/ml and 200 μg/ml, respectively, whereas the MIC of the parental strain was 1.56 μg/ml. We transformed these strains with the plasmid pRpsL-wt, carrying the wt rpsL, or a control plasmid, pRpsLΔ4, carrying a mock gene (a defective rpsL gene with a 4-bp deletion that disrupts the reading frame after amino acid 26 of the RpsL protein [Fig. 1, as well as the supplemental material, show plasmid sequences and maps]) under a modified early E. coli promoter from phage T7. Transformed cells were selected on agar plates supplemented with 35 μg/ml chloramphenicol, as the plasmid encodes chloramphenicol acetyltransferase, which confers chloramphenicol resistance. The streptomycin MICs of the transformed strains were then determined. As shown in Fig. 2A, transformation of the plasmid carrying wt rpsL, pRpsL-wt, conferred a dominant sensitive phenotype, reducing the MIC of the resistant mutants Sm6 and Sm13 from 100 μg/ml to 12.5 μg/ml and from 200 μg/ml to 3.125 μg/ml, respectively. A control streptomycin-sensitive E. coli strain transformed with these plasmids (pRpsLΔ4 and pRpsL-wt) retained similar streptomycin MICs (not shown). These results demonstrate that a wt rpsL allele delivered on a plasmid into a streptomycin-resistant E. coli strain renders the cell significantly more sensitive to streptomycin.

Fig 2.

Fig 2

rpsL carried by plasmids efficiently sensitizes streptomycin-resistant mutants. Streptomycin-resistant mutants Sm6 and Sm13, transformed with a plasmid carrying wt rpsL, pRpsL-wt (A), or rpsL having multiple silent mutations, pRpsL-sil (B), become more sensitive to streptomycin than mutants transformed with a plasmid carrying a mock gene, pRpsLΔ4. Serial 10-fold dilutions starting at 105 CFU/spot (from top to bottom) of the different mutants were spotted on plates with the indicated streptomycin concentrations. Chloramphenicol was supplemented at 35 μg/ml in all plates to maintain the plasmid. The plates were incubated overnight and photographed using MiniBis Pro (Bio-Imaging Systems). A representative experiment out of three is presented.

rpsL designed with decreased homology to the wt allele can efficiently restore streptomycin sensitivity.

The system we propose as a proof of principle is based on the rpsL-containing construct being transferred horizontally between strains by transformation, conjugation, or transduction, as described below. Recombination events between the chromosomal resistant rpsL and the delivered wt rpsL may reduce the efficiency of the construct, because it may eventually recombine with an rpsL copy that does not confer sensitivity on the transformed strains (nevertheless, there is no danger that it will confer resistance on sensitive strains, as the resistant allele is recessive). In order to reduce the undesired recombination events between the incoming allele conferring sensitivity and the resistant allele in the transformed cell, we designed an allele that cannot undergo homologous recombination with the bacterial copy. Efficient homologous recombination requires identity between recombining genes. Reduction of homology from 100 to 90 decreases the frequency of recombination over 40-fold in E. coli (14). In addition, a minimal efficient processing segment of 23 to 27 bp that is identical to the invading strand is required for efficient homologous recombination (14). We synthesized an rpsL gene with silent mutations that maximize the incompatibility of recombination with the sequence of wt rpsL. Silent substitutions were made in every possible case, except where codon usage was less than 10 (see the supplemental material for plasmid sequences). Overall, the genes were identical in only 62 of their sequences, and there was no single minimal efficient process segment between the wt rpsL and the new rpsL allele, thus providing efficient barriers against homologous recombination. We designated this allele rpsL-sil and the plasmid carrying it pRpsL-sil. The introduced silent mutations might hamper the folding of the encoded protein or its expression levels (3). We therefore tested whether this allele, like the wt rpsL, can dominantly restore sensitivity. As shown in Fig. 2B, dramatic sensitization to streptomycin was observed, with the MIC values decreasing in Sm6 and Sm13 from 100 μg/ml to 25 μg/ml and from 200 μg/ml to 6.25 μg/ml, respectively. The efficiency of restoration of sensitivity was lower than that observed with the wt rpsL, possibly due to the product's folding efficiency, as already mentioned. Nevertheless, these results indicate that both rpsL and rpsL-sil can efficiently restore sensitivity to streptomycin when expressed from plasmids.

A toxic compound, tellurite, efficiently replaces chloramphenicol as a selection marker.

In the above-described experiments, chloramphenicol, under the constitutive bla promoter, was used as a selection and maintenance marker for the rpsL-bearing plasmids. However, chloramphenicol is not a dispensable antibiotic, and by using it in the proposed system, sensitivity to streptomycin is restored by forfeiting sensitivity to chloramphenicol. This outcome is less desirable than one in which drug sensitivity is restored without forfeiting sensitivities to other drugs. We therefore sought to replace chloramphenicol with a dispensable, yet efficient, selection substance. A resistance gene against tellurite (TeO32−), a toxic compound, was evaluated. Tellurite is toxic to bacteria, as it forms long-lived sulfur complexes, thus disrupting the thiol balance in the bacterial cells. Tellurite was once used as a treatment for microbial infections, especially for syphilis, prior to the discovery of antibiotics (22). The tellurite resistance genes, tehAB, present naturally in the E. coli chromosome, do not confer resistance on E. coli under their endogenous promoter due to low transcription (9). Upon expression from an active promoter (e.g., T7), however, the MIC of tellurite against E. coli increases 50- to 100-fold. The observed MIC for E. coli strains that either possess or lack the chromosomal tehAB genes is equal to or less than 2 μg/ml compared to a MIC of 128 μg/ml in cells harboring extrachromosomal tehAB with an active promoter (9). Remarkably, all of the known tellurite resistance genes, including tehAB, are highly specific to tellurite, showing no cross-resistance to other compounds (22), and are therefore a relatively safe choice for our purposes. In addition, the tehAB genes are relatively small (∼2.5 kb), making them easy to clone and genetically transfer. Linking these genes to the antibiotic-sensitizing DNA cassette would thus constitute an appropriate selectable sensitizing construct. Plasmids carrying rpsL-sil or the mock gene were constructed, carrying the tellurite resistance genes tehAB instead of the gene encoding chloramphenicol acetyltransferase. These plasmids were named pRpsL-sil-tell and pRpsLΔ4-tell. The plasmids were transformed into the streptomycin-resistant strains Sm6 and Sm13, and the streptomycin MICs of these transformed cells were determined. Restoration of sensitivity by tellurite-based plasmids was comparable to that observed with the chloramphenicol-based plasmids (Fig. 3). pRpsL-sil-tell sensitized Sm6 from a MIC of 100 μg/ml to 1.56 μg/ml and Sm13 from a MIC of 200 μg/ml to 12.5 μg/ml. These results indicate that tellurite can be used instead of the chloramphenicol resistance marker. They also demonstrate that tellurite can maintain the plasmids without cross-reactivity with the streptomycin resistance phenotype.

Fig 3.

Fig 3

Tellurite resistance genes efficiently replace chloramphenicol acetyltransferase as a selection marker. Streptomycin-resistant mutants transformed with a plasmid carrying wt rpsL as well as a tellurite resistance gene, pRpsL-sil-tell, become more sensitive to streptomycin than mutants transformed with a plasmid carrying a mock gene, pRpsLΔ4-tell. Serial 10-fold dilutions starting at 105 CFU/spot (from top to bottom) of the different mutants were spotted on plates with the indicated streptomycin concentrations. Tellurite was supplemented at 1.5 μg/ml in all plates to maintain the plasmid. The plates were incubated overnight and photographed using MiniBis Pro (Bio-Imaging Systems). A representative experiment out of three is presented.

Streptomycin-resistant bacteria lysogenized with phage λ encoding rpsL become streptomycin sensitive.

The system has thus been shown to restore drug sensitivity using plasmids as a genetic delivery tool without forfeiting other drugs' efficiencies. The system is intended for transfer to resistant pathogens residing on hospital surfaces, rendering them treatable by antibiotics. Plasmids are efficiently transferred from host to host mainly via conjugation. However, establishing a conjugation-based system requires dissemination of bacteria harboring a conjugative plasmid, which is not desirable from either regulatory or safety points of view. We therefore evaluated the use of phages as safer delivery vehicles for the designed constructs. We chose λ, a model phage that has been extensively studied, as a gene delivery tool. This phage can infect its E. coli host and proceed to the lytic or lysogenic cycle. We used a common phage mutant (λgt11; see Materials and Methods) that is directed to a specific cycle type according to the ambient temperature and has a deletion (nin5) designed to allow stable insertion of up to 5 kb of foreign DNA. This phage mutant was engineered to contain wt rpsL, rpsL-sil, or a mock rpsL, each linked to the tellurite resistance genes and designated, respectively, λ-RpsL-wt-tell, λ-RpsL-sil-tell, and λ-RpsLΔ4-tell (Fig. 1B). One of the streptomycin-resistant strains mentioned above, Sm13, was lysogenized with the recombinant phages and selected on agar plates supplemented with 1.5 μg/ml tellurite at 32°C, a temperature at which it favors the lysogenic cycle. The lysogenized bacteria were propagated, and their streptomycin MICs were determined. Lysogenization of Sm13 by the phages resulted in sensitization of the resistant mutants (Fig. 4A). The MIC value for the λ-RpsLΔ4-tell lysogen was 200 μg/ml, compared to 25 μg/ml and 50 μg/ml for λ-RpsL-wt-tell and λ-RpsL-sil-tell, respectively. Although significant, the sensitization was not as efficient as that observed using plasmid delivery.

Fig 4.

Fig 4

rpsL genes introduced by phage λ sensitize a streptomycin-resistant mutant. (A) Phage λ carrying a single copy of either wt rpsL (λ-RpsL-wt-tell) or rpsL-sil (λ-RpsL-sil-tell) sensitizes a streptomycin-resistant mutant, Sm13, compared to phage λ carrying a mock gene (λ-RpsLΔ4-tell). (B) Sensitization is significantly enhanced when the phage carries both copies of rpsL (λ-2xRpsL-tell). Serial 10-fold dilutions starting at 105 CFU/spot (from top to bottom) of the different lysogens were spotted on plates with the indicated streptomycin concentrations. Tellurite was supplemented at 1.5 μg/ml in all plates to maintain the prophage. The plates were incubated overnight and photographed using MiniBis Pro (Bio-Imaging Systems). A representative experiment out of three is presented.

Two copies of the rpsL gene are significantly more efficient than a single copy in reversing resistance.

We suspected that the decreased sensitization observed for lysogenization relative to plasmid transformation is due to a lower number of rpsL gene copies introduced by the λ phage. To test this and improve the sensitization, we cloned the two different rpsL alleles (wt rpsL and rpsL-sil) into the λ phage, designated λ-2xRpsL-tell, and used it to lysogenize the resistant strain Sm13 as described above. Introduction of two gene copies dramatically enhanced the sensitization efficiency of the lysogenized strains, resulting in a significant decrease of the MIC from 200 μg/ml to 1.56 μg/ml, comparable to the MIC observed for the sensitive strain (Fig. 4B). As a whole, these results constitute a proof of principle for restoration of sensitivity to streptomycin using a phage that carries sufficient copies of rpsL at the “genetic cost” of a resistance marker to a toxic compound.

Nalidixic acid-resistant bacteria lysogenized with phage λ carrying gyrA show restored nalidixic acid sensitivity.

The above-mentioned results demonstrate that streptomycin resistance can be reversed by the proposed system. We wished to expand the proof of principle to other antibiotics, as well, to demonstrate that a “multidrug-sensitivity cassette” can theoretically be used. We therefore chose to target quinolone resistance, which also manifests dominant sensitivity by the wt allele (12). The quinolone drug family targets the enzyme gyrase, encoded by gyrA, resulting in DNA replication arrest. Mutations in gyrA are observed in a specific region termed the “quinolone resistance-determining region” (QRDR). The wt gyrA allele is dominant sensitive and may therefore reverse resistance (12). Nalidixic acid, the first of the synthetic quinolone family antibiotics, was used here as a representative of the quinolone family. To test whether the system can restore sensitivity to quinolone, we isolated spontaneous nalidixic acid-resistant mutants by plating sensitive E. coli isolates on 50 μg/ml nalidixic acid. Similar to the isolation of the streptomycin mutants, we obtained mutants with previously reported substitutions in the target gene, gyrA (Table 2). We identified five D87G substitutions and three S83L substitutions in the gyrA gene product. These results corroborate another study on pathogenic E. coli, which showed that 37 out of 38 isolated quinolone-resistant gyrA mutants have substitutions at either S83, D87, or both. Out of 36 pathogenic E. coli isolates resistant to high levels of nalidixic acid (MIC ≥ 256 μg/ml), 35 had at least one mutation in gyrA (4). Here, as with the isolation of streptomycin-resistant mutants, the fact that most of the spontaneous mutations are located in the target gene highlights the potential benefit of reversing the effects of these mutations. We next introduced the wt gyrA expressed from its endogenous promoter or a control construct, both linked to tellurite resistance genes, into λ phages, designated λ-GyrA-tell and λ-Ctrl-tell, respectively. We used these phages to lysogenize a nalidixic acid-resistant strain, Nal2, harboring an S83L substitution in GyrA. The lysogens were selected on 4 μg/ml tellurite and tested for sensitization by measuring MICs as described above, using nalidixic acid instead of streptomycin. As shown in Fig. 5, the gyrA construct significantly reversed the mutant's resistance. The MIC of the resistant mutants decreased 2-fold when lysogenized by a gyrA-bearing phage compared to the control phage. The significance of this sensitization was confirmed by experiments in which we transformed gyrA-bearing plasmids into nalidixic acid-resistant mutants and observed a decrease by 3 orders of magnitude in the number of CFU on 50 μg/ml nalidixic acid compared to resistant cells transformed with a mock plasmid (see Fig. S1 in the supplemental material). Overall, these results indicate that the proposed system can be used to target nalidixic acid resistance, as well as streptomycin resistance.

Fig 5.

Fig 5

gyrA introduced by phage λ sensitizes a nalidixic acid-resistant mutant. Phage λ carrying a single copy of wt gyrA (λ-GyrA-tell) sensitizes a nalidixic acid-resistant mutant, Nal2, compared to phage λ carrying a mock gene (λ-Ctrl-tell). Triplicates of the different lysogens, at 104 CFU/spot, were spotted on plates with the indicated streptomycin concentrations. Tellurite was supplemented at 4 μg/ml in all plates. The plates were incubated overnight and photographed using MiniBis Pro (Bio-Imaging Systems). A representative experiment out of three is presented.

Proposed application, safety measures, and advantages of the system.

The proof of principle presented here is a step toward solving the major threat of emerging drug-resistant pathogens, against which we have limited new emerging antibiotic weapons. It demonstrates that with simple genetic engineering, bacteria can be resensitized to approved and useful antibiotics. It is suggested that the system be applied in a simple treatment of hospital surfaces to reverse the resistance of nosocomial pathogens. Phages against Listeria monocytogenes (ListShield) and E. coli (EcoShield) are used to spray ready-to-eat food and effectively target the contaminating pathogen (5). Phages are also used in the United States as effective pesticides on edible crops, among others (5). Although the above-mentioned applications used non-genetically altered phages, they support the safety and efficacy of our proposed spraying of phages on hospital surfaces. The proposed uses and advantages of the system are presented in Table 3. Extended transfer of the sensitizing cassette by specifically constructed lysogenizing phages might enrich for antibiotic-treatable pathogens on hospital surfaces. This enriched sensitive population might then interfere with the establishment of newly introduced resistant pathogens by overtaking their ecological niche. Our approach differs from conventional phage therapy in that it does not use phages to kill the pathogens directly. Consequently, there is no selection against the phage used, but rather, selection for pathogens harboring the phage because it contains tellurite resistance. Moreover, the approach avoids the use of phage inside the patient's body, thus overcoming toxicity issues and other drawbacks of phage therapy, such as phage neutralization by the spleen and the immune system (11). The system presented makes use of a temperate phage whose lytic cycle is induced at elevated temperatures (8). This feature carries added value because in the environment, as long as the temperature is below 32°C, there is only selective pressure for being lysogenized and taking up the sensitizing genes linked to the tellurite resistance marker. However, once the pathogens are lysogenized, they are less bound to infect humans or other warm-blooded animals, because such an infection would induce the lytic cycle of the prophage and consequently kill the bacteria. This added benefit is not essential for a future product but is an optional addition. If successful, this approach will render most of the nosocomial infections treatable by antibiotics, unlike the current situation, in which most nosocomial infections are caused by antibiotic-resistant pathogens. The sensitizing cassette may be expanded to include other sensitizing genes, such as thyA, conferring dominant sensitivity to trimethoprim (20). Designing several antibiotic-sensitizing genes on a single construct reduces the probability of spontaneous regaining of resistance against all of these antibiotics simultaneously. We believe that the provided proof of principle can be applied to different pathogen-phage systems, as the extensive coevolution of phages and bacteria suggests that it is possible to find lysogenizing phages specific to any bacterium. For example, the described system could be modified quite simply to target pathogenic E. coli (e.g., E. coli O104:H4) by carrying out several selection cycles of the described λ phage on the desired host until the phage becomes fully adapted to it. In addition, the dominant sensitivity of both rpsL and gyrA alleles has been shown to be broad across bacterial species e.g., (2, 12, 17). Along with the proof of principle, we also demonstrate a simple procedure for creating an efficient barrier against homologous recombination. The procedure includes replacement of most of the wobble bases, thus reducing the identity between genes, as well as eliminating the minimal efficient processing segment for homologous recombination, without significantly affecting the translated product. This procedure can be carried out with currently available technology for basically any desired gene, as synthetic gene production has become common practice. Further manipulations to reduce the possibility of tellurite resistance being horizontally transferred without the sensitization cassette can be designed in a future product. For example, the sensitization genes can be constructed so that their presence is essential for acquisition of tellurite resistance: the sensitizing genes would be preferentially positioned before a promoterless tellurite resistance gene, making tellurite resistance dependent on expression of the sensitizing genes. In addition to the system's benefits, which can be improved by implementing the above-mentioned safety measures, these phages are simple to prepare and to apply, constituting a great advantage. Broad use of the proposed system, in contrast to antibiotics and phage therapy, will potentially change the nature of nosocomial infections by making the bacteria more susceptible to antibiotics rather than more resistant.

Table 3.

Proposed procedure for using the lysogenizing phages and the selection agent (tellurite) compared to the current cleaning and disinfecting procedures in hospitals

Surface treatment/frequency Current procedure Proposed procedure Advantage of proposed procedure
Floor/furniture cleansing
    Soap Used Used Renders bacteria drug sensitive
    Lysogenizing phages Not used Used
Disinfection
    Disinfectant Used Used Selects for drug-sensitive residual bacteria to occupy ecological niche
    Tellurite Not used Used
Frequency
    Daily Used Used Repeated usage results in more sensitive clones

Supplementary Material

Supplemental material

ACKNOWLEDGMENTS

We are indebted to Charles C. Richardson for reagents and support. We thank Nir Osherov for critical reading of the manuscript and Camille Vainstein for professional language editing.

This research was supported by Israel Science Foundation grant 611/10, Binational Science Foundation grant 2009218, German-Israel Foundation grant 2061/2009, and Marie Curie International Reintegration Grants PIRG-GA-2009-256340 and GA-2010-266717.

Footnotes

Published ahead of print 23 November 2011

Supplemental material for this article may be found at http://aem.asm.org/.

REFERENCES

  • 1. Brussow H. 2005. Phage therapy: the Escherichia coli experience. Microbiology 151:2133–2140 [DOI] [PubMed] [Google Scholar]
  • 2. Drecktrah D, Douglas JM, Samuels DS. 2010. Use of rpsL as a counterselectable marker in Borrelia burgdorferi. Appl. Environ. Microbiol. 76:985–987 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3. Kimchi-Sarfaty C, et al. 2007. A “silent” polymorphism in the MDR1 gene changes substrate specificity. Science 315:525–528 [DOI] [PubMed] [Google Scholar]
  • 4. Komp Lindgren P, Karlsson A, Hughes D. 2003. Mutation rate and evolution of fluoroquinolone resistance in Escherichia coli isolates from patients with urinary tract infections. Antimicrob. Agents Chemother. 47:3222–3232 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5. Lang LH. 2006. FDA approves use of bacteriophages to be added to meat and poultry products. Gastroenterology 131:1370. [DOI] [PubMed] [Google Scholar]
  • 6. Lederberg J. 1951. Streptomycin resistance; a genetically recessive mutation. J. Bacteriol. 61:549–550 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7. Levy SB, Marshall B. 2004. Antibacterial resistance worldwide: causes, challenges and responses. Nat. Med. 10:S122–S129 [DOI] [PubMed] [Google Scholar]
  • 8. Lieb M. 1964. Ultraviolet sensitivity of Escherichia coli containing heat-inducible lambda prophages. Science 145:175–176 [DOI] [PubMed] [Google Scholar]
  • 9. Liu M, Taylor DE. 1999. Characterization of gram-positive tellurite resistance encoded by the Streptococcus pneumoniae tehB gene. FEMS Microbiol. Lett. 174:385–392 [DOI] [PubMed] [Google Scholar]
  • 10. Lu TK, Collins JJ. 2009. Engineered bacteriophage targeting gene networks as adjuvants for antibiotic therapy. Proc. Natl. Acad. Sci. U. S. A. 106:4629–4634 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11. Merril CR, Scholl D, Adhya SL. 2003. The prospect for bacteriophage therapy in Western medicine. Nat. Rev. Drug Discov. 2:489–497 [DOI] [PubMed] [Google Scholar]
  • 12. Robillard NJ. 1990. Broad-host-range gyrase A gene probe. Antimicrob. Agents Chemother. 34:1889–1894 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13. Sharan SK, Thomason LC, Kuznetsov SG, Court DL. 2009. Recombineering: a homologous recombination-based method of genetic engineering. Nat. Protoc. 4:206–223 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14. Shen P, Huang HV. 1986. Homologous recombination in Escherichia coli: dependence on substrate length and homology. Genetics 112:441–457 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15. Shi R, Zhang J, Li C, Kazumi Y, Sugawara I. 2007. Detection of streptomycin resistance in Mycobacterium tuberculosis clinical isolates from China as determined by denaturing HPLC analysis and DNA sequencing. Microbes Infect. 9:1538–1544 [DOI] [PubMed] [Google Scholar]
  • 16. Sreevatsan S, et al. 1996. Characterization of rpsL and rrs mutations in streptomycin-resistant Mycobacterium tuberculosis isolates from diverse geographic localities. Antimicrob. Agents Chemother. 40:1024–1026 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17. Sung CK, Li H, Claverys JP, Morrison DA. 2001. An rpsL cassette, janus, for gene replacement through negative selection in Streptococcus pneumoniae. Appl. Environ. Microbiol. 67:5190–5196 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18. Timms AR, Steingrimsdottir H, Lehmann AR, Bridges BA. 1992. Mutant sequences in the rpsL gene of Escherichia coli B/r: mechanistic implications for spontaneous and ultraviolet light mutagenesis. Mol. Gen. Genet. 232:89–96 [DOI] [PubMed] [Google Scholar]
  • 19. Wiegand I, Hilpert K, Hancock RE. 2008. Agar and broth dilution methods to determine the minimal inhibitory concentration (MIC) of antimicrobial substances. Nat. Protoc. 3:163–175 [DOI] [PubMed] [Google Scholar]
  • 20. Wong QN, et al. 2005. Efficient and seamless DNA recombineering using a thymidylate synthase A selection system in Escherichia coli. Nucleic Acids Res. 33:e59. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21. Wright A, Hawkins CH, Anggard EE, Harper DR. 2009. A controlled clinical trial of a therapeutic bacteriophage preparation in chronic otitis due to antibiotic-resistant Pseudomonas aeruginosa; a preliminary report of efficacy. Clin. Otolaryngol. 34:349–357 [DOI] [PubMed] [Google Scholar]
  • 22. Zannoni D, Borsetti F, Harrison JJ, Turner RJ. 2008. The bacterial response to the chalcogen metalloids Se and Te. Adv. Microb. Physiol. 53:1–72 [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplemental material

Articles from Applied and Environmental Microbiology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES