Abstract
A mitochondrial aspartate tRNA (anticodon GUC) was isolated from a transplantable rat tumor, Morris hepatoma 5123D, and sequenced. The sequence, pGAGAUAUUm(1)AGUAAAAUAAUUACA psi AACCUUGUCAAGGUUAAGUUAUAGACUUAAAUCUAUAUAUCUUACCAOH, can be arranged in a cloverleaf structure. The RNA exhibits a number of unusual features, such as lack of the constant -G-G- and -T-psi-C- sequences in loops I and IV, respectively, small size of these loops, lack of the constant G.C base pair adjacent to loop IV, predominance of A.U base pairs in general, and presence of m1A in position 9. The RNA exhibits 82 and 70% homology with the DNA-derived putative sequences of human placenta and beef heart mitochondrial tRNA Asp, respectively, and bears little resemblance to other sequenced aspartate tRNAs of non-mitochondrial origin.
Full text
PDF






Images in this article
Selected References
These references are in PubMed. This may not be the complete list of references from this article.
- Allen J. A., Coombs M. M. Covalent binding of polycyclic aromatic compounds to mitochondrial and nuclear DNA. Nature. 1980 Sep 18;287(5779):244–245. doi: 10.1038/287244a0. [DOI] [PubMed] [Google Scholar]
- Arcari P., Brownlee G. G. The nucleotide sequence of a small (3S) seryl-tRNA (anticodon GCU) from beef heart mitochondria. Nucleic Acids Res. 1980 Nov 25;8(22):5207–5212. doi: 10.1093/nar/8.22.5207. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Backer J. M., Weinstein I. B. Mitochondrial DNA is a major cellular target for a dihydrodiol-epoxide derivative of benzo[a]pyrene. Science. 1980 Jul 11;209(4453):297–299. doi: 10.1126/science.6770466. [DOI] [PubMed] [Google Scholar]
- Baer R. J., Dubin D. T. The sequence of a possible 5S RNA-equivalent in hamster mitochondria. Nucleic Acids Res. 1980 Aug 25;8(16):3603–3610. doi: 10.1093/nar/8.16.3603. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Barrell B. G., Anderson S., Bankier A. T., de Bruijn M. H., Chen E., Coulson A. R., Drouin J., Eperon I. C., Nierlich D. P., Roe B. A. Different pattern of codon recognition by mammalian mitochondrial tRNAs. Proc Natl Acad Sci U S A. 1980 Jun;77(6):3164–3166. doi: 10.1073/pnas.77.6.3164. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Barrell B. G., Bankier A. T., Drouin J. A different genetic code in human mitochondria. Nature. 1979 Nov 8;282(5735):189–194. doi: 10.1038/282189a0. [DOI] [PubMed] [Google Scholar]
- Brown W. M., George M., Jr, Wilson A. C. Rapid evolution of animal mitochondrial DNA. Proc Natl Acad Sci U S A. 1979 Apr;76(4):1967–1971. doi: 10.1073/pnas.76.4.1967. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Chia L. L., Morris H. P., Randerath K., Randerath E. Base composition studies on mitochondrial 4 S RNA from rat liver and Morris hepatomas 5123D and 7777. Biochim Biophys Acta. 1976 Feb 18;425(1):49–62. doi: 10.1016/0005-2787(76)90215-x. [DOI] [PubMed] [Google Scholar]
- Dawid I. B. Evolution of mitochondrial DNA sequences in Xenopus. Dev Biol. 1972 Oct;29(2):139–151. doi: 10.1016/0012-1606(72)90051-6. [DOI] [PubMed] [Google Scholar]
- Gangloff J., Keith G., Ebel J. P., Dirheimer G. The primary structure of aspartate transfer ribonucleic acid from brewer's yeast. II. Partial digestions with pancreatic ribonuclease and T 1 ribonuclease and derivation of complete sequence. Biochim Biophys Acta. 1972 Jan 31;259(2):210–222. [PubMed] [Google Scholar]
- Gauss D. H., Sprinzl M. Compilation of tRNA sequences. Nucleic Acids Res. 1981 Jan 10;9(1):r1–23. [PMC free article] [PubMed] [Google Scholar]
- Gupta R. C., Randerath K. Rapid print-readout technique for sequencing of RNA's containing modified nucleotides. Nucleic Acids Res. 1979 Aug 10;6(11):3443–3458. doi: 10.1093/nar/6.11.3443. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Gupta R. C., Roe B. A., Randerath K. Sequence of human glycine transfer ribonucleic acid (anticodon CCC). Determination by a newly developed thin-layer readout sequencing technique and comparison with other glycine transfer ribonucleic acids. Biochemistry. 1980 Apr 15;19(8):1699–1705. doi: 10.1021/bi00549a028. [DOI] [PubMed] [Google Scholar]
- Harada F., Yamaizumi K., Nishimura S. Oligonucleotide sequences of RNase T 1 and pancreatic RNase digests of E. coli aspartic acid tRNA. Biochem Biophys Res Commun. 1972 Dec 18;49(6):1605–1609. doi: 10.1016/0006-291x(72)90525-6. [DOI] [PubMed] [Google Scholar]
- Malkin L. I. Minor species of ribonucleic acid associated with rat liver mitochondria. Biochemistry. 1971 Dec 7;10(25):4752–4756. doi: 10.1021/bi00801a023. [DOI] [PubMed] [Google Scholar]
- Niranjan B. G., Avadhani N. G. Activation of aflatoxin B1 by a mono-oxygenase system localized in rat liver mitochondria. J Biol Chem. 1980 Jul 25;255(14):6575–6578. [PubMed] [Google Scholar]
- Pedersen P. L. Tumor mitochondria and the bioenergetics of cancer cells. Prog Exp Tumor Res. 1978;22:190–274. doi: 10.1159/000401202. [DOI] [PubMed] [Google Scholar]
- RajBhandary U. L., Chang S. H. Studies on polynucleotides. LXXXII. Yeast phenylalanine transfer ribonucleic acid: partial digestion with ribonuclease T-1 and derivation of the total primary structure. J Biol Chem. 1968 Feb 10;243(3):598–608. [PubMed] [Google Scholar]
- Randerath E., Gupta R. C., Morris H. P., Randerath K. Isolation and sequence analysis of two major leucine transfer ribonucleic acids (anticodon Mm-A-A) from a rat tumor, Morris hepatoma 5123D. Biochemistry. 1980 Jul 22;19(15):3476–3483. doi: 10.1021/bi00556a011. [DOI] [PubMed] [Google Scholar]
- Randerath K., Gupta R. C., Randerath E. 3H and 32P derivative methods for base composition and sequence analysis of RNA. Methods Enzymol. 1980;65(1):638–680. doi: 10.1016/s0076-6879(80)65065-4. [DOI] [PubMed] [Google Scholar]
- Rich A., RajBhandary U. L. Transfer RNA: molecular structure, sequence, and properties. Annu Rev Biochem. 1976;45:805–860. doi: 10.1146/annurev.bi.45.070176.004105. [DOI] [PubMed] [Google Scholar]
- Schoemaker H. J., Schimmel P. R. Effect of aminoacyl transfer RNA synthetases on H-5 exchange of specific pyrimidines in transfer RNAs. Biochemistry. 1977 Dec 13;16(25):5454–5460. doi: 10.1021/bi00644a009. [DOI] [PubMed] [Google Scholar]
- Wunderlich V., Tetzlaff I., Graffi A. Studies on nitrosodimethylamine: preferential methylation of mitochondrial DNA in rats and hamsters. Chem Biol Interact. 1972 Jan;4(2):81–89. doi: 10.1016/0009-2797(72)90001-4. [DOI] [PubMed] [Google Scholar]
- Young I. G., Anderson S. The genetic code in bovine mitochondria: sequence of genes for the cytochrome oxidase subunit II and two tRNAs. Gene. 1980 Dec;12(3-4):257–265. doi: 10.1016/0378-1119(80)90108-0. [DOI] [PubMed] [Google Scholar]
- de Bruijn M. H., Schreier P. H., Eperon I. C., Barrell B. G., Chen E. Y., Armstrong P. W., Wong J. F., Roe B. A. A mammalian mitochondrial serine transfer RNA lacking the "dihydrouridine" loop and stem. Nucleic Acids Res. 1980 Nov 25;8(22):5213–5222. doi: 10.1093/nar/8.22.5213. [DOI] [PMC free article] [PubMed] [Google Scholar]

