Abstract
Spinacia oleracia cholorplast 5S ribosomal RNA was end-labeled with [32P] and the complete nucleotide sequence was determined. The sequence is: pUAUUCUGGUGUCCUAGGCGUAGAGGAACCACACCAAUCCAUCCCGAACUUGGUGGUUAAACUCUACUGCGGUGACGAU ACUGUAGGGGAGGUCCUGCGGAAAAAUAGCUCGACGCCAGGAUGOH. This sequence can be fitted to the secondary structural model proposed for prokaryotic 5S ribosomal RNAs by Fox and Woese (1). However, the lengths of several single- and double-stranded regions differ from those common to prokaryotes. The spinach chloroplast 5S ribosomal RNA is homologous to the 5S ribosomal RNA of Lemna chloroplasts with the exception that the spinach RNA is longer by one nucleotide at the 3' end and has a purine base substitution at position 119. The sequence of spinach chloroplast 5S RNA is identical to the chloroplast 5S ribosomal RNA gene of tobacco. Thus the structures of the chloroplast 5S ribosomal RNAs from some of the higher plants appear to be almost totally conserved. This does not appear to be the case for the higher plant cytoplasmic 5S ribosomal RNAs.
Full text
PDF




Selected References
These references are in PubMed. This may not be the complete list of references from this article.
- Bohnert H. J., Gordon K. H., Crouse E. J. Homologies among ribosomal RNA and messenger RNA genes in chloroplasts, mitochondria and E. coli. Mol Gen Genet. 1980;179(3):539–545. doi: 10.1007/BF00271743. [DOI] [PubMed] [Google Scholar]
- Corry M. J., Payne P. I., Dyer T. A. The nucleotide sequence of 5 S rRNA from the blue-green alga Anacystis nidulans. FEBS Lett. 1974 Sep 15;46(1):63–66. doi: 10.1016/0014-5793(74)80335-2. [DOI] [PubMed] [Google Scholar]
- Donis-Keller H., Maxam A. M., Gilbert W. Mapping adenines, guanines, and pyrimidines in RNA. Nucleic Acids Res. 1977 Aug;4(8):2527–2538. doi: 10.1093/nar/4.8.2527. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Dyer T. A., Bowman C. M. Nucleotide sequences of chloroplast 5S ribosomal ribonucleic acid in flowering plants. Biochem J. 1979 Dec 1;183(3):595–604. doi: 10.1042/bj1830595. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Erdmann V. A. Collection of published 5S and 5.8S RNA sequences and their precursors. Nucleic Acids Res. 1981 Jan 10;9(1):r25–r42. doi: 10.1093/nar/9.1.213-a. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Fox G. E., Woese C. R. 5S RNA secondary structure. Nature. 1975 Aug 7;256(5517):505–507. doi: 10.1038/256505a0. [DOI] [PubMed] [Google Scholar]
- Kashdan M. A., Pirtle R. M., Pirtle I. L., Calagan J. L., Vreman H. J., Dudock B. S. Nucleotide sequence of a spinach chloroplast threonine tRNA. J Biol Chem. 1980 Sep 25;255(18):8831–8835. [PubMed] [Google Scholar]
- Mackay R. M., Spencer D. F., Doolittle W. F., Gray M. W. Nucleotide sequences of wheat-embryo cytosol 5-S and 5.8-S ribosomal ribonucleic acids. Eur J Biochem. 1980 Dec;112(3):561–576. doi: 10.1111/j.1432-1033.1980.tb06122.x. [DOI] [PubMed] [Google Scholar]
- Payne P. I., Dyer T. A. Evidence for the nucleotide sequence of 5-S rRNA from the flowering plant Secale cereale (Rye). Eur J Biochem. 1976 Dec;71(1):33–38. doi: 10.1111/j.1432-1033.1976.tb11086.x. [DOI] [PubMed] [Google Scholar]
- Pirtle R., Kashdan M., Pirtle I., Dudock B. The nucleotide sequence of a major species of leucine tRNA from bovine liver. Nucleic Acids Res. 1980 Feb 25;8(4):805–815. [PMC free article] [PubMed] [Google Scholar]
- Sanger F., Donelson J. E., Coulson A. R., Kössel H., Fischer D. Use of DNA polymerase I primed by a synthetic oligonucleotide to determine a nucleotide sequence in phage fl DNA. Proc Natl Acad Sci U S A. 1973 Apr;70(4):1209–1213. doi: 10.1073/pnas.70.4.1209. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Silberklang M., Prochiantz A., Haenni A. L., Rajbhandary U. L. Studies on the sequence of the 3'-terminal region of turnip-yellow-mosaic-virus RNA. Eur J Biochem. 1977 Feb;72(3):465–478. doi: 10.1111/j.1432-1033.1977.tb11270.x. [DOI] [PubMed] [Google Scholar]
- Stanley J., Vassilenko S. A different approach to RNA sequencing. Nature. 1978 Jul 6;274(5666):87–89. doi: 10.1038/274087a0. [DOI] [PubMed] [Google Scholar]
