Skip to main content
NCBI home page
Nucleic Acids Research logoLink to Nucleic Acids Research
. 1982 Dec 20;10(24):8307–8310. doi: 10.1093/nar/10.24.8307

Two thraustochytrid 5S ribosomal RNAs.

R M MacKay, W F Doolittle
PMCID: PMC327087  PMID: 7162992

Abstract

The complete nucleotide sequences of the 5S ribosomal RNAs (rRNAs) of two thraustochytrids, Thraustochytrium visurgense and Schizochytrium, aggregatum, are AUGAGCCCUCAUAUCAUGUGGAGUGCACCGGAUCUCAUCCGAACUCCGUAGUUAAGCCACAUAGAGCGCGUC UAGUACUGCCGUAGGGGACUAGGUGGGAAGCACGCGUGGGGCUCAUU and ACAGCCGUUCAUACCACACGGAGA AUACCGGAUCUCGUUCGAACUCCGCAGUCAAGCCGUGUCGGGCGUGCUCAGUACUACCAUAGGGGACUGGGUGGGA AGCGUGCGUGACGGCUGUU, respectively. These sequences are discussed in terms of the apparent unity in secondary structure and strong divergence in primary structure exhibited by protist 5S rRNAs.

Full text

PDF
8307

Selected References

These references are in PubMed. This may not be the complete list of references from this article.

  1. Delihas N., Andersen J., Andresini W., Kaufman L., Lyman H. The 5S ribosomal RNA of Euglena gracilis cytoplasmic ribosomes is closely homologous to the 5S RNA of the trypanosomatid protozoa. Nucleic Acids Res. 1981 Dec 11;9(23):6627–6633. doi: 10.1093/nar/9.23.6627. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Donis-Keller H. Phy M: an RNase activity specific for U and A residues useful in RNA sequence analysis. Nucleic Acids Res. 1980 Jul 25;8(14):3133–3142. doi: 10.1093/nar/8.14.3133. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Erdmann V. A. Collection of published 5S and 5.8S RNA sequences and their precursors. Nucleic Acids Res. 1982 Jan 22;10(2):r93–115. doi: 10.1093/nar/10.2.762-c. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Hinnebusch A. G., Klotz L. C., Blanken R. L., Loeblich A. R., 3rd An evaluation of the phylogenetic position of the dinoflagellate Crypthecodinium cohnii based on 5S rRNA characterization. J Mol Evol. 1981;17(6):334–337. doi: 10.1007/BF01734355. [DOI] [PubMed] [Google Scholar]
  5. Hori H., Osawa S., Iwabuchi M. The nucleotide sequence of 5S rRNA from a cellular slime mold Dictyostelium discoideum. Nucleic Acids Res. 1980 Dec 11;8(23):5535–5539. doi: 10.1093/nar/8.23.5535. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Luehrsen K. R., Fox G. E. Secondary structure of eukaryotic cytoplasmic 5S ribosomal RNA. Proc Natl Acad Sci U S A. 1981 Apr;78(4):2150–2154. doi: 10.1073/pnas.78.4.2150. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. MacKay R. M., Gray M. W., Doolittle W. F. Nucleotide sequence of Crithidia fasciculata cytosol 5S ribosomal ribonucleic acid. Nucleic Acids Res. 1980 Nov 11;8(21):4911–4917. doi: 10.1093/nar/8.21.4911. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. MacKay R. M., Spencer D. F., Schnare M. N., Doolittle W. F., Gray M. W. Comparative sequence analysis as an approach to evaluating structure, function, and evolution of 5S and 5.8S ribosomal RNAs. Can J Biochem. 1982 Apr;60(4):480–489. doi: 10.1139/o82-057. [DOI] [PubMed] [Google Scholar]
  9. Miyazaki M. Studies on the nucleotide sequence of pseudouridine-containing 5S RNA from Saccharomyces cerevisiae. J Biochem. 1974 Jun;75(6):1407–1410. doi: 10.1093/oxfordjournals.jbchem.a130532. [DOI] [PubMed] [Google Scholar]
  10. Peattie D. A. Direct chemical method for sequencing RNA. Proc Natl Acad Sci U S A. 1979 Apr;76(4):1760–1764. doi: 10.1073/pnas.76.4.1760. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Perkins F. O. The ultrastructure of holdfasts, "rhizoids", and "slime tracks" in Thraustochytriaceous fungi and Labyrinthula spp. Arch Mikrobiol. 1972;84(2):95–118. doi: 10.1007/BF00412431. [DOI] [PubMed] [Google Scholar]

Articles from Nucleic Acids Research are provided here courtesy of Oxford University Press

RESOURCES