AUTHOR'S CORRECTION
Volume 31, no. 13, p. 2696–2706, 2011. Page 2698, Fig. 2A: The sequence for the full mutant 3′UTR should read GGGAUCGGCACCAGUGUGAAUGCGUGUCUUAUGGA….
. 2012 Feb;32(4):898. doi: 10.1128/MCB.06639-11
A Hypoxia-Induced Positive Feedback Loop Promotes Hypoxia-Inducible Factor 1α Stability through miR-210 Suppression of Glycerol-3-Phosphate Dehydrogenase 1-Like
Timothy J Kelly
1, Amanda L Souza
1, Clary B Clish
1, Pere Puigserver
1
Timothy J Kelly
1Department of Cancer Biology, Dana-Farber Cancer Institute, and Department of Cell Biology, Harvard Medical School, Boston, Massachusetts, USA; Department of Cell Biology, Johns Hopkins University School of Medicine, Baltimore, Maryland, USA; and Metabolite Profiling Initiative, Broad Institute of MIT and Harvard, Cambridge, Massachusetts, USA
Find articles by Timothy J Kelly
Amanda L Souza
1Department of Cancer Biology, Dana-Farber Cancer Institute, and Department of Cell Biology, Harvard Medical School, Boston, Massachusetts, USA; Department of Cell Biology, Johns Hopkins University School of Medicine, Baltimore, Maryland, USA; and Metabolite Profiling Initiative, Broad Institute of MIT and Harvard, Cambridge, Massachusetts, USA
Find articles by Amanda L Souza
Clary B Clish
1Department of Cancer Biology, Dana-Farber Cancer Institute, and Department of Cell Biology, Harvard Medical School, Boston, Massachusetts, USA; Department of Cell Biology, Johns Hopkins University School of Medicine, Baltimore, Maryland, USA; and Metabolite Profiling Initiative, Broad Institute of MIT and Harvard, Cambridge, Massachusetts, USA
Find articles by Clary B Clish
Pere Puigserver
1Department of Cancer Biology, Dana-Farber Cancer Institute, and Department of Cell Biology, Harvard Medical School, Boston, Massachusetts, USA; Department of Cell Biology, Johns Hopkins University School of Medicine, Baltimore, Maryland, USA; and Metabolite Profiling Initiative, Broad Institute of MIT and Harvard, Cambridge, Massachusetts, USA
Find articles by Pere Puigserver
1Department of Cancer Biology, Dana-Farber Cancer Institute, and Department of Cell Biology, Harvard Medical School, Boston, Massachusetts, USA; Department of Cell Biology, Johns Hopkins University School of Medicine, Baltimore, Maryland, USA; and Metabolite Profiling Initiative, Broad Institute of MIT and Harvard, Cambridge, Massachusetts, USA
Copyright © 2012, American Society for Microbiology. All Rights Reserved.
PMCID: PMC3272972
This corrects the article "A Hypoxia-Induced Positive Feedback Loop Promotes Hypoxia-Inducible Factor 1α Stability through miR-210 Suppression of Glycerol-3-Phosphate Dehydrogenase 1-Like
" in volume 31 on page 2696.