Skip to main content
NCBI home page
Nucleic Acids Research logoLink to Nucleic Acids Research
. 1981 Oct 24;9(20):5407–5410. doi: 10.1093/nar/9.20.5407

The nucleotide sequence of 5S rRNA from Mycoplasma capricolum.

H Hori, M Sawada, S Osawa, K Murao, H Ishikura
PMCID: PMC327528  PMID: 7301591

Abstract

The nucleotide sequence of 5S rRNA from Mycoplasma capricolum is UUGGUGGUAUAGCAUAGAGGUCACACCUGUUCCCAUGCCGAACACAGAAGUUAAGCUCUAUUACGGUGAAGAUAUUACU GAUGUGAGAAAAUAGCAAGCUGCCAGUUOH. The length is 107 nucleotides long, and the shortest in all the 5S rRNAs so far known. The sequence is more similar to those of the gram-positive bacteria than those of the gram-negative bacteria.

Full text

PDF
5407

Selected References

These references are in PubMed. This may not be the complete list of references from this article.

  1. Brownlee G. G., Sanger F., Barrell B. G. Nucleotide sequence of 5S-ribosomal RNA from Escherichia coli. Nature. 1967 Aug 12;215(5102):735–736. doi: 10.1038/215735a0. [DOI] [PubMed] [Google Scholar]
  2. Chang S. H., Brum C. K., Siberklang M., RajBhandary U. L., Hecker L. I., Barnett W. E. The first nucleotide sequence of an organelle transfer RNA: chloroplastic tRNAphe. Cell. 1976 Dec;9(4 Pt 2):717–723. doi: 10.1016/0092-8674(76)90135-5. [DOI] [PubMed] [Google Scholar]
  3. Herr W., Noller H. F. A fragment of 23S RNA containing a nucleotide sequence complementary to a region of 5S RNA. FEBS Lett. 1975 May 1;53(2):248–252. doi: 10.1016/0014-5793(75)80030-5. [DOI] [PubMed] [Google Scholar]
  4. Hori H., Osawa S. Evolutionary change in 5S RNA secondary structure and a phylogenic tree of 54 5S RNA species. Proc Natl Acad Sci U S A. 1979 Jan;76(1):381–385. doi: 10.1073/pnas.76.1.381. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Hori H., Osawa S., Murao K., Ishikura H. The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus. Nucleic Acids Res. 1980 Nov 25;8(22):5423–5426. doi: 10.1093/nar/8.22.5423. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. JONES A. S., WALKER R. T. Isolation and analysis of the deoxyribonucleic acid of Mycoplasma mycoides var. Capri. Nature. 1963 May 11;198:588–589. doi: 10.1038/198588a0. [DOI] [PubMed] [Google Scholar]
  7. Johnson J. D., Horowitz J. Characterization of ribosomes and RNAs from Mycoplasma hominis. Biochim Biophys Acta. 1971 Oct 14;247(2):262–279. doi: 10.1016/0005-2787(71)90675-7. [DOI] [PubMed] [Google Scholar]
  8. Kilpatrick M. W., Walker R. T. The nucleotide sequence of glycine tRNA from Mycoplasma mycoides sp. capri. Nucleic Acids Res. 1980 Jun 25;8(12):2783–2786. doi: 10.1093/nar/8.12.2783. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Kuchino Y., Kato M., Sugisaki H., Nishimura S. Nucleotide sequence of starfish initiator tRNA. Nucleic Acids Res. 1979 Aug 10;6(11):3459–3469. doi: 10.1093/nar/6.11.3459. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Maniloff J., Morowitz H. J. Cell biology of the mycoplasmas. Bacteriol Rev. 1972 Sep;36(3):263–290. doi: 10.1128/br.36.3.263-290.1972. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Marotta C. A., Varricchio F., Smith I., Weissman S. M. The primary structure of Bacillus subtilis and Bacillus stearothermophilus 5 S ribonucleic acids. J Biol Chem. 1976 May 25;251(10):3122–3127. [PubMed] [Google Scholar]
  12. Peattie D. A. Direct chemical method for sequencing RNA. Proc Natl Acad Sci U S A. 1979 Apr;76(4):1760–1764. doi: 10.1073/pnas.76.4.1760. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Razin S. Physiology of mycoplasmas. Adv Microb Physiol. 1973;10:1–80. doi: 10.1016/s0065-2911(08)60086-7. [DOI] [PubMed] [Google Scholar]
  14. Silberklang M., Prochiantz A., Haenni A. L., Rajbhandary U. L. Studies on the sequence of the 3'-terminal region of turnip-yellow-mosaic-virus RNA. Eur J Biochem. 1977 Feb;72(3):465–478. doi: 10.1111/j.1432-1033.1977.tb11270.x. [DOI] [PubMed] [Google Scholar]
  15. Stanley J., Vassilenko S. A different approach to RNA sequencing. Nature. 1978 Jul 6;274(5666):87–89. doi: 10.1038/274087a0. [DOI] [PubMed] [Google Scholar]
  16. Tully J. G., Barile M. F., Edward D. G., Theodore T. S., Erno H. Characterization of some caprine mycoplasmas, with proposals for new species, mycoplasma capricolum and mycoplasma putrefaciens. J Gen Microbiol. 1974 Nov;85(1):102–120. doi: 10.1099/00221287-85-1-102. [DOI] [PubMed] [Google Scholar]
  17. Walker R. T., RajBhandary U. L. The nucleotide sequence of formylmethionine tRNA from Mycoplasma mycoides sp. capri. Nucleic Acids Res. 1978 Jan;5(1):57–70. doi: 10.1093/nar/5.1.57. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Wallace D. C., Morowitz H. J. Genome size and evolution. Chromosoma. 1973;40(2):121–126. doi: 10.1007/BF00321457. [DOI] [PubMed] [Google Scholar]

Articles from Nucleic Acids Research are provided here courtesy of Oxford University Press

RESOURCES