Abstract
Huntington's disease (HD) is an autosomal dominant progressive neurodegenerative disorder caused by an expansion of a CAG/polyglutamine repeat for which there are no disease modifying treatments. In recent years, transcriptional dysregulation has emerged as a pathogenic process that appears early in disease progression and has been recapitulated across multiple HD models. Altered histone acetylation has been proposed to underlie this transcriptional dysregulation and histone deacetylase (HDAC) inhibitors, such as suberoylanilide hydroxamic acid (SAHA), have been shown to improve polyglutamine-dependent phenotypes in numerous HD models. However potent pan-HDAC inhibitors such as SAHA display toxic side-effects. To better understand the mechanism underlying this potential therapeutic benefit and to dissociate the beneficial and toxic effects of SAHA, we set out to identify the specific HDAC(s) involved in this process. For this purpose, we are exploring the effect of the genetic reduction of specific HDACs on HD-related phenotypes in the R6/2 mouse model of HD. The study presented here focuses on HDAC3, which, as a class I HDAC, is one of the preferred targets of SAHA and is directly involved in histone deacetylation. To evaluate a potential benefit of Hdac3 genetic reduction in R6/2, we generated a mouse carrying a critical deletion in the Hdac3 gene. We confirmed that the complete knock-out of Hdac3 is embryonic lethal. To test the effects of HDAC3 inhibition, we used Hdac3 +/− heterozygotes to reduce nuclear HDAC3 levels in R6/2 mice. We found that Hdac3 knock-down does not ameliorate physiological or behavioural phenotypes and has no effect on molecular changes including dysregulated transcripts. We conclude that HDAC3 should not be considered as the major mediator of the beneficial effect induced by SAHA and other HDAC inhibitors in HD.
Introduction
Huntington's disease (HD) is an autosomal dominant progressive neurodegenerative disorder with a mean age of onset of 40 years. The main clinical manifestations are chorea, cognitive impairment, psychiatric disorders and weight loss. The disease duration is 15–20 years and in the absence of disease modifying treatments, the disease progresses inexorably until death [1]. The mutation responsible for HD is an unstable expansion of a CAG repeat in the HTT gene that leads to a polyglutamine expansion in the N-terminus of the huntingtin (HTT) protein [2]. Neuropathologically, HD is characterized by neuronal loss in several brain regions including the striatum and the cortex as well as the deposition of nuclear and cytoplasmic HTT-containing aggregates [3].
A variety of mouse models have been used to study the pathogenic pathways involved in HD [4]. These include the R6/2 model, which is transgenic for a single-copy of exon 1 of human HTT, which in our colony carries approximately 200 CAG repeats [5], [6] and the HdhQ150 knock-in model in which 150 CAGs have been inserted into the mouse Htt gene [7], [8]. The R6/2 mouse has an early onset progressive phenotype that recapitulates many features of the human disease. Motor and cognitive impairment appear before 6 weeks, HTT aggregation can clearly be detected from 3 weeks, whereas neuronal cell loss in the striatum occurs at later stages [9], [10], [11]. Mice with an average 200 CAG repeats are not usually kept beyond 15 weeks. The early and reproducible phenotype of this mouse line has made it an ideal model screening compounds and performing genetic crosses. At late-stage disease, the R6/2 and HdhQ150 models have developed remarkably similar phenotypes [8], [12], [13], [14] supporting the hypothesis that the generation of a toxic fragment is a critical event in HD pathogenesis [15].
In recent years, transcriptional dysregulation has emerged as a pathogenic process that appears early in disease progression and has been recapitulated across multiple HD model systems including the R6/2 and HdhQ150 mouse models [12], [16]. Histone acetylation/deacetylation is an important mechanism involved in gene transcriptional regulation and altered histone acetylation has been proposed to underlie transcriptional dysregulation in HD [17]. In general, acetylation of lysines by histone acetyl transferases (HAT) leads to activation of transcription whereas removal of acetyl groups by histone deacetylases (HDAC) leads to gene silencing [18]. There are two evolutionary divergent types of HDACs: the zinc-dependent HDACs (human HDAC1-11) and the NAD+ dependent HDACs also called sirtuins (human SIRT1-7). Inhibitors of the zinc-dependant HDACs include suberoylanilide hydroxamic acid (SAHA) and trichostatin A (TSA) [19], whereas sirtuins are inhibited by nicotinamide [20]. The human zinc-dependent HDAC family comprises eleven members divided into four classes: I (HDAC1, 2, 3 and 8), IIa (HDAC4, 5, 7 and 9), IIb (HDAC6 and 10) and IV (HDAC11). HDAC inhibition has been shown to improve polyglutamine-dependent phenotypes in several models of HD [21], [22], [23], [24], [25], [26]. Although administration of SAHA improves HD-related phenotypes in the R6/2 mouse model, therapeutic doses have toxic effects and induce profound weight loss [24].
To better understand the mechanism underlying this potential therapeutic benefit and to dissociate the beneficial and toxic effects of SAHA, we set out to identify the specific HDAC(s) involved in this process. For this purpose, we are exploring the effect of the genetic reduction of specific HDACs on HD-related phenotypes in R6/2 mice. Genetic reduction (knock-down or complete knock-out) of Hdac5, 6, 7 and 9 failed to induce a phenotypic improvement ([27], [28] and unpublished data) whereas knock-down of Hdac4 induces a significant beneficial effect (unpublished data).
The study presented here focuses on HDAC3, which is the most highly expressed class I HDAC in the brain [29]. This HDAC is of particular interest for several reasons. Class I HDACs are directly involved in histone deacetylation and as a class I HDAC, HDAC3 is one of the main cellular targets of SAHA [30]. A recent study showed that the class I inhibitor HDACi 4b, which is reported to be more specific for HDAC3 than the other class I HDACs, ameliorated the disease phenotype and reversed many of the transcriptional abnormalities found in the brain of R6/2 mice [26]. Moreover, studies involving genetic reduction of specific HDACs in invertebrate models of HD have implicated class I HDACs in the reduction of polyglutamine-dependent toxicity. In Drosophila melanosgaster, knock-down of the class I HDAC rpd3, that is homologous to human HDAC1/2 but also partially homologous to HDAC3, suppresses pathogenesis [31]. Similarly, in C. Elegans, only the knock-down of the hda-3, that shares homology with human class I HDACs, suppressed polyglutamine-dependant toxicity [21]. Finally, the catalytic domain of HDAC4 interacts with HDAC3 via the transcriptional corepressor complex N-CoR/SMRT, and suppression of HDAC4 binding to SMRT/N-CoR and to HDAC3 results in the loss of enzymatic activity associated with HDAC4 [32]. Given the beneficial effect of Hdac4 knock-down on HD-related phenotypes in R6/2 mice, we might expect that a reduction of Hdac3 expression would lead a reduced HDAC4 activity and an improvement in R6/2 phenotypes.
To evaluate a potential benefit of Hdac3 genetic reduction in R6/2, we generated a genetically engineered mouse in which part of the Hdac3 gene is deleted. We observed that a complete knock-out of Hdac3 is embryonic lethal. Hdac3 mRNA levels were reduced to 50% of wild type (WT) in the brains of Hdac3 +/− heterozygotes (knock-down) with a corresponding reduction in HDAC3 protein in the nucleus but not in the cytoplasm. We found that Hdac3 +/− heterozygotes are viable and fertile, with no overt phenotype. We performed a genetic cross between R6/2 mice and Hdac3+/− heterozygotes and found that Hdac3 knock-down does not ameliorate physiological or behavioural phenotypes in R6/2 mice, does not modulate HTT aggregation and has no effect on transcriptional dysregulation. We conclude that HDAC3 should not be considered as the major mediator of the beneficial effect induced by SAHA and other HDAC inhibitors in HD.
Results
Conventional heterozygous deletion of Hdac3
We generated a conventional null allele of Hdac3 in order to evaluate whether a reduction in HDAC3 level has beneficial effects in the R6/2 mice. For this purpose, loxP sites were introduced upstream of exon 11 and within exon 15 by homologous recombination inducing a deletion covering exon 11 to 14 and the 5′ end of exon 15 (Fig. 1A). This mutation removes a part of the nuclear localization signal and a C-terminal region necessary for both deacetylase activity and transcriptional repression [33], [34]. Heterozygous F1 mice were generated and deletion of Hdac3 was confirmed at the genomic level by PCR and sequencing (Fig. 1B). We intercrossed Hdac3+/− mice in order to generate nullizygotes, but did not obtain any Hdac3 knock-out offspring at birth or between embryonic stages E8.5 and E15.5. This result reveals that a complete lack of Hdac3 induces an embryonic lethality prior to E8.5 and confirms previous studies showing that Hdac3−/− mice die before E9.5 [35], [36]. Given this embryonic lethality we used Hdac3 +/− heterozygotes for our study. These mice are viable and fertile, with no overt phenotype.
Figure 1. Generation of an Hdac3 convention knock-out allele.
(A) Strategy to generate an Hdac3 conventional knock-out allele. The genomic structure and the targeting vector are shown. The Hdac3 gene contains 15 exons (blue rectangles). LoxP sites (red triangles) were introduced upstream exon 11 and within exon 15. The vector contains a 5′ homology arm covering the exonic and intronic region from intron 3–4 to intron 10–11 and a 3′ homology arm covering a part of exon 15 and the 3′UTR (green rectangle). The conditional knock-out region (yellow rectangle) covers exon 11 to 14 and 5′ end of exon 15. This conditional allele was introduced by homologous recombination in ES cells. The neomycine cassette (pink rectangle) flanked by 2 LoxP sites was removed by electroporation of Cre recombinase in ES cells and the cells containing the allele corresponding to a complete deletion of exon 11 to 14 were selected. Primers used for genotyping are represented as black arrows. F1 = forward 1; F2 = forward 2; R = Reverse. (B) Representative genotyping PCR on mouse genomic DNA. Duplex PCR with F1, F2 and R primers detects both the WT (250 bp band with primers F2/R) and the knock-out (500 bp with primers F1/R) allele.
It was important first to confirm that the Hdac3 expression level was reduced in Hdac3+/− mice as it has been previously shown that Hdac1, another class I HDAC, autoregulates its expression to wild-type (WT) levels in Hdac1 +/− heterozygous mice [37]. It was also important to determine whether Hdac3 levels might be regulated by the R6/2 transprotein. Therefore, we crossed R6/2 males to Hdac3 +/− heterozygous females to generate WT, Hdac3 +/−, R6/2 and R6/2::Hdac3 +/− double mutant (Dbl) mice and performed RT-qPCR on cDNA prepared from cortex, cerebellum and striatum of 15-week old mice. The RT-qPCR primer sequences were located within the deletion (at the junction between exon 14 and 15) so that only the WT allele can be detected. We observed a significant reduction of Hdac3 mRNA to 50% of the WT level in all the brain regions irrespective of the presence of the R6/2 transprotein (Fig. 2A). In order to verify the specificity of Hdac3 reduction we analyzed the expression level of the other Hdacs by RT-qPCR and showed that these were not changed in Hdac3+/− mice compared to WT (Fig. S1).
Figure 2. Hdac3 mRNA and protein expression in Hdac3+/− heterozygous mouse brain.
(A) Hdac3 mRNA expression levels in 15 week old mouse cortex, cerebellum and striatum are shown as a relative expression ratio to the WT level. Hdac3+/− (red) and Dbl (purple) mice express the mRNA at 50% of the WT (blue) and R6/2 (green) levels in all brain regions. Error bars correspond to S.E.M. (n = 8) ***p<0.001. (B) Western blot showing the expression of HDAC3 protein in the cytoplasmic (C) and the nuclear (N) fraction of WT mouse whole brain. Antibodies to α-tubulin (cytoplasmic) and histone H4 (nuclear) were used to control for the purity of the fractions. (C) Representative western blot and (D) quantification of cytoplasmic and nuclear fraction prepared from WT (blue), Hdac3+/− (red), R6/2 (green) and Dbl (purple) 15 week old-mouse whole brains. Antibodies to α-tubulin (cytoplasmic) and histone H4 (nuclear) were used as both purity and loading controls. Cytoplasmic HDAC3 was not affected by Hdac3 deletion whereas nuclear HDAC3 was reduced to 60% of the WT level. Error bars correspond S.E.M. (n = 3) *p<0.05.
In order to see whether this mRNA reduction translates into a reduction at the protein level, we performed western blotting on whole brain lysates using an HDAC3 specific antibody. Surprisingly, the protein level was only reduced to 80% of the WT level (Fig. S2). As HDAC3 is present in both the nucleus and the cytoplasm in mammalian cells [33], we investigated whether HDAC3 levels might differ between these two intracellular compartments. For this purpose, we performed nuclear and cytoplasmic fractionation of whole brains from 4 week old mice. We first confirmed that HDAC3 is present in both the nucleus and cytoplasm in WT mouse brain (Fig. 2B). Analysis of brains from WT, Hdac3+/−, R6/2 and Dbl mice revealed that cytoplasmic HDAC3 is not reduced in Hdac3 +/− and Dbl brains as compared to WT and R6/2. In contrast, its expression is reduced to 60% of the WT level in Hdac3 +/− heterozygotes irrespective of the presence of the R6/2 transgene (Fig. 2C and D). As we are primarily interested in the involvement of HDAC3 in transcriptional repression through histone deacetylation, a specific reduction of HDAC3 in the nucleus would be expected to be sufficient to mimic inhibition of HDAC3 histone deacetylase activity and explore its potential benefit in HD.
Genetic reduction of Hdac3 does not modify the R6/2 phenotype
A set of previously established quantitative tests was used to evaluate whether a genetic reduction of Hdac3 had an effect on HD-related phenotypes in R6/2 mice. In order to generate mice for this analysis, R6/2 males were bred with Hdac3 +/− females to generate at least 12 mice per genotype (males and females, WT n = 16, Hdac3+/− n = 14, R6/2 n = 12, Dbl n = 15). The mice were born over a period of 5 days and the 4 genotypes were recovered in a Mendelian ratio. The average CAG repeat size did not differ between the R6/2 group and the Dbl group (204±3.16 vs 205±0.91; p = 0.11). Body weight, RotaRod performance, grip strength and exploratory activity were monitored from 4 to 15 weeks of age, and in each case, a specific test was performed by the same operator, on the same day and at the same time during the weeks in which measurements were taken.
Mice were weighed weekly from 4 to 15 weeks of age. As expected, R6/2 mice weighed less overall than WT mice [F(1,49) = 32.657, p<0.001] and gained weight at a slower rate [F(4,539) = 38.086, p<0.001] (Fig. 3A). No significant differences in the overall weight [F(1,49) = 3.267, p = 0.077] or in weight gain [F(4,539) = 0.254, p = 0.887] between WT and Hdac3+/− mice were observed. However, there was a trend for Hdac3+/− mice to weigh more than WT (p = 0.077). Genetic reduction of Hdac3 had no effect on R6/2 weight [F(1,49) = 0.218, p = 0.643] and did not attenuate the rate of R6/2 weight loss [F(4,539) = 1.458, p = 0.222]. Therefore, genetic reduction of Hdac3+/− does not improve the weight loss phenotype in the R6/2 mice.
Figure 3. Hdac3 genetic reduction does not modify R6/2 phenotypes.
(A) Weight loss in males (left panel) and females (right panel) are shown between 4 and 15 weeks of age. Hdac3 genetic reduction did not induce a significant increase of the body weight in R6/2 (B) RotaRod performance is represented as the average latency to fall in each group at 4, 8, 10, 12 and 14 weeks. Hdac3 genetic reduction did not ameliorate the impairment in RotaRod performance in R6/2 (C) Average grip strength in each group is represented at 4, 11, 12, 13 and 14 weeks. Hdac3 genetic reduction did not induce a significant improvement in the grip strength in R6/2 mice (D) Average activity for each genotype is shown at 5 (upper panel) and 13 (lower panel) weeks of age. Hdac3 genetic reduction did not reverse the hypoactivity observed in R6/2 mice (E) Average brain weight for each group was measured at 15 weeks of age. Hdac3 genetic reduction did not modify the brain weight loss in R6/2 but a slight increase in brain weight was observed in WT animals **p<0.01. Error bars correspond to SEM (n>12). The same color code (blue = WT; red = Hdac3; green = R6/2 and purple = Dbl) was used for all measured parameters.
RotaRod performance is a sensitive indicator of balance and motor coordination, which has been reliably shown to decline in R6/2 mice. RotaRod was assessed at 4, 8, 10, 12 and 14 weeks of age. Consistent with previous data, R6/2 mice displayed a significant decline in overall RotaRod performance [F(1,49) = 75.523, p<0.001] and this worsened with age [F(3,980) = 23.764, p<0.001] (Fig. 3B). Hdac3 knock-down had no effect on overall RotaRod performance of Hdac3 +/− mice [F(1,49) = 0.386, p = 0.537] and did not significantly change the overall performance of R6/2 mice [F(1,49) = 0.478, p = 0.493]. Furthermore, Hdac3 knock-down had no effect on the deterioration of R6/2 RotaRod performance with age [F(3,980) = 0.344, p = 0.792].
Forelimb grip strength was assessed at 4 weeks of age and then weekly when the mice were 11 to 14 weeks old. Consistent with previous data, R6/2 mice performance was significantly decreased compared to WT [F(1,49) = 105.705, p<0.001] and deteriorated with age [F(3,392) = 25.804, p<0.001] (Fig. 3C). The grip strength of Hdac3 +/− mice was comparable to WT mice, both overall [F(1,49) = 0.230, p = 0.634] and over the course of the experiment [F(3,392) = 0.675, p = 0.586]. Furthermore, genetic reduction of Hdac3 did not improve R6/2 overall grip strength performance [F(1,49) = 0.603, p = 0.441] or deterioration with age [F(3,392) = 0.846, p = 0.483].
Exploratory activity was assessed fortnightly from 5 to 13 weeks of age as described previously and analyzed by repeated measures general linear model (GLM) ANOVA. Mice were assessed for a period of 30 min for total activity, rearing, centre rearing and mobility. The p-values obtained for each parameter are displayed in Table S1. For all genotypes, the mice are highly active and mobile during the first part of the assessment period and this decreased over the course of the 30 min (Fig. 3D and Fig. S3). R6/2 mice show an overall hypoactivity and decreased mobility relative to WT mice from 7 weeks onwards. Rearing and centre rearing are also significantly decreased in R6/2 mice from 9 and 11 weeks of age respectively. Hdac3+/− mice were indistinguishable from WT mice for all of the parameters. Furthermore, Hdac3 genetic reduction does not improve hypoactivity in the R6/2 mice.
Finally, we evaluated whether Hdac3 genetic reduction had an effect on brain weight. Loss of brain weight has been observed in R6/2 mice in previous studies [6]. Brains were harvested from mice at 15 weeks of age, at the end of the trial. As expected, R6/2 mice displayed a significant decrease in brain weight [F(1,49) = 182.333, p<0.001] (Fig. 3E). ANOVA analysis failed to detect any significant change in brain weight as a result of Hdac3 genetic reduction [F(1,49) = 1.865, p = 0.178]. Analysis of the results by Student's t-test revealed that Hdac3 knock-down induces a significant increase in brain weight in the WT context (p = 0.0074) but no significant change was observed in the transgenic context (Fig. 3E). The brain weight of the Dbl mice is not significantly different from R6/2 (p = 0.3857). This result suggests that Hdac3 knock-down has no effect on R6/2 mice brain weight loss.
Hdac3 genetic reduction does not ameliorate the dysregulated expression of genes of interest in R6/2 mouse brains
HDAC inhibitors have been shown to reverse transcriptional dysregulation in wide variety of HD models [17], [26], [38]. In order to evaluate whether a genetic reduction of Hdac3 might modulate the transcriptional changes observed in HD, we used RT-qPCR to analyze the expression level of a set of ‘genes of interest’ in different brain regions. This included cortical Bdnf as well as cerebellar and striatal genes that are dysregulated in HD mouse models [8], [12]. This analysis was performed on brain regions taken from 15 week old WT, Hdac3+/−, R6/2 and Dbl mice. Changes in gene expression induced by the transgene were consistent with previous results for all the genes that were tested (Fig. 4A, B, C). Genetic reduction of Hdac3 had no effect on the levels of the dysregulated transcripts in R6/2 brain regions except for Bdnf V (decreased expression, p = 0.037) and Cnr1 (increased expression, p = 0.028) for which very mild but statistically significant changes were observed in the cortex and in striatum respectively (Fig. 4A and C). Similarly Hdac3 genetic reduction had no effect on the expression of these genes in non-transgenic animals except for Cnr1 for which a significant decrease in expression was observed in Hdac3+/− compared to WT striata (p = 0.012; Fig. 4C). We also found that Hdac3 reduction does not affect the expression of the R6/2 transgene in the cortex (Fig. 4D), cerebellum (Fig. 4E) and striatum (Fig. 4F).
Figure 4. Hdac3 genetic reduction does not reverse transcriptional dysregulation in R6/2.
(A) Expression of Bdnf transcripts from different promoters (Bdnf I, IV and V) and the coding region (Bdnf B) in the cortex are represented as a percent of WT expression levels. With the exception of a slight decrease in Bdnf V, Hdac3 reduction did not affect Bdnf expression. (B) Expression levels of genes specifically altered in the cerebellum of R6/2 mice are represented as a percent of WT expression. No significant difference was induced by Hdac3 genetic reduction. (C) Expression levels of genes specifically altered in the striatum of R6/2 mice are represented as a percent of WT expression. A significant decrease in the expression of Cnr1 in non-transgenic animals was observed as well as a slightly significant increase in Cnr1 expression in R6/2 striata. Expression of the R6/2 transgene in Dbl brains is represented as a percent of that in R6/2 brains for cortex (D), cerebellum (E) and striatum (F). Hdac3 reduction did not induce a significant change in transgene expression. Error bars correspond to S.E.M. (n = 8) *p<0.05. The same color code (blue = WT; red = Hdac3; green = R6/2 and purple = Dbl) was used for all the graphs. Bdnf I, IV V, brain derived neurotrophic factor promoter I, IV, V; Bdnf B, brain derived neurotrophic factor coding exon B; Igfbp5, insulin-like growth factor binding protein 5; Kcnk2, potassium channel subfamily K, member 2; Nr4a2, nuclear receptor subfamily 4, group A, member 2; Pcp4, Purkinje cell protein 4; Uchl1, ubiquitin C-terminal hydrolase L1; Cnr1, cannabinoid receptor 1; Darpp32, dopamine and cAMP regulated neuronal phosphoprotein; Drd2, dopamine D2 receptor; Penk1, proenkephalin.
Hdac3 genetic reduction does not reduce Huntingtin aggregation in R6/2 mouse brains
HTT aggregation is a hallmark of brain pathology in HD and has been consistently observed in all HD models including the R6/2 mouse. Aggregation can be detected in several R6/2 brain regions from 3–4 weeks of age and increases with age [11]. In order to evaluate whether Hdac3 reduction has an effect on this aggregation, we used a SEPRION ligand-based ELISA that provides a highly quantitative assay for measuring HTT aggregation in mouse brains [14]. Aggregates were captured from proteins extracted from the cortex, hippocampus and brain stem of 4, 9 and 15 week-old mice and detected with the MW8 antibody [39]. As expected, HTT aggregation was detectable at 4 weeks in all three brain regions, increased with age and this was not modified by Hdac3 reduction. Levels of soluble HTT in these lysates can be quantified by western blot using the HTT specific antibody S830 [40]. The soluble trans-protein migrates at around 95 kDa whereas the aggregated protein remains in the stacking gel. Fig. 5B shows the results that we obtained for hippocampi from mice of 4, 9 and 15 weeks of age. The soluble fraction decreased with age in both R6/2 and Dbl mice and did not differ significantly between these genotypes at any time point (Fig. 5C). Similarly, a qualitative difference of the aggregated fraction was not detected. Taken together, the data obtained from the ELISA and western blotting revealed that Hdac3 genetic reduction has no effect on HTT aggregation.
Figure 5. Hdac3 genetic reduction does not reduce HTT aggregation in R6/2 mouse brain.
(A) The SEPRION ligand based ELISA assay was used to quantify HTT aggregation in the cortex, hippocampus and brain stem of 4, 9 and 15 week-old mice. The graphs represent the microtitre-plate reading of R6/2 (green) and Dbl (purple) lysates. Background readings obtained with WT and Hdac3 lysates were comparable to water. Aggregation levels augment with age but are not modified by Hdac3 reduction. Error bars correspond to S.E.M. (n>6). (B) Representative western blot of hippocampal lysates at 4, 9 and 15 weeks of age. The aggregated HTT fraction (stacking gel) augments with age whereas the soluble fraction decreases with age. α-tubulin was used as a loading control. (C) Quantification of (B). Soluble HTT is represented as a percentage of the soluble fraction in R6/2. Error bars correspond to S.E.M. (n = 6). The same color code (R6/2 = green; Dbl = purple) is used in (A) and (C).
Discussion
HDAC inhibitors were first investigated as therapeutics in the context of HD to counteract transcriptional dysregulation, thought to contribute to the molecular pathogenesis of HD. They were first shown to be protective in a Drosophila melanogaster model [25] and following on from the demonstration that SAHA, a potent HDAC inhibitor, improves HD-related phenotypes in the R6/2 mouse, (Hockly et al., 2003), protective effects of the butyrates in HD mouse models were also reported [22], [23]. However, therapeutic doses of SAHA were not well tolerated, leading to a marked weight loss in both WT and R6/2 animal. Therefore, if HDAC inhibitors are to be further developed as therapeutics for HD, it is essential that efficacy can be uncoupled from toxicity as far as is possible. As a pan-HDAC inhibitor, SAHA targets the eleven zinc-dependant HDACs with a preference for class I HDACs (1, 2, 3 and 8) and the class IIb HDAC, HDAC6 [30]. Identifying more specific inhibitors that target the HDAC(s) responsible for the beneficial effects observed in HD mouse models might be one mechanism by which the toxic effects could be diminished. Toward this aim, we are systematically investigating the effects of genetically reducing the levels of individual HDAC enzymes in the R6/2 mouse. In this study, we focus on HDAC3 and show that the reduction of nuclear HDAC3 to approximately 60% of WT levels has no effect on HD-related behavioral and physiological phenotypes or HTT aggregation. Importantly, the expression levels of a specific set of dysregulated gene transcripts were not restored.
HDAC3 was an interesting candidate for a number of reasons. The specific HDACs involved in the therapeutic benefits observed in invertebrate models of HD have also been explored by systematic genetic invalidation-based studies. Although a direct comparison with the mammalian enzymes cannot be made, as there are only four HDACs in Drosophila melanogaster and eight in Caenorhabditis elegans [21], [31] both studies pointed to the class I HDACs as being the critical mediators of the beneficial effects. In Drosophila melanogaster, rpd3 knock-down suppressed neurodegeneration and extended the survival of transgenic flies [31]. Rpd3 is a class I HDAC that shares amino-acid sequence similarities with human HDAC1, 2 and 3 at 82%, 76% and 57% respectively. In Caenorhabditis elegans, of the eight HDAC enzymes, it was only knock-down of Hda-3 that induced a neuroprotective effect, whereas knock-down of other HDACs, including the other class 1 orthologues Hda-1 and Hda-2, exacerbated toxicity [21]. However, it was a pharmacological study in the R6/2 mouse model of HD that indicated that HDAC3 rather than the other class I HDACs might be the most relevant in a mammalian system. HDACi 4b is one of a series of inhibitors for which the preferred cellular target has been reported to be HDAC3 [41]. HDACi 4b was shown to improve motor performance and body weight of R6/2 mice, associated with a reversal of histone H3 hypoacetylation and the correction of specific brain mRNA levels [26]. Given that we have found that the genetic reduction of HDAC4 has beneficial effects in the R6/2 mouse (unpublished data) and that the enzyme activity of HDAC4 is dependent on its presence in the multiprotein complex that contains HDAC3 and the SMRT/N-CoR transcriptional repressors [32], HDAC3 was a therapeutic target that merited further investigation.
Although HDAC3 is the most highly expressed HDAC in the brain [29] little is known about its function in the central nervous system. Specific silencing of Hdac3 in the hippocampus has been shown to lead to long-term memory enhancement [42]. The overexpression of Hdac3 in rat cerebellar neurons induces neuronal death whereas suppression of its expression by shRNA protects against low-potassium-induced neuronal death [43]. Unlike HDAC1 and 2, which are predominantly nuclear proteins, HDAC3 contains a nuclear export signal and is present in both the nucleus and the cytoplasm in mammalian cells [33], [44]. Investigations into the functions of the class I HDACs have been confined to their roles in the nucleus: HDACs 1 and 2 are part of the CoREST/mSin3a/NuRD repressor complex whereas HDAC3 interacts with NCoR/SMRT to repress gene expression [44], and in cortical neurons, HDAC3 is likely to be important for SMRT nuclear retention [45]. We were surprised to find that the cytoplasmic levels of HDAC3 in the brains of Hdac3+/− heterozygous mice were equivalent to that in WT brains, whereas nuclear levels were reduced to approximately 60% of WT. The fact that cytoplasmic HDAC3 levels are maintained in the Hdac3 +/−heterozygous state suggests that cytoplasmic HDAC3 may be tightly bound in a protein complex that sequesters HDAC3 and prevents it from migrating to the nucleus.
Our inability to detect any beneficial consequences of reducing nuclear HDAC3 levels in R6/2 mice was disappointing. The fact that Hdac3 −/− nullizygous mice die early in embryogenesis indicates that another protein cannot compensate for HDAC3 function. We might expect that reduction of nuclear HDAC3 to approximately 60% of WT levels could be similar to the level of inhibition achieved by pharmacological approaches. Therefore, the Hdac3 +/− heterozygous mice present a suitable model with which to further investigate the therapeutic potential of reducing HDAC3 nuclear function. Our negative results would appear to contradict the report that the administration of HDACi 4b to R6/2 mice improves transcriptional dysregulation as well as behavioural phenotypes [26]. However these previously reported beneficial effects are surprising in the light of the physical stability and metabolic issues concerning HDACi 4b that have recently been highlighted (Beconi et al. unpublished data). Taken together, the current data raise doubts as to the validation of HDAC3 inhibition as a therapeutic target for HD.
Materials and Methods
Generation of an Hdac3 null allele
The Hdac3-targeting vector was generated by PCR and standard cloning. The 5′ homology arm (4.7 kb), the 3′ homology arm (4.9 kb) and the knock-out region (4.5 kb) were generated by PCR using high fidelity Prime Star HS DNA polymerase (Takara) and RP23-24H23 BAC clone as a template. Aside from the homologous arms, the final vector (HighQ1B-mHdac3) also contains loxP sequences flanking the knock-out region (4.5 kb), a neomycine resistance cassette (Neo, for positive selection of the ES cells), and a diphtheria toxin gene cassette (DTA, for negative selection of the ES cells). The targeting vector was linearized with NotI and electroporated into C57BL/6NTac ES cells (an ES cell line derived from C57BL/6 Taconic mice). The cells were selected with 200 ug/ml G418 and 192 neo resistant ES clones were screened for homologous recombination by Southern blot analysis. Targeted ES cells were electroporated with the Cre-recombinase and G418 sensitive clones were picked and analyzed by Southern blot. Clones carrying a deletion of Exon 11 to 14 were identified and microinjected into the blastocysts of C57BL/6 females to generate chimeric mice. Chimeras were bred to C57BL/6 females to achieve germ-line transmission and generate heterozygotes. The deletion was confirmed at the genomic level by PCR and sequencing.
Mouse maintenance and breeding
All animal work was approved by the King's College London Ethical Review Panel and experimental procedures were performed in accordance with the UK Home Office regulations.
Hemizygous R6/2 mice were bred and reared in our colony by backcrossing R6/2 males to (CBA×C57Bl/6) F1 (CBF) females (B6CBAF1/OlaHsd, Harlan Olac). Hdac3+/− heterozygotes originated in a C57Bl/6 background and were backcrossed once to CBF females before breeding to R6/2 males. All animals had unlimited access to water and breeding chow (Special Diet Services, Witham, UK). Housing conditions and environmental enrichment were used as previously described [46]. Hdac3+/− females were crossed to R6/2 males to generate WT, Hdac3 +/−, R6/2 and Dbl mice. All cages contained at least one mouse of each genotype and mice were additionally given mash that consist of powdered chow mixed with water from 4 to 15 weeks. Mice were subject to a 12 h light/12 h dark cycle.
Genotyping of R6/2 and Hdac3 +/− mice and CAG repeat sizing
R6/2 mice were genotyped by PCR of tail-tip genomic DNA. PCR was performed using 1× Thermo-start master mix (Thermo scientific), 10% DMSO, 10 ng/ul forward primer 33727 (5′-CGCAGGCTAGGGCTGTCAATCATGCT-3′), 10 ng/ul reverse primer 32252 (5′-TCATCAGCTTTTCCAGGGTCGCCAT-3′) and 100 ng genomic DNA. Amplification conditions were: 15 min at 94°C, 35× (30 s at 94°C; 30 s at 60°C; 60 s at 72°C), 10 min at 72°C. The amplicon for the R6/2 transgene is 272 bp. The CAG repeat size was determined as follow: amplification of the CAG repeat from R6/2 mouse DNA was performed with a FAM labelled forward primer (5′-GAGTCCCTCAAGTCCTTCCAGCA-3′) and reverse primer (5′-GCCCAAACTCACGGTCGGT-3′) with 0.2 mM dNTPs; 10% DMSO; AM buffer (67 mM TrisHCL pH 8.8; 16.6 mM (NH4)S04; 2 mM MgCl2; 0.17 mg/ml BSA) and 0.5 U AmpliTaq DNA polymerase (Applied Biosystems). Amplification conditions were: 90 s at 94°C, 24× (30 s at 94°C; 30 s at 65°C; 90 s at 72°C), 10 min at 72°C. All instruments and materials were obtained from Applied Biosystems unless indicated. The FAM-tagged PCR product (1 ul) together with MegaBACETM ET900 (AmershamBioscience) internal size standard (0.04 ul) were denatured for 5 min at 94°C in 9 ul of HiDi-formamide and analysed using an ABI3730 sequencer. Data analysis was performed using platemanager application GeneMapper v5.2- 3730XL. Hdac3 +/− mice were genotyped by duplex PCR in a 10 ul reaction containing 100 ug gDNA, 2 ul of 5× Promega buffer, 1.2 ul of 25 mM MgCl2, 1 ul of 10× PCR Enhancer (Invitrogen), 1 ul of 2 mM dNTP, 1 ul of 10 uM forward 1 (F1) primer (5′- GCTTAGCCTACTTGGCAAGTGCCAG-3′), 1 ul of 10 uM forward 2 (F2) primer (5′-GGCCAGAAGCACCCAATGAGTTCTA-3′), 1 ul of 10 uM reverse (R) primer (5′- ACAATCATCAGGCCGTGAGAGTTTG-3′), 0.2 ul of Promega Taq DNA polymerase and 4.4 ul H2O. Amplification conditions were: 10 min at 94°C, 40× (30 s at 94°C; 30 s at 58°C; 60 s at 72°C) 10 min at 72°C. The WT allele product is 250 bp and the Hdac3 knock-out allele is 500 bp.
Phenotypic analysis
The phenotypic analysis was performed on mice from 4 weeks to 15 weeks of age (WT males n = 9, females n = 7; Hdac3+/− males n = 7, females n = 7; R6/2 males n = 5, females n = 7; Dbl males n = 10, females n = 5). Mice were weaned 4 days before the beginning of the analysis. Mice were weighed weekly to the nearest 0.1 g. Motor coordination was assessed using an Ugo Basile 7650 accelerating RotaRod with an acceleration set to run from 4 to 40 RPM in 300 seconds (Linton Instrumentation, UK). At 4 weeks of age, mice were tested on four consecutive days, with three trials per day. At 8, 10, 12 and 14 weeks of age, mice were tested on three consecutive days with three trials per day. Forelimb grip strength was measured once a week at 4 and from 11 to 14 weeks using a San Diego Instruments Grip Strength Meter (San Diego, CA, USA) as described in [24]. Exploratory spontaneous motor activity was recorded and assessed fortnightly at 5, 7, 9, 11 and 13 weeks of age for 30 min during the day using infra-red activity monitoring cages (Linton Instruments, AM1053) as described in [47]. Briefly, activity (total number of beam breaks in the lower level), mobility (at least two consecutive beam breaks in the lower level) and rearing (number of rearing beam breaks) were measured. The data were collected and analyzed as described in [47]. At 15 weeks of age mice were sacrificed, brains were extracted and weighed to the nearest 0.01 g.
RNA extraction and gene expression analysis
Brain regions were dissected, snap-frozen in liquid nitrogen and stored at −80°C until required. Cortices, cerebella and striata were homogenized in Qiazol reagent and extracted using Qiagen RNeasy Mini kit (Qiagen). After quantification with a Nanodrop 1000 spectrophotometer (Labtech international), 1 ug of total RNA was reverse transcribed in 20 ul RT reaction using MMLV-RT kit (Invitrogen) and P21 random hexamers as described in Benn et al, 2008. RT reaction was diluted 10 times in nuclease-free Sigma water and 5 ul was used in 25 ul reaction containing Precision MasterMix (PrimerDesign), 300 nM gene-specific primers and 200 nM fluorescent reporting probe (FAM labelled and TAMRA quenched) specific to each target gene of interest using the Opticon2 Real Time PCR detection system (MJ research). Housekeeping genes previously identified [48] were used as ready-mixed PerfectProbe sets containing primers and probe (PrimerDesign). The geometric mean of three housekeeping genes for each brain region (Atp5b, Canx, and Ubc for cortex; Atp5b, Eif4a2, and Ubc for cerebellum, Atp5b, Ubc and Ywhaz for striatum) was used as a reference in order to determine relative expression ratio of the genes of interest using 2−ΔΔCt method. For Hdac3 expression analysis, primers and probe were designed using Primer3 software at the junction between exon 14 and 15 so only the WT allele can be detected (forward primer 5′- CGACGCTGAAGAGAGAGGTC -3′, reverse primer 5′- TTTCCTTGTCGTTGTCATGG-3′; probe 5′- CCGAGGAGAACTACAGCAGG-3′). The amplicon was sequence-verified. For the other target genes, primers and probes were used as in previous studies [28], [48], [49] and their sequences are available in Table S2.
Isolation of nuclear and cytoplasmic fractions from mouse brains
Brains were extracted from mice, snap-frozen in −50°C isopenthane and stored at −80°C until required. All procedures were performed on ice. Each brain was homogenized in 2 ml ice-cold buffer 1 (575 mM sucrose; 25 mM KCl; 50 mM Triethanolamine; 5 mM MgCl2; 5 mM DTT; 0.5 mM PMSF; 1 tablet complete protease inhibitor cocktail from Roche) with 5–10 strokes in a 5 ml ice-cold homogenizer. The homogenate was then centrifuged at 800 g for 15 min at 4°C. The supernatant corresponds to the cytoplasmic fraction. The pellet was then homogenized in 3 ml buffer 1 and 2 volumes (6 ml) of Buffer 2 (2.3 M sucrose; 24.8 mM KCl; 50 mM Triethanolamine; 5 mM MgCl2; 1 mM DTT; 0.5 mM PMSF; 1 tablet complete protease inhibitor cocktail from Roche) were added and mixed to the homogenate. The mix was then centrifuged at 124000 g for 1 hour at 4°C (SW40 rotor in Beckman ultracentrifuge). The pellet (nuclear fraction) was washed twice in Buffer 1 and finally resuspended in 100 ul of Buffer 1.
Seprion ligand ELISA assay
Brain regions were dissected, snap-frozen in liquid nitrogen and stored at −80°C until required. A 2.5% lysate was prepared by ribolysing tissues for 3×30 sec in Lysing matrix tubes (Lysing matrix D; MP Biomedicals) in ice-cold RIPA buffer (50 mM Tris-HCl pH 8.0; 120 mM NaCl; 1% Igepal; 3.125% sodium deoxycholate; 0.01% SDS; 1 mM β-mercaptoethanol; 1 uM PMSF; 1 mM DTT; 1 tablet complete protease inhibitor cocktail from Roche). Lysates were then stored at −80°C and used within 12 h. Fifteen microliters of homogenate was mixed to 3 ul 10% SDS, 62 ul H2O and 20 ul 5× capture buffer (Microsens Biotechnologies). A total of 100 ul was transferred to the well of a Seprion ligand-coated ELISA plate, and incubated with shaking for 1 h at room temperature (RT). The well was then washed 5× in PBS-T (PBS; 0.1% Tween) and incubated shaking for 1 h at RT with 100 ul MW8 primary antibody (mouse monoclonal antibody [39]) diluted 1∶3000 in conjugate buffer (150 mM NaCl; 4% BSA; 1% non-fat dried milk; 0.1% Tween 20 in PBS). After 5 washes with PBS-T, the well was incubated shaking for 45 min at RT with 100 ul horse radish peroxidase (HRP)-conjugated anti-mouse secondary antibody (DAKO) diluted 1∶2000 in conjugate buffer. The well was then washed 5× in PBS-T and 100 ul of RT TMB substrate (SerTec) was added and incubated in the dark at RT for 5 min. Reactions were terminated by adding 100 ul 0.5 M HCl and the absorption at 450 nm was measured using a plate reader (Biorad).
Western blotting and antibodies
The protein concentration of the whole brain cytoplasmic fraction and RIPA extracted brain regions (ELISA) were determined using the BCA assay kit (Thermo scientific). Twenty micrograms of proteins were denatured in one volume of 2× sample buffer (125 mM Tris-HCl pH 6.8, 4% SDS, 20% Glycerol, 10% β-mercaptoethanol, 0.004% bromophenol blue) for 10 min at 95°C. Four microliters of the total 100 ul nuclear fraction was also denatured in one volume of 2× sample buffer for 10 min at 95°C. Lysates were then fractionated on 12% (nuclear and cytoplasmic fraction) or 10% (RIPA-extracted protein lysates) SDS-PAGE gels and electro-transferred into nitrocellulose membranes (Whatman) by submerged transfer apparatus (Bio-Rad) in (25 mM Tris, 192 mM glycine, 20% v/v methanol). Membranes were blocked for 1 h at RT in 5% non-fat dried milk in PBS-T (PBS; 0.2% Tween). Membranes containing nuclear and cytoplasmic fractions were then incubated with gentle agitation over night at 4°C with an HDAC3 antibody (rabbit polyclonal Abcam, 1/1000) or 20 min RT with a mouse monoclonal α-tubulin antibody (1/30000, Sigma) or rabbit polyclonal histone H4 antibody (1/5000, Millipore) in PBS-T, 5% non-fat dried milk. Membranes containing RIPA-extracted protein lysates were incubated 1 h RT with the sheep polyclonal S830 huntingtin antibody [40] diluted 1∶2000 in PBS-T, 5% non-fat dried milk or α-tubulin antibody (20 min). For chemiluminescent detection, membranes were washed 3× in PBS-T probed with HRP-linked secondary antibodies (HRP conjugated anti-rabbit mouse or sheep antibody (1∶10000, Dako) in PBS-T, 5% non-fat dried milk for 45 min at RT and washed 3× in PBS-T. Protein was detected by chemiluminescense (ECL reagent GE healthcare) according to the manufacturer's instructions. The signals were quantified using a GS-800 calibrated densitometer (Bio-Rad).
Statistical analysis
Statistical analysis was performed by Student's t-test (Excel or SPSS), one-way ANOVA, two-way ANOVA and repeated measures GLM ANOVA, with the Greenhouse–Geisser correction for non-sphericity using SPSS.
Supporting Information
Hdac3 genetic reduction does not affect the expression of the other Hdacs . Expression of Hdac1-11 transcripts are represented as a percent of WT expression levels in the cortex (A), the cerebellum (B) and the striatum (C) of 6 week old WT and Hdac3 +/− mice. The level of Hdac3 is the only significant difference between WT and Hdac3 +/− brain regions. Error bars correspond to S.E.M. (n = 6) ***p<0.001. The same color code (blue = WT; red = Hdac3) was used for all the graphs.
(TIF)
HDAC3 protein expression in Hdac3+/− heterozygous mouse brain. (A) Representative western blot showing the expression of the HDAC3 protein in 4 week old mouse whole brains extracted with RIPA buffer. α-tubulin was used as a loading control (B) Quantification of (A). A slight significant decrease (≈20%) was induced by Hdac3 genetic reduction. Error bars correspond to S.E.M. (n = 3) *p<0.05. Blue = WT; red = Hdac3.
(TIF)
Hdac3 genetic reduction does not modify R6/2 exploratory activity. Average activity (left) rearing (middle) and mobility (right) for each genotype is shown at 5, 7, 9, 11 and 13 weeks of age. The same color code (blue = WT; red = Hdac3+/−; green = R6/2 and purple = Dbl) was used for all the graphs. R6/2 mice show an overall hypoactivity and decreased mobility relative to WT mice from 7 weeks onwards and rearing is significantly decreased in R6/2 mice from 9 weeks of age. Hdac3+/− mice were indistinguishable from WT mice for all of the parameters. Genetic reduction of Hdac3 failed to induce any improvement for these parameters in R6/2 mice.
(TIF)
Hdac3 genetic reduction does not modify R6/2 exploratory activity. The numbers displayed in Table S1 indicate the p-values for each of the parameters analysed (R6/2 genotype, Hdac3 genotype, time in the activity cages) at 5, 7, 9, 11 and 13 weeks of age. Significant p-values are highlighted in yellow for p<0.05, orange for p<0.01 and pink for p<0.001. Mice in activity cages are shown to behave differently with respect to measures of exploratory behaviour (as determined by measuring activity, mobility and rearing) over a period of 30 min (Time). R6/2 mice exhibit an overall hypoactivity and a reduced mobility from 7 weeks and rearing is significantly reduced from 9 weeks (R6/2 genotype) and (Time*R6/2 genotype). Hdac3 genetic reduction does not influence the behaviour of mice for any parameter assessed (Hdac3 genotype) and (Time*Hdac3 genotype) and furthermore, there appears to be no interaction between Hdac3 and R6/2 genotypes (R6/2*Hdac3) and (R6/2*Hdac3*time).
(DOCX)
Sequences of primers and Taqman probes used in real-time PCR assays. Bdnf I, IV V, brain derived neurotrophic factor promoter I, IV, V; Bdnf B, brain derived neurotrophic factor coding exon B; Cnr1, cannabinoid receptor 1; Darpp32, dopamine and cAMP regulated neuronal phosphoprotein; Drd2, dopamine D2 receptor; Hdac1-11, histone deacetylase 1–11; Htt, huntingtin gene; Igfbp5, insulin-like growth factor binding protein 5; Kcnk2, potassium channel subfamily K, member 2; Nr4a2, nuclear receptor subfamily 4, group A, member 2; Pcp4, Purkinje cell protein 4; Penk1, proenkephalin; Uchl1, ubiquitin C-terminal hydrolase L1.
(DOCX)
Acknowledgments
We thank Donna Groom and members of the Neurogenetics Laboratory for the provision of R6/2 males for breeding.
Footnotes
Competing Interests: DH is employed by CHDI Management, Inc. and YO and KC are employees of Taconic. There are no patents, products in development or marketed products to declare. This does not alter the authors' adherence to all the PLoS ONE policies on sharing data and materials.
Funding: This work was funded by CHDI Foundation, a privately-funded non-profit biomedical research organization exclusively dedicated to discovering and developing therapeutics that slow the progression of Huntington's disease. DH was involved in the design and generation of the Hdac3 KO mouse. With the exception of this, the funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
References
- 1.Bates G, Harper PS, Jones L. Huntington's disease. Oxford: Oxford University Press; 2002. [Google Scholar]
- 2.The Huntington's Disease Collaborative Research Group. A novel gene containing a trinucleotide repeat that is expanded and unstable on Huntington's disease chromosomes. The Huntington's Disease Collaborative Research Group. Cell. 1993;72:971–983. doi: 10.1016/0092-8674(93)90585-e. [DOI] [PubMed] [Google Scholar]
- 3.DiFiglia M, Sapp E, Chase KO, Davies SW, Bates GP, et al. Aggregation of huntingtin in neuronal intranuclear inclusions and dystrophic neurites in brain. Science. 1997;277:1990–1993. doi: 10.1126/science.277.5334.1990. [DOI] [PubMed] [Google Scholar]
- 4.Crook ZR, Housman D. Huntington's disease: can mice lead the way to treatment? Neuron. 69:423–435. doi: 10.1016/j.neuron.2010.12.035. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Mangiarini L, Sathasivam K, Seller M, Cozens B, Harper A, et al. Exon 1 of the HD gene with an expanded CAG repeat is sufficient to cause a progressive neurological phenotype in transgenic mice. Cell. 1996;87:493–506. doi: 10.1016/s0092-8674(00)81369-0. [DOI] [PubMed] [Google Scholar]
- 6.Davies SW, Turmaine M, Cozens BA, DiFiglia M, Sharp AH, et al. Formation of neuronal intranuclear inclusions underlies the neurological dysfunction in mice transgenic for the HD mutation. Cell. 1997;90:537–548. doi: 10.1016/s0092-8674(00)80513-9. [DOI] [PubMed] [Google Scholar]
- 7.Lin CH, Tallaksen-Greene S, Chien WM, Cearley JA, Jackson WS, et al. Neurological abnormalities in a knock-in mouse model of Huntington's disease. Hum Mol Genet. 2001;10:137–144. doi: 10.1093/hmg/10.2.137. [DOI] [PubMed] [Google Scholar]
- 8.Woodman B, Butler R, Landles C, Lupton MK, Tse J, et al. The Hdh(Q150/Q150) knock-in mouse model of HD and the R6/2 exon 1 model develop comparable and widespread molecular phenotypes. Brain Res Bull. 2007;72:83–97. doi: 10.1016/j.brainresbull.2006.11.004. [DOI] [PubMed] [Google Scholar]
- 9.Carter RJ, Lione LA, Humby T, Mangiarini L, Mahal A, et al. Characterization of progressive motor deficits in mice transgenic for the human Huntington's disease mutation. J Neurosci. 1999;19:3248–3257. doi: 10.1523/JNEUROSCI.19-08-03248.1999. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Lione LA, Carter RJ, Hunt MJ, Bates GP, Morton AJ, et al. Selective discrimination learning impairments in mice expressing the human Huntington's disease mutation. J Neurosci. 1999;19:10428–10437. doi: 10.1523/JNEUROSCI.19-23-10428.1999. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Stack EC, Kubilus JK, Smith K, Cormier K, Del Signore SJ, et al. Chronology of behavioral symptoms and neuropathological sequela in R6/2 Huntington's disease transgenic mice. J Comp Neurol. 2005;490:354–370. doi: 10.1002/cne.20680. [DOI] [PubMed] [Google Scholar]
- 12.Kuhn A, Goldstein DR, Hodges A, Strand AD, Sengstag T, et al. Mutant huntingtin's effects on striatal gene expression in mice recapitulate changes observed in human Huntington's disease brain and do not differ with mutant huntingtin length or wild-type huntingtin dosage. Hum Mol Genet. 2007;16:1845–1861. doi: 10.1093/hmg/ddm133. [DOI] [PubMed] [Google Scholar]
- 13.Moffitt H, McPhail GD, Woodman B, Hobbs C, Bates GP. Formation of polyglutamine inclusions in a wide range of non-CNS tissues in the HdhQ150 knock-in mouse model of Huntington's disease. PLoS One. 2009;4:e8025. doi: 10.1371/journal.pone.0008025. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Sathasivam K, Lane A, Legleiter J, Warley A, Woodman B, et al. Identical oligomeric and fibrillar structures captured from the brains of R6/2 and knock-in mouse models of Huntington's disease. Hum Mol Genet. 2010;19:65–78. doi: 10.1093/hmg/ddp467. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Landles C, Sathasivam K, Weiss A, Woodman B, Moffitt H, et al. Proteolysis of mutant huntingtin produces an exon 1 fragment that accumulates as an aggregated protein in neuronal nuclei in Huntington disease. J Biol Chem. 285:8808–8823. doi: 10.1074/jbc.M109.075028. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Cha JH. Transcriptional signatures in Huntington's disease. Prog Neurobiol. 2007;83:228–248. doi: 10.1016/j.pneurobio.2007.03.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Sadri-Vakili G, Bouzou B, Benn CL, Kim MO, Chawla P, et al. Histones associated with downregulated genes are hypo-acetylated in Huntington's disease models. Hum Mol Genet. 2007;16:1293–1306. doi: 10.1093/hmg/ddm078. [DOI] [PubMed] [Google Scholar]
- 18.Kuo MH, Allis CD. Roles of histone acetyltransferases and deacetylases in gene regulation. Bioessays. 1998;20:615–626. doi: 10.1002/(SICI)1521-1878(199808)20:8<615::AID-BIES4>3.0.CO;2-H. [DOI] [PubMed] [Google Scholar]
- 19.Codd R, Braich N, Liu J, Soe CZ, Pakchung AA. Zn(II)-dependent histone deacetylase inhibitors: suberoylanilide hydroxamic acid and trichostatin A. Int J Biochem Cell Biol. 2009;41:736–739. doi: 10.1016/j.biocel.2008.05.026. [DOI] [PubMed] [Google Scholar]
- 20.Avalos JL, Bever KM, Wolberger C. Mechanism of sirtuin inhibition by nicotinamide: altering the NAD(+) cosubstrate specificity of a Sir2 enzyme. Mol Cell. 2005;17:855–868. doi: 10.1016/j.molcel.2005.02.022. [DOI] [PubMed] [Google Scholar]
- 21.Bates EA, Victor M, Jones AK, Shi Y, Hart AC. Differential contributions of Caenorhabditis elegans histone deacetylases to Huntingtin polyglutamine toxicity. J Neurosci. 2006;26:2830–2838. doi: 10.1523/JNEUROSCI.3344-05.2006. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Ferrante RJ, Kubilus JK, Lee J, Ryu H, Beesen A, et al. Histone deacetylase inhibition by sodium butyrate chemotherapy ameliorates the neurodegenerative phenotype in Huntington's disease mice. J Neurosci. 2003;23:9418–9427. doi: 10.1523/JNEUROSCI.23-28-09418.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Gardian G, Browne SE, Choi DK, Klivenyi P, Gregorio J, et al. Neuroprotective effects of phenylbutyrate in the N171-82Q transgenic mouse model of Huntington's disease. J Biol Chem. 2005;280:556–563. doi: 10.1074/jbc.M410210200. [DOI] [PubMed] [Google Scholar]
- 24.Hockly E, Richon VM, Woodman B, Smith DL, Zhou X, et al. Suberoylanilide hydroxamic acid, a histone deacetylase inhibitor, ameliorates motor deficits in a mouse model of Huntington's disease. Proc Natl Acad Sci U S A. 2003;100:2041–2046. doi: 10.1073/pnas.0437870100. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Steffan JS, Bodai L, Pallos J, Poelman M, McCampbell A, et al. Histone deacetylase inhibitors arrest polyglutamine-dependent neurodegeneration in Drosophila. Nature. 2001;413:739–743. doi: 10.1038/35099568. [DOI] [PubMed] [Google Scholar]
- 26.Thomas EA, Coppola G, Desplats PA, Tang B, Soragni E, et al. The HDAC inhibitor 4b ameliorates the disease phenotype and transcriptional abnormalities in Huntington's disease transgenic mice. Proc Natl Acad Sci U S A. 2008 doi: 10.1073/pnas.0804249105. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Bobrowska A, Paganetti P, Matthias P, Bates GP. Hdac6 knock-out increases tubulin acetylation but does not modify disease progression in the R6/2 mouse model of Huntington's disease. PLoS One. 2011;6:e20696. doi: 10.1371/journal.pone.0020696. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Benn CL, Butler R, Mariner L, Nixon J, Moffitt H, et al. Genetic knock-down of HDAC7 does not ameliorate disease pathogenesis in the R6/2 mouse model of Huntington's disease. PLoS One. 2009;4:e5747. doi: 10.1371/journal.pone.0005747. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Broide RS, Redwine JM, Aftahi N, Young W, Bloom FE, et al. Distribution of histone deacetylases 1–11 in the rat brain. J Mol Neurosci. 2007;31:47–58. doi: 10.1007/BF02686117. [DOI] [PubMed] [Google Scholar]
- 30.Salisbury CM, Cravatt BF. Activity-based probes for proteomic profiling of histone deacetylase complexes. Proc Natl Acad Sci U S A. 2007;104:1171–1176. doi: 10.1073/pnas.0608659104. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Pallos J, Bodai L, Lukacsovich T, Purcell JM, Steffan JS, et al. Inhibition of specific HDACs and sirtuins suppresses pathogenesis in a Drosophila model of Huntington's disease. Hum Mol Genet. 2008;17:3767–3775. doi: 10.1093/hmg/ddn273. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Fischle W, Dequiedt F, Hendzel MJ, Guenther MG, Lazar MA, et al. Enzymatic activity associated with class II HDACs is dependent on a multiprotein complex containing HDAC3 and SMRT/N-CoR. Mol Cell. 2002;9:45–57. doi: 10.1016/s1097-2765(01)00429-4. [DOI] [PubMed] [Google Scholar]
- 33.Yang WM, Tsai SC, Wen YD, Fejer G, Seto E. Functional domains of histone deacetylase-3. J Biol Chem. 2002;277:9447–9454. doi: 10.1074/jbc.M105993200. [DOI] [PubMed] [Google Scholar]
- 34.Guenther MG, Barak O, Lazar MA. The SMRT and N-CoR corepressors are activating cofactors for histone deacetylase 3. Mol Cell Biol. 2001;21:6091–6101. doi: 10.1128/MCB.21.18.6091-6101.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Bhaskara S, Knutson SK, Jiang G, Chandrasekharan MB, Wilson AJ, et al. Hdac3 is essential for the maintenance of chromatin structure and genome stability. Cancer Cell. 18:436–447. doi: 10.1016/j.ccr.2010.10.022. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Montgomery RL, Potthoff MJ, Haberland M, Qi X, Matsuzaki S, et al. Maintenance of cardiac energy metabolism by histone deacetylase 3 in mice. J Clin Invest. 2008;118:3588–3597. doi: 10.1172/JCI35847. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Schuettengruber B, Simboeck E, Khier H, Seiser C. Autoregulation of mouse histone deacetylase 1 expression. Mol Cell Biol. 2003;23:6993–7004. doi: 10.1128/MCB.23.19.6993-7004.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Ryu H, Lee J, Olofsson BA, Mwidau A, Dedeoglu A, et al. Histone deacetylase inhibitors prevent oxidative neuronal death independent of expanded polyglutamine repeats via an Sp1-dependent pathway. Proc Natl Acad Sci U S A. 2003;100:4281–4286. doi: 10.1073/pnas.0737363100. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Ko J, Ou S, Patterson PH. New anti-huntingtin monoclonal antibodies: implications for huntingtin conformation and its binding proteins. Brain Res Bull. 2001;56:319–329. doi: 10.1016/s0361-9230(01)00599-8. [DOI] [PubMed] [Google Scholar]
- 40.Sathasivam K, Woodman B, Mahal A, Bertaux F, Wanker EE, et al. Centrosome disorganization in fibroblast cultures derived from R6/2 Huntington's disease (HD) transgenic mice and HD patients. Hum Mol Genet. 2001;10:2425–2435. doi: 10.1093/hmg/10.21.2425. [DOI] [PubMed] [Google Scholar]
- 41.Xu C, Soragni E, Chou CJ, Herman D, Plasterer HL, et al. Chemical probes identify a role for histone deacetylase 3 in Friedreich's ataxia gene silencing. Chem Biol. 2009;16:980–989. doi: 10.1016/j.chembiol.2009.07.010. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42.McQuown SC, Barrett RM, Matheos DP, Post RJ, Rogge GA, et al. HDAC3 is a critical negative regulator of long-term memory formation. J Neurosci. 31:764–774. doi: 10.1523/JNEUROSCI.5052-10.2011. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43.Bardai FH, D'Mello SR. Selective toxicity by HDAC3 in neurons: regulation by Akt and GSK3beta. J Neurosci. 31:1746–1751. doi: 10.1523/JNEUROSCI.5704-10.2011. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 44.Yang XJ, Seto E. The Rpd3/Hda1 family of lysine deacetylases: from bacteria and yeast to mice and men. Nat Rev Mol Cell Biol. 2008;9:206–218. doi: 10.1038/nrm2346. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 45.Soriano FX, Hardingham GE. In cortical neurons HDAC3 activity suppresses RD4-dependent SMRT export. PLoS One. 2011;6:e21056. doi: 10.1371/journal.pone.0021056. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 46.Hockly E, Woodman B, Mahal A, Lewis CM, Bates G. Standardization and statistical approaches to therapeutic trials in the R6/2 mouse. Brain Res Bull. 2003;61:469–479. doi: 10.1016/s0361-9230(03)00185-0. [DOI] [PubMed] [Google Scholar]
- 47.Hockly E, Tse J, Barker AL, Moolman DL, Beunard JL, et al. Evaluation of the benzothiazole aggregation inhibitors riluzole and PGL-135 as therapeutics for Huntington's disease. Neurobiol Dis. 2006;21:228–236. doi: 10.1016/j.nbd.2005.07.007. [DOI] [PubMed] [Google Scholar]
- 48.Benn CL, Fox H, Bates GP. Optimisation of region-specific reference gene selection and relative gene expression analysis methods for pre-clinical trials of Huntington's disease. Mol Neurodegener. 2008;3:17. doi: 10.1186/1750-1326-3-17. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 49.Mielcarek M, Benn CL, Franklin SA, Smith DL, Woodman B, et al. SAHA decreases HDAC 2 and 4 levels in vivo and improves molecular phenotypes in the R6/2 mouse model of Huntington's disease. PLoS One. 2011 doi: 10.1371/journal.pone.0027746. in press. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Hdac3 genetic reduction does not affect the expression of the other Hdacs . Expression of Hdac1-11 transcripts are represented as a percent of WT expression levels in the cortex (A), the cerebellum (B) and the striatum (C) of 6 week old WT and Hdac3 +/− mice. The level of Hdac3 is the only significant difference between WT and Hdac3 +/− brain regions. Error bars correspond to S.E.M. (n = 6) ***p<0.001. The same color code (blue = WT; red = Hdac3) was used for all the graphs.
(TIF)
HDAC3 protein expression in Hdac3+/− heterozygous mouse brain. (A) Representative western blot showing the expression of the HDAC3 protein in 4 week old mouse whole brains extracted with RIPA buffer. α-tubulin was used as a loading control (B) Quantification of (A). A slight significant decrease (≈20%) was induced by Hdac3 genetic reduction. Error bars correspond to S.E.M. (n = 3) *p<0.05. Blue = WT; red = Hdac3.
(TIF)
Hdac3 genetic reduction does not modify R6/2 exploratory activity. Average activity (left) rearing (middle) and mobility (right) for each genotype is shown at 5, 7, 9, 11 and 13 weeks of age. The same color code (blue = WT; red = Hdac3+/−; green = R6/2 and purple = Dbl) was used for all the graphs. R6/2 mice show an overall hypoactivity and decreased mobility relative to WT mice from 7 weeks onwards and rearing is significantly decreased in R6/2 mice from 9 weeks of age. Hdac3+/− mice were indistinguishable from WT mice for all of the parameters. Genetic reduction of Hdac3 failed to induce any improvement for these parameters in R6/2 mice.
(TIF)
Hdac3 genetic reduction does not modify R6/2 exploratory activity. The numbers displayed in Table S1 indicate the p-values for each of the parameters analysed (R6/2 genotype, Hdac3 genotype, time in the activity cages) at 5, 7, 9, 11 and 13 weeks of age. Significant p-values are highlighted in yellow for p<0.05, orange for p<0.01 and pink for p<0.001. Mice in activity cages are shown to behave differently with respect to measures of exploratory behaviour (as determined by measuring activity, mobility and rearing) over a period of 30 min (Time). R6/2 mice exhibit an overall hypoactivity and a reduced mobility from 7 weeks and rearing is significantly reduced from 9 weeks (R6/2 genotype) and (Time*R6/2 genotype). Hdac3 genetic reduction does not influence the behaviour of mice for any parameter assessed (Hdac3 genotype) and (Time*Hdac3 genotype) and furthermore, there appears to be no interaction between Hdac3 and R6/2 genotypes (R6/2*Hdac3) and (R6/2*Hdac3*time).
(DOCX)
Sequences of primers and Taqman probes used in real-time PCR assays. Bdnf I, IV V, brain derived neurotrophic factor promoter I, IV, V; Bdnf B, brain derived neurotrophic factor coding exon B; Cnr1, cannabinoid receptor 1; Darpp32, dopamine and cAMP regulated neuronal phosphoprotein; Drd2, dopamine D2 receptor; Hdac1-11, histone deacetylase 1–11; Htt, huntingtin gene; Igfbp5, insulin-like growth factor binding protein 5; Kcnk2, potassium channel subfamily K, member 2; Nr4a2, nuclear receptor subfamily 4, group A, member 2; Pcp4, Purkinje cell protein 4; Penk1, proenkephalin; Uchl1, ubiquitin C-terminal hydrolase L1.
(DOCX)





