Skip to main content
NCBI home page
Molecular Therapy logoLink to Molecular Therapy
. 2011 Dec 6;20(2):339–346. doi: 10.1038/mt.2011.265

Construction of an Oncolytic Herpes Simplex Virus That Precisely Targets Hepatocellular Carcinoma Cells

Xinping Fu 1, Armando Rivera 1, Lihua Tao 1, Bart De Geest 2, Xiaoliu Zhang 1
PMCID: PMC3277243  PMID: 22146341

Abstract

Selective replication in tumor cells is a highly desirable feature for oncolytic viruses. Recent studies have shown that microRNAs (miRNAs) play important roles in controlling gene expression, and that certain tissue-specific miRNAs are frequently downregulated in malignant cells. miR-122 is a liver-specific microRNA. It is abundantly expressed in normal hepatocytes but is absent in many hepatocellular carcinoma (HCC) cells. We hypothesized that expression of an essential viral gene by a liver-specific promoter would initially restrict virus replication to cells of hepatic origin and that adding miR-122 complementary sequences to the viral gene would make the transcripts degradable by miR-122 in normal hepatocytes, thus further confining its replication to HCC. We have constructed such an oncolytic herpes simplex virus by linking the essential viral glycoprotein H gene with the liver-specific apolipoprotein E (apoE)-AAT promoter and by adding the miR-122a complimentary sequence to the 3′ untranslated region (3′UTR). To further increase the safety of this virus, complementary sequences from miR-124a and let-7 were also engineered into the same 3′UTR. Designated liver-cancer specific oncolytic virus (LCSOV), it was highly selective in killing HCC cells and in shrinking HCC xenografts. We conclude that LCSOV is a highly specific oncolytic virus that can precisely target HCC.

Introduction

Cancer virotherapy is to treat cancer patients with an engineered virus that can selectively replicate in and thus lyse tumor cells while sparing normal cells.1 Viruses are absolute intracellular pathogens and they have the intrinsic ability to infect cells and to produce progeny viruses that can then spread within the organ/tissue. The crux of cancer virotherapy is to guide this strong tissue- destructive capability to specifically target malignant tissues. Different strategies have been used to modify viruses for oncolytic purposes. One such strategy is the use of tissue-specific promoters to drive the expression of an essential viral gene. An oncolytic virus constructed in this manner will essentially restrict the virus replication to a particular organ tissue, and thus can be used to treat a tumor originating in the same tissue. The safety of such an oncolytic virus will depend on the expendability of the targeted tissue, and it may be used to treat malignant diseases such as prostate cancer since prostate tissue can be dispensable. However, an oncolytic virus constructed using such a strategy may not be suitable for cancers such as hepatocellular carcinoma (HCC) that originate from an important organ/tissue.

Recent studies have established that microRNAs (miRNAs), which are single-stranded RNA molecules of 21–23 nucleotides in length, play an important role in regulating host gene expression. These short RNAs bind to the complementary sequences in mRNAs to guide their degradation or prevent them from being translated. Among the identified miRNAs, a subset of them have been found to be encoded in a tissue-specific manner.2,3,4 For example, miR-124 has been reported to be mainly detected in brain tissue whereas miR-122 has been reported to be mainly expressed in hepatocytes.5 Interestingly, many of these tissue-specific miRNAs have been found to be down regulated or totally disappear when these tissues become malignant. For example, it has been reported that expression of miR-122 is significantly decreased in many HCC cells.6,7 Recently, this differential expression of tissue-specific miRNAs has been exploited for the purpose of constructing oncolytic viruses that can more specifically target tumor cells. For example, Edge et al. first reported the construction of an oncolytic vesicular stomatitis virus whose activity was dictated by expression of let-7 (ref. 8), a microRNA family that functions as an essential regulator of gene expression in various organ tissues and is frequently downregulated in malignant cells.9 They incorporated several copies of let-7 microRNA complementary sequence into the 3′ untranslated region (3′UTR) of the matrix protein gene, so that this essential viral gene transcript would be degraded in normal cells where let-7 is abundant but virus replication would be permitted in tumor cells where expression of let-7 is downregulated.8 Subsequently, similar strategies have been used to construct conditionally replicating herpes simplex virus,10 vaccinia virus,11 and measles virus.12 However, as the abundance of let-7 fluctuates widely in different organ tissues, merely relying on this single control mechanism may not be enough to confer safety of these oncolytic viruses.

Here, we report a strategy to construct an oncolytic herpes simplex virus (HSV) that can precisely target HCC by combined use of a strong liver-specific promoter and miRNA-mediated degradation. Designated liver-cancer-specific oncolytic virus (LCSOV), it was highly selective in replicating in HCC cells when tested in vitro. When tested in vivo, LCSOV led to significant size reductions of HCC tumor xenografts, greatly extending animal survival without showing any toxicity. We conclude that the strategy of combining tissue-specific promoter with miRNA-mediated degradation can be applied for constructing oncolytic viruses that can precisely target tumor cells for destruction.

Results

Combination of liver-specific promoter and miRNA complementary sequence can confine gene expression exclusively to HCC

In our previous studies, we showed that apolipoprotein E (apoE)-AAT is a strong liver-specific promoter and can be potentially used in gene therapy for liver diseases.13 To explore its suitability for HCC treatment, we initially linked it to a fused marker gene that contains the coding sequences for green fluorescent protein (GFP) and firefly luciferase, to generate pApoE-AAT-GFP-Luc. We also created another construct in which the same marker gene is driven by the cytomegalovirus (CMV) promoter, to generate pCMV-GFP-Luc. We first transfected pApoE-AAT-GFP-Luc into cancer cells of different tissue origins, including those from liver (Hep3B, HepG2, and HuH-7), kidney (HEK293T), lung (A549), and brain (Neuro-2a of neuron origin and U87 of glia origin). Two cells from normal tissues, human umbilical vein endothelial cells and primary mouse hepatocytes (PMHs), were also included in this experiment. While luciferase activity was detected at a high level in all the cells of hepatocyte origin transfected with pApoE-AAT-GFP-Luc, the gene expression was barely detectable in other cells transfected with the same construct (Figure 1a). Next, we directly compared the marker gene expression between pApoE-AAT-GFP-Luc and pCMV-GFP-Luc constructs in some of the cell lines used in Figure 1a. In cells of nonliver origin, the promoter activity of apoE-AAT is only a small fraction of that from the CMV promoter. However, apoE-AAT promoter showed a strong activity in both PMHs and Hep3B cells. In fact, the luciferase activity from pApoE-AAT-GFP-Luc transfected was even higher than that of pCMV-GFP-Luc (Figure 1b). Together, these results confirm that apoE-AAT is a strong promoter with high specificity for cells of hepatic origin.

Figure 1.

Figure 1

Open in a new tab

apoE-AAT is a strong and specific promoter in cells of hepatocyte origin. (a) pApoE-AAT-GFP-Luc was transfected into cells of different tissue origin and cells were harvested 24 hours later for quantification of luciferase activity, which was shown as relative light units (RLU). (b) Cells seeded in parallel wells were transfected with either pApoE-AAT-GFP-Luc or pCMV-GFP-Luc and the luciferase activity determined as in (a). The RLU percentage was calculated by dividing the value of pApoE-AAT-GFP-Luc with the value from the pCMV-GFP-Luc-transfected well. All the RLU values in these two experiments were corrected for the transfection efficacy based on total protein concentration. The data represents the mean ± SD of three experiments. *P < 0.01. apoE, apolipoprotein E; GFP, green fluorescent protein.

Next, we compared the gene expression between pApoE-AAT- GFP-Luc and pApoE-AAT-GFP-Luc-miR-3, with the later being constructed from the former by inserting the complementary sequences (miR-3) of miR-122a, miR-124a and let-7 into the 3′ UTR of the GFP-Luc marker gene. We first transfected the plasmids into PMHs. Transfection of pApoE-AAT-GFP-Luc gave a very high reading of luciferase activity, indicating that apoE-AAT, despite its human origin, maintains its promoter activity in murine liver tissue. Marker gene expression from pApoE-AAT-GFP-Luc-miR-3 was greatly reduced to a barely detectable level (Figure 2), indicating that the amount of miR-122 in normal hepatocytes is high enough to degrade the majority of the marker gene transcripts despite the fact that they are abundantly produced from the strong apoE-AAT promoter. We next compared the marker gene expression between pApoE-AAT-GFP-Luc and pApoE-AAT- GFP-Luc-miR-3 constructs in two HCC cell lines that differ in miR-122a expression profile. It has been reported that Hep3B cells do not express miR-122a while this miRNA can be readily detected in HuH-7 cells.14,15 Similar to the results in Figure 1a, abundant luciferase activity was detected in both cells transfected with pApoE-AAT-GFP-Luc. In contrast, differential luciferase activity was observed between these two cell lines when they were transfected with pApoE-AAT-GFP-Luc-miR-3, with abundant luciferase activity being detected in the miR-122a negative Hep3B cells but not in the miR-122a positive HuH-7 cells (Figure 2). These results thus support the observation in PMH, and together they suggest that miR-122a expression profile can dictate the abundance of the gene products that is driven by the apoE-AAT promoter. The fact that luciferase was abundantly expressed in the miR-122a negative Hep3B cells transfected with pApoE-AAT-GFP-Luc-miR-3 also suggests that the presence of miR-3 in the 3′ UTR per se does not interfere with the gene expression.

Figure 2.

Figure 2

Open in a new tab

Marker gene expression from pApoE-AAT-GFP-Luc-miR-3 is significantly downregulated in primary mouse hepatocytes. Primary mouse hepatocytes or hepatocellular carcinoma (HCC) cells were transfected with either pApoE-AAT-GFP-Luc or pApoE-AAT-GFP-Luc-miR-3. Cells were harvested 24 hours later and cell lysates were assayed for the luciferase activity. The data are the mean ± SD of three experiments. *P < 0.01.

We also measured the effect of let-7 on expression of the marker gene that has been linked to the miR-3 sequence. We chose three cell lines for this experiment. Two of them (HEK293T and A549) are known to be let-7a negative16 and HeLa cells have been identified as let-7a positive.17,18 None of these cell lines expresses miR-122a or miR-124a.5,19,20,21 These cells were cotransfected with either pCMV-GFP-Luc-miR-3 plus pSIN-control plasmid or pCMV-GFP-Luc-miR-3 plus pSIN-miR-let-7a that contains a let-7a expression cassette. The reason we chose pCMV-GFP-Luc-miR-3 instead of pApoE-AAT-GFP-Luc-miR-3 for this experiment is because the apoE-AAT promoter won't be active in these cells. As compared with the luciferase activity in cells transfected with pCMV-GFP-Luc-miR-3 plus pSIN-control (which was set as 100 in Figure 3), cotransfection of pCMV-GFP-Luc-miR-3 with pSIN-miR-let-7a dramatically reduced the marker gene expression in let-7-negative HEK293T and A549 cells. The marker gene expression from HeLa cells transfected with pCMV-GFP-Luc-miR-3 plus pSIN-control was already very low, indicating that the endogenously expressed let-7a was able to degrade the GFP-Luc transcripts effectively. Cotransfection of pSIN-miR-let-7a did not significantly improve the downregulation effect. Cotransfection of pCMV-GFP-Luc, which does not contain miR-3, with pSIN-miR-let-7a did not significantly change the marker gene expression in any of these cells (data not shown). Together, these results show that the let-7 complementary sequence contained within miR-3 in the 3′ UTR of the marker gene is responding to let-7a expression accordingly.

Figure 3.

Figure 3

Open in a new tab

Let-7a down regulates marker gene expression from constructs containing miR-3. Let-7a negative (HEK293T, A549) and positive (HeLa) cells were transfected with pCMV-GFP-Luc-Mir3 (miR-3) plus pSIN-control (Ctl) or pCMV-GFP-Luc-Mir3 plus pSIN-miR-let-7a (L7). Relative light units (RLU) is expressed as a percentage of the pCMV-GFP-Luc-miR-3 plus pSIN-control. The data are the mean ± SD of three experiments. *P < 0.01.

Virus construction

The strategy for virus construction is illustrated in Figure 4. We first replaced the marker gene in pApoE-AAT-GFP-Luc-miR-3 with the HSV gH gene so that its expression would be controlled in the same manner as for the marker gene. Then gH flanking sequences were amplified from HSV genome and were added to either side of the modified gH gene cassette for the purpose of homologous recombination. The new plasmid was used to transfect CR-1 cells that expresses gH in trans.22 The transfected cells were infected 24 hours later with a mutant HSV named DH1A that is defective in gH and contains a copy of the lacZ gene in the deleted gH locus.22 The desired recombinant virus was selected by picking white plaques from blue background of lacZ-expressing DH1A and purified to homogeneity before they were amplified for storage. We named one of the stocks prepared from the plaque-purified viruses LCSOV and chose it for further characterization.

Figure 4.

Figure 4

Open in a new tab

Construction strategy of liver-cancer specific oncolytic virus (LCSOV). (a) Schematic representation of DH1A genome. The terminal repeats (TR) and internal repeats (IR) are represented by filled squares and are labeled. The locus of the deleted gH gene is also marked (a lacZ gene has been inserted into the deleted gH region). (b) Schematic representation of the modified gH gene cassette. Individual components are labeled. L-flank and R-flank mark the left and right flanking sequences of gH gene that are needed to initiate homologous recombination. (c) Arrangements of the complementary sequences for the three targeted microRNAs (miRNAs).

In vitro characterization of LCSOV

To verify whether replication of LCSOV would be determined by both the liver-specific apoE-AAT promoter and the relevant miRNA expression profile, we used LCSOV to infect a panel of cells with positive or negative apoE-AAT promoter activity and different expression status of the three miRNAs. Among them, A549 is a non-HCC tumor cell line and is negative for all of the three targeted miRNAs. The rest are hepatic origin but differ in miR-122a expression profile, HuH-7, and PMH are miR-122a positive while Hep3B is miR-122a negative.14,15 As a control, these cells were also infected with a wild type HSV (WT17+) at the same multiplicity of infection. While WT17+ replicates to a high titer in all these cell lines, LCSOV replication was hampered significantly in A549, HuH-7 cells and PMHs. As mentioned previously, A549 does not express any of the three targeted miRNAs. Failure of LCSOV to grow in A549 is thus mainly due to lack of apoE-AAT promoter activity. ApoE-AAT promoter is active in both HuH-7 cells and PMHs. Thus, the failure of LCSOV to grow in these cells is due to the degrading effect of miR-122a on gH transcripts. In Hep3B cells in which the apoE-AAT promoter is active and miR-122a is absent, LCSOV replicates to almost the same level as WT17+ (Figure 5). These results demonstrate that, similar to what has been found for the GFP-Luc marker gene, the expression of the engineered gH in the viral genome is controlled by both the liver-specific apoE-AAT promoter and the miR-122 expression profile, which then determines the virus replication capability.

Figure 5.

Figure 5

Open in a new tab

Conditional replication of liver-cancer specific oncolytic virus (LCSOV). A549 cells (lung cancer), HuH-7 liver cancer cells (miR-122a positive), Hep3B liver cancer cells (miR-122a negative), and normal primary mouse hepatocytes were infected with LCSOV or WT17+ at 0.1 plaque-forming units (pfu)/cell. Cells were collected 24 hours after infection and virus titer was quantitated by plaque assay. The data are mean ± SD of three experiments. *P < 0.05.

Next, we compared the killing activity of LCSOV against two HCC lines with different miR-122a expression profile, HuH-7 (miR-122a positive) and Hep3B (miR-122a negative). Cells were infected with LCSOV at 0.1 plaque-forming unit (pfu)/cell and harvested 24 hours and 48 hours later. Cell viability was determined by trypan blue exclusion assay. Infection of LCSOV at this relatively low dose progressively killed the miR-122a negative Hep3B cells (Figure 6). At 48 hours after infection, almost all the cells in the infected well were killed. In contrast, infection of the miR-122a positive with LCSOV at the same dose showed very little toxicity even at 48 hours after infection. These data correlate well with the virus replication results, further confirming that the miR-122 expression profile can determine the virus replication and cytotoxicity.

Figure 6.

Figure 6

Open in a new tab

Liver-cancer specific oncolytic virus (LCSOV) can selectively kill miR-122a negative tumor cells. Hep3B (miR-122a negative) and HuH-7 (miR-122a positive) liver cancer cells were infected with LCSOV at 0.1 plaque-forming units (pfu)/cell. Cells were harvested 24 and 48 hours and cell viability was determined by trypan blue exclusion. *P < 0.05; *P < 0.01.

In vivo evaluation of antitumor efficacy and safety of LCSOV

For the in vivo studies, we initially implanted 5 × 106 cells of miR-122a negative Hep3B tumor cells in the right flank of 4–5-week-old SCID mice. When tumors reached the approximate size of 5 mm in diameter, mice were randomly divided into two groups to receive intratumoral injection of either 5 × 106 pfu of LCSOV at a volume of 100 µl, or a same volume of phosphate-buffered saline. Tumors were then measured weekly. The tumor in the group that received phosphate-buffered saline grew rapidly, to an average volume of >1,500 mm3 2 weeks after the start of the treatment (Figure 7a). Animals in this group had to be euthanized by the third week after treatment due to large tumor burden. The tumors in the group treated with LCSOV, on the other hand, did not grow significantly after the start of the treatment. The tumor size remained small to the end of this experiment. These results demonstrate that LCSOV has a potent oncolytic activity against miR-122a negative HCC despite its high targeting specificity.

Figure 7.

Figure 7

Open in a new tab

In vivo evaluation of liver-cancer specific oncolytic virus (LCSOV) oncolytic efficacy and animal survival. (a) LCSOV effectively inhibits Hep3B tumor growth. 5 × 106 cells were implanted into the right flank of SCID mice. After tumor reached approximate size of 5 mm in diameter, mice received intratumoral injections of either LCSOV (5 × 106 plaque-forming units (pfu)) or phosphate-buffered saline (PBS). Tumor size was measured consecutively for 3 weeks. *P < 0.01. (b) Kaplan–Meier survival curve. Immune competent Balb/c mice were intravenously injected with 1 × 107 pfu of LCSOV or 1 × 105 plaque-forming units (pfu) of WT17+. Animals were observed for 40 days and animal survival was recorded.

As an initial step to assess safety of LCSOV, we conducted a survival experiment. We administered a relatively large dose (1 × 107 pfu) of LCSOV intravenously (via the tail vein) into immune competent Balb/c mice. We also administered WT17+ to another group of mice through the same route but at a much lower dose (1 × 105 pfu). Mice receiving WT17+ started to die days after virus injection, and by the second week, over 80% of mice in this group were dead (Figure 7b). In contrast, all the animals in the group receiving LCSOV survived until the end of this experiment (40 days after virus administration). No obvious discomfort or symptom was observed in any animals in this group during the entire experiment.

We then conducted another in vivo experiment to directly compare the toxicity of LCSOV with that of Synco-2D, a well-characterized HSV-1-based oncolytic virus.23,24 Blood samples were collected from mice before they were systemically injected with either LCSOV or Synco-2D at a dose of 1 × 107 pfu. Blood samples were collected again at day 3 and day 14 after virus administration for measurement of alanine transaminase and aspartate transaminase activity. At day 14, all the animals were euthanized and their organ tissues collected for detection of viral genome by PCR. Systemic delivery of Synco-2D caused a transit elevation of both alanine transaminase and aspartate transaminase at day 3 (Figure 8a,b), which was consistent with our previous observation with other HSV-derived oncolytic viruses.25 Administration of LCSOV, on the other hand, did not cause any significant increase in the aspartate transaminase activity (Figure 8b). It only caused a slight increase in alanine transaminase activity with a less steep slope than that of Synco-2D (Figure 8a). PCR detection of different organ tissues showed that residual HSV genome sequence was barely detectable in mice receiving Synco-2D, and it was completely undetectable in mice receiving LCSOV (Figure 8c). Together, these results demonstrate that the strategy of simultaneously controlling the gH expression with both tissue-specific promoter and miRNA-targeted degradation can make HSV safe for in vivo administration, without the need to delete additional viral genes that may compromise the virus replication capability in tumor cells.

Figure 8.

Figure 8

Open in a new tab

Direct comparison of liver-cancer specific oncolytic virus (LCSOV) with another herpes simplex virus (HSV)-derived oncolytic virus for in vivo distribution and liver toxicity. (a, b) Mice received systemic injection of 1 × 107 plaque-forming units (pfu) of either LCSOV or Synco-2D and blood samples were collected before or 3 and 14 days after virus administration for measurement of the activity of liver enzymes (a) alanine transaminase (ALT) and (b) aspartate transaminase (AST). (c) Mice from the experiment shown in a and b were killed at day 14 after virus administration and organ tissues collected for detection of viral genome by PCR. The primers used for detecting viral genome are from the HSV ICP6 gene (labeled as ICP6). A pair of primers from the murine ribosomal gene 36B4 gene (labeled as 36B4) were used in the PCR as a loading control.

Discussion

Recent studies from several groups have shown that the differential expression profile of certain miRNAs between normal and malignant cells can be exploited for the purpose of constructing oncolytic viruses.8,10,11,12 Here, we show that by controlling the expression of the essential gH gene of HSV simultaneously with a liver-specific promoter and miR-122a targeted degradation, an oncolytic virus can be constructed that can precisely target HCC. As HCC often occurs after a prolonged period of chronic liver disease such as chronic hepatitis,26 patients with HCC may have very limited healthy liver tissue left. Thus, it is very desirable to develop a treatment that can target HCC with high precision and with little or no toxicity to the few remaining normal hepatocytes. Our data show that LCSOV can selectively replicate in and destroy HCC cells that do not express miR-122, and spares normal hepatocytes that contain this liver-specific miRNA in abundance. Thus, an oncolytic HSV constructed by this strategy may be particularly useful for HCC treatment.

To further ensure the safety of LCSOV, we engineered additional miRNA complementary sequences of let-7 and miR-124a into the same 3′ UTR region of the modified gH gene. The inclusion of miR-124a in the vector construction strategy is based on the consideration that HSV is a neurotropic virus and miR-124a is abundantly expressed in normal brain tissues.27 The addition of the let-7 complementary sequence to the gH gene cassette will further minimize the possibility of any leaked virus to cause damage to other normal organ tissues. In vivo studies show that LCSOV was well tolerated when it was given systemically at a relatively high dose. All these support the conclusion that, due to these multiple control mechanisms, LCSOV is a safe oncolytic virus that can precisely target HCC.

When designing the virus construction strategy, we decided to engineer an essential viral structural gene instead of a regulatory gene as is the case in many similar studies. This is based on the concern that certain regulatory genes may possess a low threshold amounts required for their transactivation activity. In such cases, a low level of leakage in gene expression may result in initiating full virus replication cycle, compromising the safety of the constructed virus. In contrast, structural viral gene products such as glycoprotein H are needed for virus assembly and each assembled virus particle can contain many gH molecules. Thus, any slight leakage of gene expression is unlikely to result in significant virus production. However, this strategy depends heavily on promoter activity in the targeted tumor cells. Ideally the promoter activity should be equivalent to the intrinsic viral promoter in tumor cells. Several tissue-specific promoters have been shown to have the desirable specificity.28,29,30,31 However, their activity is usually much weaker than the constitutive viral promoters such as the CMV promote.30,32,33 In our previous studies, we showed that apoE-AAT is a strong yet strictly tissue (liver) specific promoter.13 In this study, we further characterized this promoter by linking it to a fused marker gene of GFP and luciferase and tested it in a panel of cells of different tissue origin by comparing it with the CMP promoter. Our results confirm that apoE-AAT is a strong and specific promoter element in tumor cells of hepatocyte origin. This certainly has contributed to the fact that the yield of LCSOV in Hep3B cells is identical to that of the wild type strain17+. This is in contrast to many other oncolytic viruses that usually have reduced replication capability as compared with their wild type counterparts. Thus, the strong apoE-AAT promoter and the selection of the structural gH gene seem to be a good combination. With the additional miRNA-mediated degradation tactic, they form a good strategy to construct an oncolytic HSV that can precisely target HCC with virtually no toxicity to normal cells. We believe that the same strategy may be applicable to construct oncolytic viruses to precisely target tumors of other tissue origins.

Materials and Methods

Cell lines. African green monkey kidney (Vero) cells, A549 (lung carcinoma cells), HeLa (cervical cancer cells), HuH-7, HepG2 and Hep3B (HCC cells), U87 (glioblastoma), Neuro-2a (neuroblastoma), and human umbilical vein endothelial cells were purchased from American Type Culture Collection (Manassas, VA). The CR-1 cells were derived from Vero cells and were established by stably transforming the cells with the gH gene of HSV-1.34 Cells were grown in Dulbecco's modified Eagle medium supplemented with 10% fetal bovine serum at 37 °C. PMHs were isolated with a technique previously described35 and cultured in Williams medium supplemented with 10% fetal bovine serum. All media contained 100 U ml−1 penicillin and 100 mg ml−1 streptomycin (Invitrogen, Carlsbad, CA).

Gene cloning and plasmid construction. Four tandem repeats of each of the complementary sequence of miR-122A, miR-124A, and miR-Let7A, designated miR-3, were synthesized in the order shown in Figure 4c, by Integrated DNA Technologies (Coralville, IA). The synthesized miR-3 was then cloned into pCMV-GFP-Luc previously generated in our lab. The newly created plasmid was designated pCMV-GFP-Luc-miR-3. The apoE-AAT enhancer-promoter component was subsequently cloned into pCMV-GFP-Luc and pCMV-GFPLuc-miR-3, respectively, by replacing the CMV promoter between NheI and NotI restriction sites. The newly generated plasmids were designated pApoE-AAT-GFP-Luc and pApoE-AAT-GFP-Luc-miR-3, respectively. All the plasmids were confirmed by restriction enzyme digestions and sequencing.

The gH gene was amplified from WT17+ by PCR. The PCR amplified product was initially cloned into pTarget (Stratagene, La Jolla, CA) and the new plasmid was designated pTRG-gH. The gH gene was then cut out from pTRG-gH and cloned into pApoE-AAT-GFP-Luc-miR-3 so that it was linked to the apoE-AAT promoter and miRNA complementary sequences, and the new plasmid was designated pApoE-AAT-gH-Mir-3 (Figure 4c). The entire apoE-AAT-gH-miR-3 cassette was then cloned into pF-LacZ so that it was flanked by the U21 and U23 sequences (left and right flanking sequences of the gH gene, respectively). This new plasmid was designated pF-apoE-AAT-gH-Mir3.

Virus construction. The detailed strategy of recombinant virus construction is illustrated in Figure 4. pF-apoE-AAT-gH-Mir-3 was transfected into CR-1 cells by Lipofectamine 2000 formulation. CR-1 cells were established from Vero cells by stably transforming the cells with the gH gene of HSV-1.34 Twenty-four hours later, cells were super-infected with 1 pfu/cell of DH1A, a mutant HSV-1 that has the gH gene replaced with the LacZ gene.36 The viruses were harvested and transferred to fresh CR-1 cell monolayers for plaque formation. The cells were stained with X-Gal and white plaques were picked. The selected viruses were then subjected to three more rounds of plaque purification before stock preparations were made. One of the plaque-purified stocks was designated LCSOV, for liver-specific tumor oncolytic virus. To confirm the inserted apoE-AAT-gH-Mir-3 in LCSOV, virion DNA was purified from the virus stock and sent for sequencing. The result confirmed that the correct sequence was presented in the right locus of the viral genome.

Luciferase reporter assay. HEK293-T, A549, Hela, Hep3B, HuH7, and PMHs were plated in 6-well plates 1 day before transfection. Twenty-four hours later, cells were transfected with plasmid DNA (pCMV-GFP-Luc, pCMV-GFP-Luc-miR-3, pApoE-AAT-GFP-Luc, pApoE-AAT-GFP-Luc-miR-3, pSIN-miR-let-7a) using Lipofectamine 2000 per manufacturer's instructions. For cotransfections, the plasmid DNA was mixed at a 3:1 ratio before adding Lipofectamine 2000 to the tube. Luciferase activity was quantified with the Bright-Glo Luciferase Assay System (Promega, Madison, WI) and readings were taken on the luminometer (GloMax 96 Microplate Luminometer; Promega) using FluoroNunc/LumiNunc Plates (Fisher Scientific, Pittsburgh, PA). Relative light unit were corrected for the transfection efficacy based on total protein concentrations determined by the Bradford Protein Assay Kit (Bio-Rad, Hercules, CA).

In vitro virus replication assay. PMH, HuH7 cells (miR-122a positive) and Hep3B cells (miR-122a negative) were infected with 0.1 pfu or 1 pfu of LCSOV or WT17+ by triplicates into 12-well plates. Viruses were harvested and titrated in CR-1 cells by a standard plaque assay.

In vitro virus cancer killing assay. HuH7 (miR-122a positive) cells and Hep3B cells (miR-122a negative) were infected with 0.1 pfu of LCSOV by triplicates into 12-well plates. At 24 and 48 hours, cells were harvested and counted using trypan blue exclusion assay. The viral cell killing was calculated by the formula: Cell killing (%) = (1 – (viable cell number in infected well)/(viable cell number in control well)) × 100.

PCR detection of HSV genome in animal organ tissues. The collected animal organ tissues, brain, heart, kidneys, lungs, liver, muscle (thigh), blood, and spleen (0.5–0.7 mg, where appropriate) were cut into small pieces and placed in 15 ml conical tubes containing 4–6 ml of lysis buffer [100 mmol/l Tris–HCl pH 7.5 (5 ml); 0.5 mol/l EDTA (500 µl); 10% SDS (1 ml); 5 mol/l NaCl (2 ml); 20 mg/ml Proteinase K (250 µl), and 45.25 ml of water]. Tubes were kept in agitation at 60 °C for 3–5 hours until complete digestion. After that, one volume of isopropanol was added to the lysates. Samples were then swirled for ~20 minutes until viscosity was gone and precipitation completed. The DNA was recovered by lifting the aggregated material from the solution using a disposable bacterial loop. Excess liquid was dabbed off from the aggregates and the DNA was dispersed in a prelabeled Eppendorf tube containing, depending on the size of the precipitation, 400–800 µl of TE buffer, pH 7.5. Complete dilution of the DNA was carried out at 37 °C in agitation. After DNA quantification a standard PCR was performed using Taq DNA polymerase (New England Biolabs, Ipswich, MA), using two pairs of primers that amplify the viral ICP6 gene and the murine ribosomal gene 36B4 (as a loading control), respectively. For the ICP6 gene primers, the sequences are: forward “GACAGCCATATCCTGAGC” and reverse “GCCAGCAGTTGCTAGACACTCA,” and for the murine ribosomal gene 36B4, the primer sequences are: forward “GCTGATGGGCAAGAACAC” and reverse “ATGTGAGGCAGCAGTTTCTC.”

Animal studies. Six-week-old female Hsd: athymic (nu/nu) mice were purchased from Harlan Laboratories (Indianapolis, IN). All animal experimental procedures were approved by the University of Houston Animal Care and Use Committee. The human Hep3B HCC cell line was cultured in 10% Dulbecco's modified Eagle medium in standard conditions until 70% confluence. Cells were then trypsinized, pelleted, and resuspended in phosphate-buffered saline at a concentration of 5 × 107/ml. 5 × 106 (in 100 µl) were subcutaneously implanted into the right flank of mice. Mice were then randomly divided into two groups (n = 5). When tumor reached the approximate size of 5 mm in diameter, mice received a single intratumoral injection of LCSOV at a dose of 5 × 106 pfu or phosphate-buffered saline only. Tumor growth was monitored weekly by bidirectional measurements using a caliper, and the tumor volume was calculated by the formula (mm3) = (length × (width)2/0.5.

For evaluating viral safety/toxicity, 6-week-old female Balb/c mice (purchased from Harlan Laboratories) were intravenously injected with 1 × 107 pfu of either LCSOV or Synco-2D, or 1 × 105 pfu of wild type strain 17+ (WT17+). Synco-2D is a HSV-1-based oncolytic virus and its construction details have been described previously.23 For the survival study, animals were housed and observed for 40 days. For toxicity comparison with Synco-2D, the animals were kept for 2 weeks during which blood was collected periodically. Afterwards, the animals were euthanized and organ tissues collected for quantitative PCR detection of viral genome. The detection of alanine transaminase and aspartate transaminase activity in the collected blood was done by the animal pathology lab in Baylor College of Medicine.

Statistical analysis. All quantitative data are reported as mean ± SD. Statistical analysis was made for multiple comparisons using analysis of variance and Student's t-test. P value < 0.05 was considered to be statistically significant.

Acknowledgments

This work was supported by the National Cancer Institute grants R01CA106671 and R01CA132792 and also by a grant from the William and Ella Owens Medical Research Foundation (to X.Z.). The authors declared no conflict of interest.

REFERENCES

  1. Parato KA, Senger D, Forsyth PA., and, Bell JC. Recent progress in the battle between oncolytic viruses and tumours. Nat Rev Cancer. 2005;5:965–976. doi: 10.1038/nrc1750. [DOI] [PubMed] [Google Scholar]
  2. Liang Y, Ridzon D, Wong L., and, Chen C. Characterization of microRNA expression profiles in normal human tissues. BMC Genomics. 2007;8:166. doi: 10.1186/1471-2164-8-166. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W., and, Tuschl T. Identification of tissue-specific microRNAs from mouse. Curr Biol. 2002;12:735–739. doi: 10.1016/s0960-9822(02)00809-6. [DOI] [PubMed] [Google Scholar]
  4. Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A.et al. (2007A mammalian microRNA expression atlas based on small RNA library sequencing Cell 1291401–1414. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Makeyev EV, Zhang J, Carrasco MA., and, Maniatis T. The MicroRNA miR-124 promotes neuronal differentiation by triggering brain-specific alternative pre-mRNA splicing. Mol Cell. 2007;27:435–448. doi: 10.1016/j.molcel.2007.07.015. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Kutay H, Bai S, Datta J, Motiwala T, Pogribny I, Frankel W.et al. (2006Downregulation of miR-122 in the rodent and human hepatocellular carcinomas J Cell Biochem 99671–678. [DOI] [PMC free article] [PubMed] [Google Scholar] [Retracted]
  7. Girard M, Jacquemin E, Munnich A, Lyonnet S., and, Henrion-Caude A. miR-122, a paradigm for the role of microRNAs in the liver. J Hepatol. 2008;48:648–656. doi: 10.1016/j.jhep.2008.01.019. [DOI] [PubMed] [Google Scholar]
  8. Edge RE, Falls TJ, Brown CW, Lichty BD, Atkins H., and, Bell JC. A let-7 MicroRNA-sensitive vesicular stomatitis virus demonstrates tumor-specific replication. Mol Ther. 2008;16:1437–1443. doi: 10.1038/mt.2008.130. [DOI] [PubMed] [Google Scholar]
  9. Boyerinas B, Park SM, Hau A, Murmann AE., and, Peter ME. The role of let-7 in cell differentiation and cancer. Endocr Relat Cancer. 2010;17:F19–F36. doi: 10.1677/ERC-09-0184. [DOI] [PubMed] [Google Scholar]
  10. Lee CY, Rennie PS., and, Jia WW. MicroRNA regulation of oncolytic herpes simplex virus-1 for selective killing of prostate cancer cells. Clin Cancer Res. 2009;15:5126–5135. doi: 10.1158/1078-0432.CCR-09-0051. [DOI] [PubMed] [Google Scholar]
  11. Hikichi M, Kidokoro M, Haraguchi T, Iba H, Shida H, Tahara H.et al. (2011MicroRNA regulation of glycoprotein B5R in oncolytic vaccinia virus reduces viral pathogenicity without impairing its antitumor efficacy Mol Ther 191107–1115. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Leber MF, Bossow S, Leonard VH, Zaoui K, Grossardt C, Frenzke M.et al. (2011MicroRNA-sensitive oncolytic measles viruses for cancer-specific vector tropism Mol Ther 191097–1106. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Van Linthout S, Collen D., and, De Geest B. Effect of promoters and enhancers on expression, transgene DNA persistence, and hepatotoxicity after adenoviral gene transfer of human apolipoprotein A-I. Hum Gene Ther. 2002;13:829–840. doi: 10.1089/10430340252899000. [DOI] [PubMed] [Google Scholar]
  14. Suzuki T, Sakurai F, Nakamura S, Kouyama E, Kawabata K, Kondoh M.et al. (2008miR-122a-regulated expression of a suicide gene prevents hepatotoxicity without altering antitumor effects in suicide gene therapy Mol Ther 161719–1726. [DOI] [PubMed] [Google Scholar]
  15. Varnholt H, Drebber U, Schulze F, Wedemeyer I, Schirmacher P, Dienes HP.et al. (2008MicroRNA gene expression profile of hepatitis C virus-associated hepatocellular carcinoma Hepatology 471223–1232. [DOI] [PubMed] [Google Scholar]
  16. Takamizawa J, Konishi H, Yanagisawa K, Tomida S, Osada H, Endoh H.et al. (2004Reduced expression of the let-7 microRNAs in human lung cancers in association with shortened postoperative survival Cancer Res 643753–3756. [DOI] [PubMed] [Google Scholar]
  17. Mayr C, Hemann MT., and, Bartel DP. Disrupting the pairing between let-7 and Hmga2 enhances oncogenic transformation. Science. 2007;315:1576–1579. doi: 10.1126/science.1137999. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Zhou JY, Ma WL, Yu HL, Xiao WW., and, Zheng WL. [Time course of let-7a expression in the cell cycle of human cervical carcinoma HeLa cells] Nan Fang Yi Ke Da Xue Xue Bao. 2009;29:442–445. [PubMed] [Google Scholar]
  19. Chang J, Nicolas E, Marks D, Sander C, Lerro A, Buendia MA.et al. (2004miR-122, a mammalian liver-specific microRNA, is processed from hcr mRNA and may downregulate the high affinity cationic amino acid transporter CAT-1 RNA Biol 1106–113. [DOI] [PubMed] [Google Scholar]
  20. Chi SW, Zang JB, Mele A., and, Darnell RB. Argonaute HITS-CLIP decodes microRNA-mRNA interaction maps. Nature. 2009;460:479–486. doi: 10.1038/nature08170. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Cawood R, Chen HH, Carroll F, Bazan-Peregrino M, van Rooijen N., and, Seymour LW. Use of tissue-specific microRNA to control pathology of wild-type adenovirus without attenuation of its ability to kill cancer cells. PLoS Pathog. 2009;5:e1000440. doi: 10.1371/journal.ppat.1000440. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Zhang X, O'Shea H, Entwisle C, Boursnell M, Efstathiou S., and, Inglis S. An efficient selection system for packaging herpes simplex virus amplicons. J Gen Virol. 1998;79 (Pt 1):125–131. doi: 10.1099/0022-1317-79-1-125. [DOI] [PubMed] [Google Scholar]
  23. Nakamori M, Fu X, Meng F, Jin A, Tao L, Bast RC., Jret al. (2003Effective therapy of metastatic ovarian cancer with an oncolytic herpes simplex virus incorporating two membrane fusion mechanisms Clin Cancer Res 92727–2733. [PubMed] [Google Scholar]
  24. Nakamori M, Fu X, Rousseau R, Chen SY., and, Zhang X. Destruction of nonimmunogenic mammary tumor cells by a fusogenic oncolytic herpes simplex virus induces potent antitumor immunity. Mol Ther. 2004;9:658–665. doi: 10.1016/j.ymthe.2004.02.019. [DOI] [PubMed] [Google Scholar]
  25. Fu X, Tao L., and, Zhang X. An oncolytic virus derived from type 2 herpes simplex virus has potent therapeutic effect against metastatic ovarian cancer. Cancer Gene Ther. 2007;14:480–487. doi: 10.1038/sj.cgt.7701033. [DOI] [PubMed] [Google Scholar]
  26. Di Bisceglie AM. Hepatitis B and hepatocellular carcinoma. Hepatology. 2009;49 5 Suppl:S56–S60. doi: 10.1002/hep.22962. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Sempere LF, Freemantle S, Pitha-Rowe I, Moss E, Dmitrovsky E., and, Ambros V. Expression profiling of mammalian microRNAs uncovers a subset of brain-expressed microRNAs with possible roles in murine and human neuronal differentiation. Genome Biol. 2004;5:R13. doi: 10.1186/gb-2004-5-3-r13. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Huber BE, Richards CA., and, Krenitsky TA. Retroviral-mediated gene therapy for the treatment of hepatocellular carcinoma: an innovative approach for cancer therapy. Proc Natl Acad Sci USA. 1991;88:8039–8043. doi: 10.1073/pnas.88.18.8039. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Vile RG., and, Hart IR. Use of tissue-specific expression of the herpes simplex virus thymidine kinase gene to inhibit growth of established murine melanomas following direct intratumoral injection of DNA. Cancer Res. 1993;53:3860–3864. [PubMed] [Google Scholar]
  30. Latham JP, Searle PF, Mautner V., and, James ND. Prostate-specific antigen promoter/enhancer driven gene therapy for prostate cancer: construction and testing of a tissue-specific adenovirus vector. Cancer Res. 2000;60:334–341. [PubMed] [Google Scholar]
  31. Tanaka S, Iwai M, Harada Y, Morikawa T, Muramatsu A, Mori T.et al. (2000Targeted killing of carcinoembryonic antigen (CEA)-producing cholangiocarcinoma cells by polyamidoamine dendrimer-mediated transfer of an Epstein-Barr virus (EBV)-based plasmid vector carrying the CEA promoter Cancer Gene Ther 71241–1250. [DOI] [PubMed] [Google Scholar]
  32. Schuur ER, Henderson GA, Kmetec LA, Miller JD, Lamparski HG., and, Henderson DR. Prostate-specific antigen expression is regulated by an upstream enhancer. J Biol Chem. 1996;271:7043–7051. doi: 10.1074/jbc.271.12.7043. [DOI] [PubMed] [Google Scholar]
  33. Koga S, Hirohata S, Kondo Y, Komata T, Takakura M, Inoue M.et al. (2000A novel telomerase-specific gene therapy: gene transfer of caspase-8 utilizing the human telomerase catalytic subunit gene promoter Hum Gene Ther 111397–1406. [DOI] [PubMed] [Google Scholar]
  34. Boursnell ME, Entwisle C, Blakeley D, Roberts C, Duncan IA, Chisholm SE.et al. (1997A genetically inactivated herpes simplex virus type 2 (HSV-2) vaccine provides effective protection against primary and recurrent HSV-2 disease J Infect Dis 17516–25. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Moldéus P, Högberg J., and, Orrenius S. Isolation and use of liver cells. Meth Enzymol. 1978;52:60–71. doi: 10.1016/s0076-6879(78)52006-5. [DOI] [PubMed] [Google Scholar]
  36. Zhang X, De Alwis M, Hart SL, Fitzke FW, Inglis SC, Boursnell ME.et al. (1999High-titer recombinant adeno-associated virus production from replicating amplicons and herpes vectors deleted for glycoprotein H Hum Gene Ther 102527–2537. [DOI] [PubMed] [Google Scholar]

Articles from Molecular Therapy are provided here courtesy of The American Society of Gene & Cell Therapy

RESOURCES