Regulation of paraoxonase 1 (PON1) in PCB 126-exposed male Sprague Dawley rats

Abstract

3,3′,4,4′,5-Pentachlorobiphenyl (PCB 126), an aryl hydrocarbon receptor (AhR) agonist and most potent dioxin-like PCB congener, significantly alters gene expression, lipid metabolism, and oxidative stress in the liver. PON1, an antioxidant and anti-atherogenic enzyme, is produced in the liver and secreted into the blood where it is incorporated into high density lipoprotein (HDL) and protects LDL and cellular membranes against lipid peroxidation. To explore the regulation of PON1, male Sprague-Dawley rats were treated with ip injections of 0, 1 or 5 μmol/kg PCB 126 and euthanized up to two weeks afterwards. Serum total and HDL-cholesterol were increased by low dose and decreased by high dose exposure, while LDL-cholesterol was unchanged. PCB 126 significantly increased hepatic PON1 gene expression and liver and serum PON1 activities. Liver and serum thiobarbituric acid reactive substances levels were not elevated except for high dose and long exposure times. Serum antioxidant capacity was unchanged across all exposure doses and time points. This study, the first describing the regulation of gene expression of PON1 by a PCB congener, raises interesting questions whether elevated PON1 is able to ameliorate PCB 126-induced lipid peroxidation and whether serum PON1 levels may serve as a new biomarker of exposure to dioxin-like compounds.

1. Introduction

Polychlorinated biphenyls (PCBs) are persistent organic pollutants and ubiquitous in the environment even though their commercial production has been banned for decades. Many of the 209 individual PCB congeners are highly resistant to biotransformation and bioaccumulate. Certain congeners with non-ortho or mono-ortho chlorine substitution are called “dioxin-like PCBs” because their binding to the arylhydrocarbon receptor (AhR) and biochemical and toxic activities are similar to those of 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) (Bandiera et al., 1982; Hestermann et al., 2000). PCB 126 is the most potent AhR agonist among all PCB congeners tested (Bandiera et al., 1982) and has a toxic equivalency factor (TEF) of 0.1 compared to TCDD, which qualifies it as the most toxic PCB in this family (Van den Berg et al., 2006). Like TCDD, PCB 126 significantly alters the expression of numerous genes and increases enzyme activities, particularly CYP 1A1/2 (Kopec et al., 2010). PCBs also increase intracellular oxidative stress which has been associated with a variety of disease processes, including carcinogenesis and cardiovascular damage (Hennig et al., 2002; Hennig et al., 2005; Ludewig et al., 2008). Several studies have shown that the dioxin-like PCBs (e.g., PCB77 and PCB 126) induce ROS and cause lipid oxidation in endothelial cells which is associated with atherosclerosis (Hassoun et al., 2002; Choi et al., 2009).

Paraoxonase 1 (PON1), a member of a three gene family which includes PON2 and PON3, is a calcium-dependent hydrolase with substrate specificity toward esters, phosphotriester lactones, carbonates and other compounds (Costa et al., 2005a; Costa et al., 2005b). PON1 is primarily synthesized in the liver and secreted into the blood as a major high density lipoprotein (HDL)-associated enzyme (La Du et al., 1999). Besides chemoprotection through detoxification of organophosphorus (OP) pesticides, it displays preventive properties against cardiovascular disease, mainly through removal of oxidized lipids in low density lipoproteins and cell membranes (Furlong et al., 2005; Furlong et al., 2010).

Recently, XRE- (xenobiotic response element)-like sequences were described in the promoter region of PON1 and these sequences were identified as possible binding sites for the activated AhR (Gouedard et al., 2004). In this publication dietary polyphenols and 3-methylcholanthrene (3-MC) were shown to induce PON1 through the AhR-dependent pathway. We therefore hypothesized that PCB 126, as an AhR agonist, may influence PON1 expression and thereby hepatic and serum PON1 activities, a possible protection mechanism against PCB-induced ROS. Here we show that PCB 126 increased hepatic PON1 expression and liver and serum PON1 activity as well as serum HDL levels and hepatic CYP1A1 and AhR transcription in male Sprague Dawley rats in vivo, while no consistent change in lipid peroxides (TBARS) and serum total antioxidant activity was observed.

2. Materials and methods

2.1. Chemicals and reagents

PCB 126 was synthesized and purified using a modified Suzuki-coupling method of 3,4,5-trichlorobromobenzene with 3,4-dichlorophenyl boronic acid utilizing a palladium-catalyzed cross coupling reaction as previously reported (Luthe et al., 2009). All reagents were obtained from Fischer Scientific (Pittsburgh, PA) and were the highest purity available, if not stated otherwise.

2.2. Animals and treatment protocol

Male Sprague-Dawley rats (75–100 g) from Harlan Laboratories, Inc (Indianapolis, IN) were housed in a controlled environment maintained at 22 °C with a 12 hour dark-light cycle with food and water available ad libitum. In the dose-response study, animals were divided into 3 groups of 3 rats each, received a single ip injection of either corn oil (control), or 1 or 5 μmol/kg PCB 126, and were euthanized two weeks after the injection. In the time-course study, rats were divided into 2 groups of 6 animals each and received 2 ip injections (days 1 & 3) of either corn oil (control) or 1 μmol/kg of PCB 126, resulting in a total dose of 2 μmol/kg in the PCB group. Half of the animals in each group were sacrificed one week, the remaining animals two weeks after the first injection. The doses of PCB 126 and exposure time periods were chosen based on a previous study in which a 1 μmol/kg dose of PCB 126 was shown to elicit mild fatty liver (Lai et al., 2010). All animals were euthanized by carbon dioxide asphyxiation and cervical dislocation. The animal protocols were approved by the Institutional Animal Care and Use Committee of the University of Iowa.

Whole blood was stored at 4°C immediately after collecting and coagulation and serum separation were performed at 4°C to minimize any artificial increase in oxidized lipids during processing. Sera were stored at −80 °C until serum endpoints measurement were performed. Livers were removed immediately and a part of them was quickly frozen in liquid nitrogen for later RNA isolation, while the rest was homogenized in Tris-KCl buffer (20mM Tris and 1.15% KCl, ph 7.4) to produce an approximate 10% (w/v) liver homogenate. All liver samples were stored at −80 °C until further use.

2.3. Analysis of serum lipid profile

Rat serum samples were used to measure total cholesterol (TC), high density lipoprotein cholesterol (HDL-C), and low density lipoprotein cholesterol (LDL-C) using a lipid assay kit from BioVision Inc (Mountain View, CA). Briefly, rat serum was separated into HDL and LDL fractions according the manufacture’s protocol for analysis of HDL-C and LDL-C, respectively. TC was determined in serum directly.

2.4. Measurement of liver and serum PON1 activity

Paraoxon and phenylacetate were used as two individual substrates in PON1 activity measurements. Briefly, the enzyme activities were determined spectrophotometrically by following the initial rate of substrate hydrolysis to p-nitrophenyl (412nm) or phenol (270nm), respectively, in 1000 μl assay mixture (100mM Tris-HCl, 2.0mM CaCl₂, 2.0 mM paraoxon or 4.0 mM phenylacetate, pH 8.0) at 25°C. A blank sample containing the assay buffer without sample was run simultaneously to correct for spontaneous substrate breakdown. The units (U) of enzyme activity were calculated from the molar extinction coefficients, E₄₁₂ (18,290 M⁻¹cm⁻¹) and E₂₇₀ (1310 M⁻¹cm⁻¹), respectively, and expressed as U/ml serum or U/mg protein in liver homogenate. Each unit of enzyme is defined as that hydrolyzing 1 nmol of paraoxon or 1 μmol of phenylacetate per minute (Beltowski et al., 2005). The protein concentration in liver homogenates was determined using the Bradford protein assay regent (Bio-Rad Laboratories, Inc CA).

2.5. Gene expression analysis

Total RNA was isolated from rat liver samples using the RNeasy Mini Kit from Qiagen, Inc (Valencia, CA) according to the manufacture’s protocol. RNA concentration and purity was determined by spectrophotometric measurement of A260/A280. cDNA templates were generated using 1 μg of total RNA per 20-μL reaction and a High-Capacity cDNA Reverse Transcription Kit from Applied Biosystems, Inc (Foster City, CA) according to the manufacture’s protocol.

Real-time PCR was performed in a 20-μL reaction with 4 ng of cDNA template and 900 nM primer using a SYBR Green Master Mix kit from Applied Biosystems, Inc (Foster City, CA) according to the manufacture’s protocol. The primers used here were taken from previous publications as indicated below and synthesized by Integrated DNA Technologies, Inc (Coralville, IA). The specificity of these primers was further verified by the Primer-BLAST online program provided by National Library of Medicine. The primer sequences are: PON1: forward 5′TGCTGGCTCACAAGA TTCA C3′, reverse 5′TTCCTTTGTACACAGCAGCG3′ (Varatharajalu et al., 2009); RPL13a: forward 5′CCC TCCACCCTATGACAAGA3′, reverse 5′ CCTTTT CCTTCCGTTTCTCC3′ (Gaub et al., 2010); ApoA1: forward 5′CCTGGATGAATTCCAGGAGA′3, reverse 5′ TCGCTGTAGAGCCCAAACTT′3 (Bettzieche et al., 2009); AhR: forward 5′ GGGCCAAGAG CTTCTTTGATG′3, reverse 5′GCAAGTCCTGCCAGTC TCTGA′3 (Shipley and Waxman, 2006); CYP1A1: forward 5′ ATGTCCAGCTCTCAGATGATAAGGTC′3, reverse 5′ATCCCTGCCAATCACTGTGTCTAAC′3 (Vondracek et al., 2006).

The PCR program used started with 95° for 10 min followed by 40 cycles of 95° for 30s, 55° for 30s and 72° for 1 min performed on an Eppendorf RealPlex2 Mastercycler® (Hamburg, Germany). A melting curve analysis was carried out after the reaction to check for false amplification caused by primer dimmers, non-specific binding or other contamination. The relative gene expression levels were calculated using the relative standard curve method. The target gene expression levels were adjusted to the house keeping gene, ribosomal protein L13a (RPL13a). Results are presented as fold change which was calculated by dividing the adjusted expression level of each target gene in the treatment group with the expression level of the gene in the corn oil control group.

2.6. Measurement of liver and serum TBARS levels

The level of thiobarbituric acid reactive substances (TBARS) expressed in terms of malondialdehyde (MDA) was used as index of liver and serum lipid peroxidation and performed according to the methods described previously (Ohkawa et al., 1979; Yagi, 1998). Briefly, liver homogenate or the serum lipid fraction were incubated with thiobarbituric acid at 95 °C for 60 minutes and the red pigment produced in the reaction was extracted using n-butanol or a n-butanol-pyridine mixture. The pigment concentration was determined spectrophotometrically (at 535nm, liver samples) or spectrofluorometrically (at excitation 515nm and emission 553nm, serum samples).

2.7. Determination of total serum antioxidant capacity

The total serum antioxidant capacity was evaluated by measuring the ferric reducing ability of serum as described (Benzie and Strain, 1996). This method determines the capacity of antioxidants contained in the sample to reduce ferric-tripyridyltriazine (Fe³⁺-TPTZ) to a ferrous form (Fe²⁺) which is then used as putative index of antioxidant or otherwise reducing potential in the sample. Results are expressed as μmol/L.

2.9. Statistics

All data are expressed as means ± SEM. Statistical analysis of the time-course study was performed by two-way ANOVA to evaluate the factors of time and PCB 126 as well as the interaction effect. One-way ANOVA was used for each individual factor (time or PCB 126) in the time-course and dose-response study. All analyses were carried out by General Linear Models (GLM) in SAS 9.2, P<0.05) followed by Dunnett’s T comparison test. A P-value of <0.05 was considered to be statistically significant. Pearson correlation analysis was used to establish the relationship between various endpoints measured in this study.

3. Results

3.1. Biometrical parameters

In the dose-response study (Table 1, upper half) the growth of rats treated with the high dose (5 μmol/kg) of PCB 126 was significantly decreased (P<0.05) and the final body weights were decreased by 31% (P<0.05). Liver weights were significantly increased by the lower dose of 1μmol/kg PCB 126 (46%, P<0.05), and both doses significantly increased the relative liver weight (51% and 54%, respectively). In the time-response study (Table 1, lower half) weight gain of PCB 126-treated rats was significantly decreased from the early time point onwards (P<0.05) with significant decreases in final body weights visible at the late time point (2 weeks). PCB 126 increased both the absolute liver weights and relative liver weights at both time points compared to the corresponding corn oil controls, an effect that was more pronounced at the later time point (34% vs 23% for liver weight and 49% vs 31% for relative liver weight after 2 and 1 week exposure, respectively).

Table 1.

Growth, body and organ weights In rats treated with PCB 126 compared to the corn oil control group two weeks after injection (upper) or at different time points after receiving a total of 2 umol/kg PCB126

Dose-Response PCB126 (μmol/kg)	Body weight gain (%)	Final body weight (g)	Final liver weight (g)	Liver/body weight (%)
Corn oil	26.1 ±1.0	325 ±11	13.2 ±0.2	4.1 ±0.1
1	21.5 ±5.9	312 ±8a	19.3 ±1.1a	6.2 ±0.4a
5	−8.1 ±0.4a,b	225 ±10a,b	14.0 ±0.6	6.3 ±0.1a
Time-Course Time after injection	Body weight gain (%)	Final body weight (g)	Final liver weight (g)	Liver/body weight (%)
Corn oil – 1 week	21.3 ±2.0	209 ±7	9.3 ±0.5	4.5 ±0.2
PCB126 – 1 week	8.3 ±0.2a	195 ±4	11.4 ±0.1a	5.9 ±0.1a
Corn oil – 2 weeks	55.1 ±1.6	268 ±6	11.1 ±0.7b	4.1 ±0.2
PCB126 – 2 weeks	37.6 ±2.6a	243 ±2a	14.9 ±0.4a	6.1 ±0.1a

Results are expressed as mean ± SEM (n=3).

Statistically significant differences

^abetween PCB 126 and corresponding control, and

^bbetween low and high dose of PCB 126; P<0.05

3.2. Serum lipid profile changes during PCB 126 treatments

In the dose-response study a significant increase in HDL-C was seen with the 1 μmol/kg dose (Fig 1A). Total cholesterol was slightly increased with the low dose (1 μmol/kg), but decreased with the high dose (5 μmol/kg) compared to the corn oil control; these changes were non-significant, but high enough to produce a statistical difference between the two doses (Fig 1A). Similarly, in the time-course study (two 1 μmol/kg injections within 3 days) a non significant increase in HDL-C after 1 week and decrease after 2 weeks compared to the control were observed, resulting in a significant difference between 1 and 2 week exposure to PCB 126. In addition a transient, significant increase in total cholesterol after 1 week exposure compared to the control and week 2 was visible (Fig 1B). No effect of PCB 126 on LDL-C was seen in either assay. These changes resulted in higher HDL-C/TC and HDL-C/LDL-C ratios with the low (1 μmol/kg) dose of PCB 126 and the 1 week time point with two 1 μmol/kg injections, but these increases did not reach significance (Supplemental Table 1). The two-way ANOVA analysis (Supplemental Table 2) suggests that both, time and PCB, have no significant overall effects on HDL-C and LDL-C, but that both had a significant overall and interactive effect on total cholesterol (TC) levels.

Fig. 1.

Serum lipid profile 2 weeks after a single ip injection of PCB 126 (A) and 1 or 2 weeks after the 1^st of 2 injections of 1 umol/kg PCB 126 (B). Results are expressed as mean ± SEM (n=3). Statistically significant differences ^a between PCB 126 and corresponding control, and ^b between low and high dose of PCB 126 or 1^st and 2^nd week; P<0.05

3.3. Serum and liver PON1 activities in control and PCB 126-treated animals

PON1 activities in serum were measured with 2 different substrates, paraoxon (paraoxonase activity) and phenylacetate (arylesterase activity of PON1). Serum PON1 paraoxonase activity in corn oil treated control animals was 399 and 349 and the arylesterase activity was 242 U/ml and 234 U/ml in the dose-response and time-response study, respectively (Fig 2). PCB 126 increased PON1 activity in serum which was significant with 5 μmol/kg where PON1 activity was nearly doubled compared to the control. A clear linear dose-dependent pattern was visible with a R² of 0.99 with phenylacetate as substrate (Fig 2A). The twice 1 μmol/kg-treatment in the time-response study (Fig 2B) produced a significant increase with paraoxon at both and phenylacetate at the later time point. No significant change in PON1 activity was seen between week 1 and week 2 in controls or in PCB 126 animals. Accordingly, as shown in the two-way ANOVA analysis (Supplemental Table 2), time did not significantly affect serum PON1 activity overall.

Fig 2.

Serum PON1 activity from does-response study (A) and time-Course study (B)

Results are expressed as mean ± SEM (n=3). ^a significant difference between PCB 126 and corresponding control, P<0.01

The hepatic PON1 levels in corn oil controls were about 2.4 and 4.3 U/mg with paraoxon and phenylacetate, respectively. Liver PON1 activities tripled due to PCB 126-exposure. No dose-response effect was seen (Fig 3A), but a time-dependent increase was visible (Fig 3B), which is reflected in the significant overall effect of both factors, time and PCB 126, in the time-course study (Supplemental Table 2).

Fig 3.

Liver PON1 Activity from does-response study (A) and time-course study (B) Results are expressed as mean ± SEM (n=3)

^a significant difference between PCB 126 and control, P<0.01 and ^b between 1 week and 2 weeks of exposure, P<0.05

3.4. Direct effects of PCB 126 on serum PON1 paraoxon activity

To analyze whether PCB 126 can directly affect PON1 activity in the serum, we incubated serum samples from a healthy, unexposed rat with 1 μM PCB 126 (stock solution in DMSO, 1% final concentration in serum) in vitro for various lengths of time (0, 5, 10, 20 min) at 37 °C followed by spectrophotometrical PON1 activity determination with paraoxon as substrate. No significant change in PON1 activity was observed at any time points compared to the DMSO vehicle control and untreated serum (Supplemental Fig 1).

3.5. Effect of PCB 126 on hepatic gene expression

Hepatic gene expression analysis by RT-PCR showed a doubling of PON1 mRNA with both doses, 1 and 5 μmol/kg PCB 126 (Fig 4A). This effect was even stronger in the time-response study after 1 week of exposure, but lower and no longer significant in the second week (Fig 4B). As expected, CYPIAI mRNA was increased by PCB 126 more than 100-fold (dose-response study) and even more than 2000-fold (time-course study) (Fig 4C, D); this effect was also not dose-dependent and only a small, non-significant reduction was seen with time. PCB 126 also increased the amount of AhR mRNA 2 to-4-fold; a statistically significant dose effect and reduction with time was visible (Fig 4E, 4F). The mRNA level of ApoA1, a PON1 stabilizing protein, was higher with 5 μmol/kg PCB 126 than in controls, but this change was not significant (Fig 4G, 4H). No changes were observed with lower concentrations of PCB 126.

Fig 4.

Hepatic gene expression of PON1 (A, B), CYP1A1(C, D), AhR (E,F), ApoA1(G,H). Results are mean ± SEM (n=3); ^a indicates significant differences to control, P<0.05

3.6. Correlation of the various parameters

A Pearson analysis of all data revealed that indeed the hepatic PON1 activity and mRNA levels as well as PON1 and CYP1A1mRNA levels were highly significantly correlated (Table 3). In the time-response study AhR mRNA levels were also significantly correlated to PON1 and CYP1A1 mRNA levels (Table 2, Figure 4). ApoA1 expression was not correlated with any other factor.

Table 3.

TBARS and Antioxidant Capacity: Dose- Response and Time-Course

Dose-Response PCB126 (μmol/kg)	Liver TBARS (nmol/100mg protein)	Serum TBARS (nmol/ml)	Serum Antioxidant Capacity(μmol/l)
Corn oil	297 ±17	3.0 ±0.3	723 ±107
1	389 ±14a	3.7 ±0.2	765 ±201
5	305 ±23	4.1 ±0.1a	783 ±94
Time-Course Time after injection	Liver TBARS (nmol/100mg protein)	Serum TBARS (nmol/ml)	Serum Antioxidant Capacity(μmol/l)
Corn oil – 1 week	397 ±39	6.1 ±0.6	881 ±42.9
PCB126 – 1 week	339 ±58	6.9 ±0.2	923 ±97.7
Corn oil – 2 weeks	237 ±32	5.9 ±0.2	804 ±50.4
PCB126 – 2 weeks	560 ±93a,b	5.0 ±0.3b	763 ±94.3

Results are expressed as mean ± SEM (n=3).

Statistically significant differences

^abetween PCB 126 and corresponding control, and

^bbetween 1 and 2 weeks of exposure to PCB 126; P<0.05

Table 2.

Pearson correlation analysis

	AhR	CYP1A1	ApoA1	PON1	PON1LPX	PON1LPH	PON1SPX	PON1SPH
Dose-response--
AhR	--	0.63	0.62	0.43	0.63	0.49	0.85 a	0.81 a
CYP1A1	--	--	0.35	0.81 a	0.88 a	0.89 a	0.68 a	0.85 a
ApoA1	--	--	--	−0.07	0.13	0.01	0.71	0.58
PON1	--	--	--	--	0.90 a	0.87 a	0.51 a	0.69 a
PON1LPX	--	--	--	--	--	0.96 a	0.62	0.72 a
PON1LPH	--	--	--	--	--	--	0.48	0.64
PON1SPX	--	--	--	--	--	--	--	0.94 a
PON1SPH	--	--	--	--	--	--	--	--
Time-course
AhR	--	0.91 a	0.27	0.86 a	0.78 a	0.75 a	0.65 a	0.65 a
CYP1A1	--	--	0.34	0.91 a	0.80 a	0.74 a	0.82 a	0.81 a
ApoA1	--	--	--	0.34	−0.04	−0.11	0.17	0.50
PON1	--	--	--	--	0.63 a	0.59 a	0.77 a	0.72 a
PON1LPX	--	--	--	--	--	0.99 a	0.76 a	0.67 a
PON1LPH	--	--	--	--	--	--	0.72 a	0.62 a
PON1SPX	--	--	--	--	--	--	--	0.89 a
PON1SPH	--	--	--	--	--	--	--	--

Value denotes the Pearson correlation coefficient r,

^aindicates a statistically significant correlation (p<0.05)

Abbreviation: PON1LPX (liver PON1 activity towards paraoxon), PON1LPH (liver PON1 activity towards phenylacetate), PON1SPX (serum PON1 activity towards paraoxon), PON1SPH (serum PON1 activity towards phenylacetate)

3.7. Liver and serum lipid peroxidation and serum antioxidant capacity

Hepatic and serum TBARS levels, expressed in terms for MDA, and serum antioxidant capacity, measured as the ferric reducing ability, are shown in Table 3. In the dose-response study a significant increases (P<0.05) in TBARS level was seen in 1μmol/kg exposed animals in the liver and in 5μmol/kg PCB 126-treated rats in the serum. A marginal dose-dependent but not significant increase of serum antioxidant capacity was seen. In the time-course study, a significant increase in hepatic TBARS after 2 weeks exposure to PCB 126 compared to the corn oil control and the PCB 126-1 week group was observed. The only change in serum TBARS was a decrease in the 2-week vs 1-week PCB-exposed group. These results agree with the two-way ANOVA analysis (Supplemental Table 2) which shows no significant overall effect of time or PCB 126 on liver TBARS but a significant effect of time of exposure on serum TBARS and a significant interaction effect on liver and serum TBARS. No significant changes were seen in the serum antioxidant capacity in either study (Table 3). However, the sensitivity of these endpoints may be very low due to the small number of animals (n=3) in each group, as the difference between the two corn oil groups in TBARS and serum antioxidant capacity levels and the large SEM indicate.

4. Discussion

Recently, researchers reported that PCB 126, the most potent dioxin-like PCB congener and a conventional food chain persistent organic pollutant, was found in Chicago air (Zhao et al., 2010). This suggests a new exposure source besides the food chain. PCB 126 was shown to induce oxidative stress and cause lipid peroxidation (Hassoun et al., 2002). PON1 is believed to protect against lipid peroxidation and to lower the risk of developing coronary artery disease and atherosclerosis (Shih et al., 1998; Furlong et al., 2000; Costa et al., 2005a). The goal of this study was to investigate the effects of PCB 126 on PON1 and the associated risk of lipid peroxidation.

Our results supported the hallmark toxic changes in response to TCDD and dioxin-like compounds, increase of liver weight and decreases of body weight gain (Denison and Heath-Pagliuso, 1998). Another hallmark is oxidative stress, which should elevate TBARS levels. Total antioxidant capacity, an index of the overall antioxidant environment in serum, should theoretically be inversely correlated to the level of serum lipid peroxides. On the other hand, PON1 is known to remove and prevent lipid peroxidation, which should lower TBARS and preserve the total serum antioxidant capacity. We were interested to see whether and how PCB 126 would influence these interrelated parameters. However, our TBARS results are difficult to interprete since it is not known to which extent the PCB treatment increased oxidative stress in these animals and/or to which extend is was counteracted by PON1.

PCBs have been shown to cause an elevation of serum total cholesterol (TC) and high density lipoprotein cholesterol (HDL-C) (Quazi et al., 1983). We observed a significant elevations of serum TC and HDL-C levels by the low dose PCB 126 exposure while the low density lipoprotein cholesterol (LDL-C) level was not changed. With the high dose or long time exposure both total and HDL-C levels were significantly decreased compared to the low dose or 1 week exposure, probably because the hepatic synthesis of cholesterol was impaired due to liver damage. The increase in total cholesterol, mediated by elevation of HDL-C, commonly known as ‘good cholesterol’, could be beneficial with respect to cardiovascular disease and atherosclerosis due to its association with PON1 (Aviram, 2006; Kaur and Bansal, 2009; Ferretti et al., 2010).

PON1 has been shown to protect both HDL and LDL against oxidation, which is considered a trigger of atherosclerosis (Aviram et al., 1998; Aviram and Rosenblat, 2005; Mackness and Mackness, 2010). Low levels of PON1 activity is a risk factor for cardiovascular disease (Aviram, 2006). Numerous factors can affect PON1 activity including oxidative stress (Franco-Pons et al., 2008). Since PCB 126 is known to increase oxidative stress, we expected to find a decrease in PON1 activity, but the opposite emerged: PCB 126 significantly increased hepatic and serum PON1 activities towards both substrates. Our in vitro experiment showed that this effect was not due to a direct effect of PCB 126 on PON1 activity. In vivo liver PON1 activity tripled and serum PON1 activity increased dose-dependently up to 100% with PCB 126 exposure. The dose-related ceiling of PON1 activity in the liver may be due to the onset of liver toxicity with the high dose of PCB 126 as indicated by the decreased cholesterol secretion and the biometric findings, or by the limits of gene induction. PON1 is synthesized in the liver and partly secreted into the blood where it is associated to HDL. No difference in serum PON1 between 1^st and 2^nd week of exposure was observed, suggesting that PON1 secretion was an early response to PCB exposure. Interestingly, no linear relationship between serum HDL-C and PON1 activity was found, indicating that binding of these two components is not a limiting factor.

To elucidate the mechanism of the increase in PON1 activity, we determined the hepatic levels of PON1 mRNA as well as those of CYP1A1, AhR and ApoA1. We observed a more than doubling in PON1 mRNA levels and, similar to the induction of CYP1A1 transcription, the highest levels was already reached with the low dose of PCB 126. Indeed, according to the Pearson calculations, CYP1A1 transcription correlated with PON1 transcription and PON1 activities, and PON1 mRNA correlated with PON1 activities. This suggests that the increase of PON1 activity was due to increases PON1 gene transcription which was up-regulated by the PCB 126 exposure. It was report that rat hepatic PON1 mRNA was increased by TCDD treatment (Boverhof et al., 2006) and hepatic PON1 protein levels were increased in rats treated with 3-MC (Rodrigo et al., 2001). PCB 126, 3-MC and TCDD bind to the AhR; the ligand-AhR complex is then translocated to the nucleus where it binds to ARNT and the ligand/AHR/ARNT complex binds to the XRE (xenobiotic response element) sequence in the promoter region of specific genes, resulting in their up regulation (Abel and Haarmann-Stemmann, 2010). The PON1 gene promoter does not have an XRE core sequence (GCGTG), but it has several so called XRE-like sequences (GCGGG). It was shown that the induction of PON1 transcription was AhR dependent and the localization of the AhR\ARNT complex was in the XRE-like sequence (Gouedard et al., 2004). Thus it is most likely that the up regulation of PON1 gene transcription by PCB 126 is also mediated by the AhR through binding to XRE-like sequences, resulting in increased PON1 activities in the liver and serum.

Interestingly, the mRNA of AhR was also significantly increased by PCB 126 treatments and the induction pattern is qualitatively and quantitatively similar to that of PON1. Similarly PCB77, another AhR agonist, was reported to increase the AhR mRNA (Mortensen and Arukwe, 2008), and aspirin caused an AHR-dependent upregulation of both, PON1 and AhR gene expression, in HepG2, primary rat hepatocytes, and mice in vivo (Jaichander et al., 2008). On the other hand, in our time-course study CYP1A1 gene remained upregulated whereas the AhR and PON1 transcription was only transiently increased. One possible explanation may be that the XRE consensus sequence and XRE-like sequence have different binding intensity to the PCB 126-AhR complex as described previously for other ligands (Gouedard et al., 2004). In addition, the overall efficiency and time course of gene transcription may also involve different recruitment of co-factors to the complex. The underlying mechanism needs to be further investigated. Independently of this, the induction of AhR gene expression may increase the chance for the ligand-receptor complex to be formed and therefore an increase in target gene transcription.

Another component of HLD-C is apolipoprotein A1 (ApoA1). ApoA1 was reported to stabilize the PON1-HDL complex (Gaidukov and Tawfik, 2005). Also, a combined down-regulation of PON1 and ApoA1 was observed in murine hepatocytes (Han et al., 2006) and Aroclor 1248, but not 3-MC and phenobarbitol caused an increase in ApoA1 hepatic mRNA and serum levels in rats (Oda et al., 2000). In contrast, no significant change of ApoA1 mRNA was seen in our studies, although a non-significant elevation in mRNA levels was observed with the high dose of PCB 126. This discrepancy deserves further evaluation, but shows that ApoA1 may not be a limiting factor in PCB 126-increased PON1 regulation and activity.

In summary, this is the first report of the regulation of PON1 status by PCB 126 exposure. Our results show that PCB 126-treatment increases liver and serum PON1 activities through the up-regulation of PON1 gene expression. This increase in PON1 activity, a protective antioxidant enzyme, may ameliorate oxidative stress induced by dioxin-like PCB congeners or other compounds. Also, serum PON1 activity may be useful in future studies as biomarker of exposure to dioxin-like compounds.

Highlights.

• PCB126 is a strong AhR agonist and reported to increase oxidative stress

• PON1 is an important serum antioxidant, produced in the liver and attached to HDL

• In rats PCB126 increased hepatic PON1 mRNA and hepatic and serum PON1 activity

• No changes in lipid peroxides (TBARS) or total serum antioxidant capacity were seen

• Increased PON1 activity may ameliorate oxidative stress produced by PCB126