Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2013 Mar 1.
Published in final edited form as: Dev Biol. 2012 Jan 2;363(1):191–200. doi: 10.1016/j.ydbio.2011.12.035

EGFR signaling is required for regenerative proliferation in the cochlea: Conservation in birds and mammals

Patricia M White 1,5, Jennifer S Stone 2, Andrew K Groves 3,6, Neil Segil 1,4,6
PMCID: PMC3288574  NIHMSID: NIHMS347571  PMID: 22230616

Abstract

Proliferation and transdifferentiaton of supporting cells in the damaged auditory organ of birds leads to robust regeneration of sensory hair cells. In contrast, regeneration of lost auditory hair cells does not occur in deafened mammals, resulting in permanent hearing loss. In spite of this failure of regeneration in mammals, we have previously shown that the perinatal mouse supporting cells harbor a latent potential for cell division. Here we show that in a subset of supporting cells marked by p75, EGFR signaling is required for proliferation, and this requirement is conserved between birds and mammals. Purified p75+ mouse supporting cells express receptors and ligands for the EGF signaling pathway, and their proliferation in culture can be blocked with the EGFR inhibitor AG1478. Similarly, in cultured chicken basilar papillae, supporting cell proliferation in response to hair cell ablation requires EGFR signaling. In addition, we show that EGFR signaling in p75+ mouse supporting cells is required for the down-regulation of the cell cycle inhibitor p27Kip1 (CDKN1b) to enable cell cycle re-entry. Taken together, our data suggest that a conserved mechanism involving EGFR signaling governs proliferation of auditory supporting cells in birds and mammals and may represent a target for future hair cell regeneration strategies.

Keywords: Cochlea, supporting cells, mitosis, EGFR, p27Kip1, conservation

Introduction

Hearing loss, caused by the death of sensory hair cells in the inner ear, affects millions of people around the world. In mammals, sensory hair cells and their surrounding supporting cells become post-mitotic during embryonic development (Ruben, 1967) and there is no evidence for regeneration of auditory hair cells after damage (Chardin and Romand, 1995; Daudet et al., 1998). In contrast, in birds and other non-mammalian vertebrates, functional regeneration of hair cells occurs through the proliferation of surrounding supporting cells and differentiation of progeny into replacement hair cells (Brignull et al., 2009; Corwin and Cotanche, 1988; Ryals and Rubel, 1988; Tucci and Rubel, 1990). The failure of hair cell regeneration in mammals poses one of the great challenges for regenerative medicine due to both the fragility and the cellular complexity of the organ of Corti.

Understanding how proliferation is regulated in supporting cells derived from mammals and birds is important to understanding the process of regeneration. Perinatal supporting cells from mouse, rat, and guinea pig retain a latent capacity to divide and differentiate into both hair cells and supporting cells in vitro (Diensthuber et al., 2009; Li et al., 2005; Lou et al., 2007; Oiticica et al., 2010; Savary et al., 2007; White et al., 2006; Zhai et al., 2005). EGF family ligands EGF and TGFα appear to promote proliferation and/or maintain progenitors under these conditions (Doetzlhofer et al., 2004; Oiticica et al., 2010), even though TGFα cannot stimulate supporting cell proliferation in the neonatal cochlea after hair cell loss (Daudet et al., 2002). How and whether these pathways connect to known intracellular regulators of proliferation, such as p27Kip1 (Chen and Segil, 1999; Lowenheim et al., 1999) or Rb1 (Yu et al., 2010), is also unknown. In the bird basilar papilla, Wnt pathway members (Alvarado et al., 2011) and activin (McCullar et al., 2010) have both been implicated in proliferation. No signals regulating proliferation in mammalian cochlear supporting cells have been described.

Here, we have taken advantage of the latent ability of perinatal mouse supporting cells, specifically, a subset of supporting cells marked by the low affinity Neurotrophin Growth Factor Receptor, p75 (p75NGFR), to divide when placed in dissociated cell culture (White et al., 2006), and compared their growth requirements to those of avian supporting cells in organ culture as they respond to hair cell loss. We found that auditory supporting cell proliferation in both mice and chickens requires EGFR signaling, as well as activity of a downstream element of the EGFR pathway, phosphoinositol-3 kinase (PI3K, also called PIK3CG). We also show that EGFR signaling causes the down-regulation of the CDK-inhibitor p27Kip1 (also called Cdkn1b). P27Kip1 has been shown to be partly responsible for the maintenance of supporting cells in a quiescent state in both the perinatal and the mature organ of Corti (Chen and Segil, 1999; Lowenheim et al., 1999). Our data demonstrate a requirement for EGFR signaling during normal avian supporting cell regenerative proliferation and suggest this requirement is conserved as a latent property of p75+ mammalian supporting cells that is revealed by their proliferation in culture. This finding illustrates a fundamental conservation in the regulation of supporting cell proliferation between birds and mammals and suggests potential targets for therapeutic intervention following hair cell loss.

Materials and Methods

Mice

The following Mus musculus strains were used: CD-1 Atoh1-GFP+ mice (Lumpkin et al., 2003), non-transgenic CD-1 mice, and 129/Sv p27Kip1 knockout mice (a gift from James Roberts; see (Fero et al., 1996). All experiments were performed in compliance with the US Department of Health and Human Services Guide for the Care and Use of Laboratory Animals, and were reviewed by the appropriate institutional animal care and use committees.

Chickens

5–10 day old Gallus gallus domesticus, also called White Leghorn chickens (Featherland Farms, Eugene, OR) were used in accordance with both institutional (University of Washington) and US Health and Human Services guidelines.

Mouse cochlear supporting cell purification and culture

The epithelial portion of the cochleae was dissected free from perinatal cochlear organs after digestion in 1 mg/ml dispase (Invitrogen) and 1 mg/ml collagenase (Worthington) for 8 minutes. Epithelia were dissociated after 3 minutes in 0.5 mg/ml trypsin (Sigma). The cells were then stained with rabbit anti-NGFR (also called p75) antibody (1:2000; Millipore), followed by incubation with phycoerythrinconjugated goat anti-rabbit secondary (1:400; PE, Millipore). PE-p75+ cells were positively sorted with a Mo-Flo cell sorter (DakoCytomation). Approximately 1000 cells were plated in a 4 μL drop, spotted onto LabTek CC2 chamber slides (Nunc) coated with 0.5 mg/ml poly-D-lysine (Sigma) and 50 μg/ml fibronectin (Invitrogen). After 1 hour, cultures were fed with DMEM/F12, 2% B27 supplement (Invitrogen), 100 units/ml penicillin (Sigma) and 20 ng/ml EGF (Biosource). Prior to fixation, in most experiments cultures were incubated with 2 μM of either 5-bromodeoxyuridine (BrdU, Becton Dickinson) or 5-ethyldeoxyuridine (EdU, Invitrogen).

Chicken basilar papilla cultures

Whole cochlear ducts were dissected, and the tegmentum vasculosum was removed. Organs were cultured free-floating in 78 μM streptomycin (plus 200 units/ml penicillin) in DMEM (Invitrogen) supplemented with 1% fetal bovine serum for 1 day. Inhibitor dissolved in DMSO (Sigma), or DMSO only, was added to cultures for two subsequent days, with 1 μM BrdU (Sigma) present for the last day, after which cultures were fixed.

Inhibitors

The following inhibitors were tested in mouse p75+ supporting cell cultures: AG1478 (LC Labs), LY294002 (AG Scientific), PD98059 (AG Scientific) bis-indolymaleimide-I (BIM-1, LC Labs), SU6656 (CalBioChem), STAT3i (CalBioChem) and SU5402 (EMD Biosciences). The concentrations of inhibitors used are described in the Results section. AG1479 and LY294002 were also tested in chicken basilar papilla cultures.

Antibody staining

The following antibodies were used: for mouse, anti-BrdU from Fitzgerald (1:500) or for chicken, Becton Dickinson (1:500); anti-p27Kip1 from Neomarker (1:500); anti-pH3 from Millipore (1:1000); anti-EGFR antibody from Santa Cruz Biotechnology (1:400), and anti-myosinVI from Proteus Biosciences (1:1000). Donkey secondary antibodies were from Millipore, and all were used at 1:250. FITC-Annexin-V reagent and cell labeling mix were both purchased from Biolegend.

Mouse cell cultures were fixed in 4% PFA in PBS (Electron Microscopy Sciences), washed in PBS, boiled in a microwave set on “hold” for 14 minutes in 10 mM citric acid (pH 6.0) to unmask epitopes, blocked in PBS with 2% donkey serum and 0.2% Triton X-100, and incubated overnight in primary antibody diluted into blocking solution at 4°C. For BrdU immunolabeling, cells were denatured in 2 M HCl prior to permeabilization. Secondary antibody labeling was performed in blocking solution for 1 hour at room temperature. For EdU staining, the Click-iT kit with Alexa-594 (Invitrogen) was used according to the manufacturer's instructions. FITC-Annexin-V staining was performed on live cells after 20 hours of culture according to the manufacturer's instructions.

14 μm mouse cryosections were cut from PFA-fixed mouse cochleae, dried onto SuperFrost Plus slides (Fisher), washed in Tris-buffered saline pH 7.4, boiled in citric acid for 14 minutes, and blocked in 2% donkey serum and 0.2% Triton X-100 prior to overnight primary antibody incubation at 4°C. Secondary antibody labeling was performed in blocking solution, either for 1 hour at room temperature or overnight at 4°C.

Microscopy

10× fluorescent images of DAPI, FITC and rhodamine stained mouse cultures mounted in Fluoromount (Southern Biotechnologies) were taken on a Zeiss Axioplan 2 upright microscope using a Zeiss Axiocam digital camera and Zeiss software.

For chicken cultures, Alexa-594 and 488 (Molecular Probes) stained cultures were mounted with Vectashield (Vector Labs) and imaged on an Olympus Fluoview-1000 (Tokyo, Japan) with a 20× objective. Olympus software was used to acquire confocal stacks.

Quantitative PCR

Messenger RNA was purified from samples using the RNeasy Micro kit (Qiagen), cDNA was synthesized using iScript (BioRad), and levels were measured on a 7500 Real-time PCR Detection System (ABI) with SYBR green SuperMix Low ROX (Quanta). Relative quantification of mouse gene expression was analyzed using the ΔΔCT method(Livak and Schmittgen, 2001), using dissociated cochlear cells run through the cell sorter as calibrator and the ribosomal RNA L19 as an endogenous reference. To measure EGFR family member transcript levels in chicken epithelia, the base of the basilar papillar epithelium from control animals was collected, as was similar preparations from animals that had received injections of gentamicin four days prior. mRNA levels for chicken Egfr, Erbb2, Erbb3, Erbb4, and Sox2 were determined by normalizing their Ct to that of chicken beta actin. Primer sequences were chosen using PrimerExpress and synthesized by IDT.

The following primer sequences were used to obtain the QPCR data presented in this paper: mouse L19, GGTCTGGTTGGATCCCAATG, CCCGGGAATGGACAGTCA; mouse Egfr, TTGGCCTATTCATGCGAAGAC, AAGCAGGCGGCGTAGTGT; mouse Erbb2, TGGATGATTGACTCCGAATGTC, TGCCATACGGGAGAATTCTGA; mouse Erbb3, GAGGATGGCAATGGTTATGTCA, CCCGGGAAGAGGATGTACCT; mouse Erbb4, CCACTTTACCACAACACGCTAGA, GATGAAGAGGCCTCCAATGACT; mouse p27Kip1, TCAAACGTGAGAGTGTCTAACG, CCGGGCCGAAGAGATTTCTG; mouse Egf, AGGACTCGGAAGCAGCTATCAA, TTCCGCTTGGCTCATCACA; mouse Tgfα, GAGCCTGTGTGGGCACCTA, GCTCACGAGGACGCTAATCC; mouse Hb-egf, AAAGCCCAAGGTGCTGATGT, GGGAGAGGACACAGGCAAAC; mouse Nrg1, GGGACCAGCCATCTCATAAAGT, CGCCTCCATTCACACAGAAA; mouse Nrg2, GAAGGAGGCTGAGGAGCTGTAC, ACCAGCAGGGCCACACA; mouse Nrg3, AGGACAGTGCGAGCGAAAA, ATTTGGCCGTGGGACTCA; mouse Nrg4, TCAGCCACACGACTTCCAAA, TCCCCTGTGGCCTGCTT; mouse Btc, CCTGGTGGTCTGCTTGATAGTG, GTGCAGACGCCGATGACTAA; chicken β-Actin, CCGTGCTGTGTTCCCATCT, TGCTCTGGGCTTCATCACC; chicken Egfr, GGTTGGTCTAGGCATCGGTCT, TGGTTCGACAAGCTCCCTCT; chicken Erbb2, CCGAGAGCCACTACGAGACC, TGCACCTCCTTGATGTCCTG; chicken Erbb3, CCTGAGGAGCAGGGCTATGA, GGGTTGTCGAAGGCACAGTC; chicken Erbb4, CCCTTCTAGCTGCCTCACTCTT, CCTTCCTTCCTTTCCGGTTC; and chicken Sox2, CAACGGAGGCTATGGGATG, GCGAGCTGGTCATGGAGTT.

Quantification and Statistical analysis

For experiments involving sorted p75+ cultures, images of stained cultures were processed in Adobe Photoshop and quantified using the Find Maxima function of ImageJ (build 1.64, NIH). The fraction of cells expressing p27Kip1 or incorporating BrdU would be determined for each of triplicate cultures per condition, and that average was taken as the value for the experiment. In QPCR experiments, a pool of sorted cells was divided in half: half was lysed immediately for cDNA preparation, and the other half was plated in multiple cultures that were lysed together at the stated time point (24 hours). Each experiment derived from a unique sorting preparation and thus constituted a biological replicate. The number of experiments, n, is given for each set when the average value is presented. Error bars represent the standard error of the mean (s.e.m.) unless otherwise stated. Unpaired, two-tailed student's t-tests were performed to determine statistical significance.

For chicken basilar papilla cultures, ImageJ was used to select individual optical slices from confocal stacks. Photoshop was used to arrange images and to overlay a rectangle onto the mid-apical region in the neural half of the basilar papilla. This rectangle was 80 μm tall and 320 μm wide, covering an area equal to 25,600 μm2, with the long side parallel to the long side of the basilar papilla. All BrdU+ cells in the rectangle were counted manually. This region, reported to be the area with the highest levels of proliferation in the regenerating BP, is about 16% of the total area that incorporates BrdU in response to damage (Stone et al., 2004). The percentage of BrdU+ supporting cells was determined for each organ, and the number of organs for each condition, n, is given when the average value is stated. Error bars represent standard error of the mean, and unpaired, two-tailed student's t-tests were performed to determine statistical significance.

Supporting cell nuclear layers were identified with DAPI in the same location and imaged in a confocal z-stack. 3–5 squares, each representing 2000 μm2, were overlaid on these images and nuclei within the squares were counted manually. Average values for the squares for each organ were used to calculate supporting cell density in each condition.

Results

Avian auditory supporting cells are normally quiescent, but they proliferate in response to the loss of hair cells in vivo (Corwin and Cotanche, 1988; Ryals and Rubel, 1988) or in organ culture (Oesterle et al., 1993). We cultured P5 chicken cochlear ducts containing the basilar papilla (Fig. 1A, diagram) for 24 hours in control media (Fig. 1B, D) or in media containing the aminoglycoside antibiotic streptomycin (Fig. 1C, E), which kills auditory hair cells (Shang et al., 2010). Both sets of cultures then received the thymidine analogue EdU in media for another 24 hours (Fig. 1B–E, red). The control cultures have undamaged MYO6+ hair cells (Fig. 1B, green) and no supporting cell proliferation (Fig. 1B, D, red). Streptomycin-treated organ cultures show significant hair cell death (Fig. 1C, green). In response, some supporting cells adjacent to dying hair cells enter S-phase, as demonstrated by their incorporation of EdU (Fig. 1C, E, red).

Figure 1. Chick auditory supporting cells proliferate in response to hair cell loss, but mouse auditory supporting cells do not.

Figure 1

Open in a new tab

A. Diagram of the cultured chick basilar papilla (BP). Chick BP images are from the region indicated by the box: distal of the midpoint, in the neural half.

B. Undamaged cultured chick BP, incubated for 48 hours, the last half with with EdU. Hair cells are revealed by MYO6 (green) and no proliferation is observed (EdU, red).

C. Chick BP cultured for 24 hours with 1 μM streptomycin followed by 24 hours with EdU; stained identically to (B). Hair cell loss (green) is nearly complete and proliferation is observed (red).

D. Same field as (B), showing the supporting cell nuclear layer (DAPI, blue) and EdU (red). No proliferation in the supporting cell layer. Size bar 10 μm.

E. Same field as (C), showing co-localization of EdU (red) and supporting cell nuclei (blue).

F. Diagram of the mouse organ of Corti. Images (E–H) are taken from the approximate region indicated.

G. Undamaged mouse organ of Corti, incubated for 48 hours, the last half with EdU. Hair cells are revealed by Atoh1-GFP fluorescence (green), and no proliferation (red) is observed in the sensory region.

H. Mouse organ of Corti cultured for 24 hours with 1 μM gentamycin followed by 24 hours with EdU; stained identically to (G). Hair cell loss (Atoh1-GFP, green) is nearly complete, but no proliferation (EdU, red) is observed.

I. Same field as (G). Mouse supporting cells, revealed by PROX1 immunostaining (blue) do not incorporate EdU (red). Size bar 25 μm.

J. Same field as (H). PROX1 immunostaining (blue) shows that surviving mouse supporting cells do not proliferate (EdU, red) after hair cell ablation.

Antibiotic treatment of intact mammalian perinatal organ cultures also leads to sensory hair cell loss (Richardson et al., 1997; Stephens, 1968). We cultured P1 mouse cochlear explants for 24 hours in control or gentamicin-containing media, and then in media with EdU for an additional 24 hours to label dividing cells. Atoh1-GFP expressing hair cells (Lumpkin et al., 2003) are missing from cochlear cultures treated with gentamicin (Fig. 1H, green) but are present in control cultures (Fig. 1G, green). In contrast to birds, no proliferation of supporting cells occurs in response to hair cell loss, as seen by the lack of EdU staining in supporting cells positive for the marker PROX1 (Bermingham-McDonogh et al., 2006) (Fig. 1I,J). Both the avian and the mammalian proliferation results are consistent with published findings (Daudet et al., 1998; Oesterle et al., 1993; Richardson et al., 1997; Shang et al., 2010).

Although perinatal mammalian supporting cells do not divide in organ culture, they display a latent potential for cell division when purified and cultured as dissociated cells (White et al., 2006). Pillar, Hensen's, and Claudius cells (Gestwa et al., 1999) (Fig. 2A) comprise one subset of cells that can be purified by fluorescence-activated cell sorting (FACS) using an antibody to p75 (also called NGFR, the low affinity NGF receptor). In vivo, mouse supporting cells express the EGF receptor protein (EGFR, Fig. 2B; Hume et al., 2003; Stankovic et al., 2004) at varying levels: outer pillar and Hensen's cells stain more brightly than Claudius cells (Fig. 2B, cf. arrows with bracket). We assessed levels of mRNA expression for ERBB receptors and ligands in FACS-purified p75+ cells with real-time PCR (Fig. 2C, D). Sorted p75+ supporting cells were enriched for mRNA of all four receptors relative to the parent population, unpurified cochlear cells (Fig. 2C). Among the 11 EGF-family ligand mRNAs tested, seven could be amplified from the parent population (Fig. 2D). Surprisingly, p75+ supporting cells have high levels of transcripts for two ligands that preferentially bind EGFR, EGF and TGFα. Consistent with its reported expression in the organ of Corti in vivo (Hume et al., 2003; Stankovic et al., 2004), EGFR protein was also detected on sorted p75+ cells 1 hour after plating (Fig. 2E).

Figure 2. Purified perinatal mouse supporting cells re-enter the cell cycle in culture in an EGFR-dependent manner.

Figure 2

Open in a new tab

A. Section of P2 mouse cochlea. Pillar and Hensen cells (arrows), as well as Claudius cells (bracket) are p75+ (red); hair cells are Atoh1-GFP+ (green).

B. Section of P2 mouse cochlea, stained with anti-EGFR (red) and DAPI (cyan) to reveal nuclei. Arrows and brackets are the same as in (A). Size bar: 50 microns.

C. Expression levels of mRNA transcripts for four ErbB receptors measured in p75+ FACS isolated supporting cells with QPCR. Gene expression levels are shown as fold change, the relative values in expression of p75+ sorted cells over the unpurified parent population.

D. Expression levels of mRNA transcripts for 8 ErbB family ligands measured in freshly isolated supporting cells with QPCR: epidermal growth factor (Egf), transforming growth factor α (Tgfα), heparin-binding EGF (Hbegf), neuregulin-1 (Nrg1), neuregulin-2 (Nrg2), neuregulin-3 (Nrg3), neuregulin-4 (Nrg4), and betacellulin (Btc). Amphiregulin and eregulin did not amplify from P2 cochlea. Fold expression normalizes the level of transcripts detected to unpurified cells.

E. EGFR protein expression on supporting cells cultured for 1 hour (red). Top inset shows a higher magnification image of a cell (in grayscale, to better show detail). Bottom inset shows an identically exposed control without primary antibody. Although a no-antibody control is not conclusive evidence of specificity, the presence of EGFR staining in vivo (Figure 2B) and the proliferation of supporting cells in EGF (Figure 2F), taken with the absence of staining in the no-antibody control suggest the antibody staining is specific as previously shown (Hume et al., 2003; Stankovic et al., 2004).

F. Cochlear supporting cells take up BrdU (green). These cells were pulsed with BrdU from 20 to 24 hours in culture and fixed immediately.

G. Cochlear supporting cells enter G2/M, as revealed by pH3 staining (green), and by chromatin morphology (inset). These cells were fixed after 30 hours culture.

H. Cochlear supporting cells pulsed with BrdU from 20 to 40 hours in culture. 78.0 ± 3.9% of cells are BrdU-labeled (green).

I. Same field as (E), stained with DAPI. Top and bottom insets correspond as well.

J. Same field as (F), stained with DAPI.

K. Same field as (G), stained with DAPI. Size bar 25 μm.

L. Same field as (G), stained with DAPI.

M. Time course of the onset of cell cycle re-entry. BrdU uptake is first observed at 16 hours in vitro, and pH3+ cells at 24 hours in vitro. BrdU bars indicate s.e.m., and pH3 bars indicate range.

N. AG1478, an EGFR inhibitor, blocks BrdU uptake. Supporting cells were pulsed with BrdU from 20 to 24 hours or to 40 hours, as indicated, in either 20 ng/ml EGF (control, green bars), 1 μM AG1478 (gray bars), no EGF (brown bars), and 1 μM AG1478 alone (purple bars). These conditions measure initial cell cycle re-entry (by 24 hours, EGF compared to EGF + AG1478, n=10, p=10−10 by t-test) and overall cell cycle re-entry (by 40 hours, EGF compared to EGF + AG1478, n=8, p=10−7 by t-test). No EGF and 1 μM AG1478 alone were each performed 3 times. Bars represent s.e.m.

O. Dose response of AG1478. Cultures were pulsed with BrdU from 20 to 24 hours with varying doses of AG1478. n=3 or more cultures per time point. Bars represent s.e.m.

Expression levels of EGF family ligands and receptors undergo some changes when purified p75+ supporting cells are placed in culture for 24hrs (Supplemental Fig. 1). With respect to receptor expression, mRNA levels of EGFR, ErbB2, ErbB3, and ErbB4 are reduced. . In addition, expression of two ligands specific for EGFR are substantially reduced in cultured supporting cells, with Egf mRNA level at 4% of its initial values, and Tgfα at 35%. The ERBB4 ligands Nrg2, Nrg4, and Btc expression are also reduced in culture. Surprisingly, the level of ERBB4 ligand Nrg1 (Jones et al., 1998) mRNA increases twenty-fold during culture, and the level of the EGFR-ligand Hb-Egf (Shin et al., 2003) increases by 2.5-fold. These data are consistent with the possibility that p75+ supporting cells could transiently stimulate their own EGF receptors during the first twenty-four hours in culture.

We modified our previously published culture system (White et al., 2006) to allow the growth of purified supporting in the absence of periotic mesenchyme. We documented the proliferation of purified p75+ supporting cells cultured in the presence of EGF. S-phase, measured by BrdU uptake, began after 16 hours for p75+ supporting cells cultured in defined medium with EGF (Fig. 2M). By 24 hours, 25.4 ± 1.7% of cells were labeled with BrdU (Fig. 2F, J). Histone-H3 phosphorylation, indicating cells in G2-M phase, was first detected at 24 hours in vitro (Fig. 2G, K). Brightly labeled, condensed chromatin characteristic of M phase was noticeable by 30 hours (Fig. 3G, K, insets). When BrdU was added to cultures at 20 hours and retained for 20 hours more, 78.0 ± 3.9% of cells were labeled (Fig. 2H, L); such pulses measure the cumulative fraction of p75+ supporting cells that enter S-phase. This robust and relatively synchronous return to the cell cycle by normally post-mitotic perinatal mammalian supporting cells provides a means to investigate the signal transduction pathways needed for cell cycle re-entry.

Figure 3. EGFR signaling is necessary for supporting cell cycle re-entry in the damaged chick basilar papilla.

Figure 3

Open in a new tab

A. Expression levels of transcripts for four ErbB receptors and the supporting cell marker Sox2, normalized to chicken β-actin. The value 1 indicates 1% of chicken β-actin mRNA. Blue bars indicate levels in epithelia from the base of the basilar papilla from control animals. Similar levels are seen in tissue obtained from 4 day streptomycin-treated animals (red), consistent with the idea that regenerating cells express these receptors. The supporting cell marker Sox2 is shown for comparison. All error bars indicate s.e.m.; n=3.

B. Experimental design for measuring proliferation in chick basilar papilla supporting cells. Control experiments receive DMSO instead of AG1478. Quantified fields were similar in location to Fig. 1.

C. P5 chick basilar papilla organ culture, treated with 1 μM gentamycin to kill hair cells, and incubated with BrdU. Anti-MYO6 antibody (green) demonstrates hair cell loss; BrdU uptake (pink) reveals proliferating supporting cells, and DAPI (blue) taken at the same optical plane shows supporting cell nuclei. (C') and (C”) show BrdU and DAPI channels from the same field. Size bar 15 μm.

D. High-power image of nuclei from the same field, demonstrating mitotic figures (arrows). Size bar 5 μm.

E. P5 chick basilar papilla organ culture treated with 1 μM gentamycin and 10 μM AG1478, and stained as in (C). Hair cell loss (green) and supporting cell survival (blue) are both unchanged by the treatment (cf. with C) but BrdU incorporation is significantly reduced. (E') and (E”) show BrdU and DAPI channels in the same field.

F. High-power image of nuclei from the field in (E); nuclear morphology is normal but no mitotic figures are evident.

G. Quantification of BrdU+ cells as a function of AG1478 concentration. Each bar represents the average ± s.e.m. of 5–12 organs. Significant reductions are seen with 1 and 10 μM (p=0.005, and p=0.0006, respectively, t-tests).

EGFR signaling is necessary to trigger cell cycle re-entry of cultured mammalian p75+ supporting cells

Since mouse vestibular supporting cells proliferate in response to NRG1 and other ERBB family ligands (Kuntz and Oesterle, 1998; Montcouquiol and Corwin, 2001b), we tested whether EGFR signaling was necessary for cochlear p75+ supporting cell cycle re-entry. We compared proliferation in control cultures containing 20 ng/ml EGF to ones containing 20 ng/ml EGF + 1 μM AG1478, an EGFR specific inhibitor (Busse et al., 2000; Osherov and Levitzki, 1994). We measured BrdU uptake at the onset of S-phase, between 20 and 24 hours, as well as cumulative proliferation, between 20 and 40 hours (Fig. 2N). AG1478 (1μM) reduced proliferation of p75+ supporting cells by 89.5%, from 25.4% to 2.8% ± 0.5% after 24 hours (n=10, p=10−10). AG1478 reduced cumulative proliferation after 40 hours by 70.5%, from 78.0 ± 3.9% to 23.0 ± 3.7% (n=8, p=10−7). Similar results were obtained with p75+ supporting cell cultures containing 1 μM AG1478, but no EGF (Fig. 2N). AG1478 inhibition was dose dependent: a reduction in proliferation was first observed at 30 nM (Fig. 2O). No difference was seen in cell survival in 1 μM AG1478 after 24 hours (770 ± 110 cells per culture in control vs. 680 ± 80 cells per culture in AG1478, p=0.51). We stained both control and 1 μM AG1478-containing cultures with fluorescently labeled Annexin-V reagent at 20 hours to detect early stages of apoptosis (Casciola-Rosen et al., 1996); 2.1% of cells in control cultures and 1.0% of cells in AG1478-containing cultures were Annexin-V-positive, indicating that differential apoptosis cannot explain the differences in BrdU uptake. We also measured proliferation levels in cultures without exogenous EGF (Fig. 2N). Without EGF, proliferation was reduced by 45% in cultures at 24 hours (14.7 ± 7.0% BrdU+ cells in no growth factor, n=13, p=0.0002); however, cumulative proliferation was not significantly reduced (60.8 ± 13% BrdU+ cells in no growth factor vs. 78.0 ± 3.9% in EGF, n=3, p=0.09). Taken together, these data are consistent with the interpretation that inhibition of EGFR signaling blocks cell cycle re-entry without affecting p75+ supporting cell survival.

The requirement for EGFR signaling is conserved in avian hair cell regeneration

To determine whether EGFR family members are present in the basilar papilla, we used QPCR to detect chicken transcripts for all four family members on basal chicken epithelial preparations. We measured levels in both control basilar papillar epithelia, which contains hair cells and quiescent supporting cells, and basilar papillae four days after in vivo hair cell ablation with gentamicin, which predominantly contains regenerating supporting cells. Three receptor transcripts are expressed to similar degrees in control and drug-damaged epithelia (Fig. 3A). Egfr, ErbB2 and ErbB4, were detected in freshly isolated basilar papilla, while ErbB3 was not (not shown). These data are consistent with a role for some Egf receptor family members in regulating avian supporting cell activity.

We tested whether EGFR signaling was also necessary for supporting cell proliferation following hair cell ablation in chick organ cultures. Inclusion of AG1478 in streptomycin-treated chick basilar papilla cultures inhibited cell cycle re-entry of chick supporting cells (Fig. 3). AG1478 or vehicle control (DMSO) was added to streptomycin-treated cultures 24 hours before the onset of S-phase to block EGFR signaling (Fig. 3B). Hair cell ablation throughout the organ was complete by 72 hours in both conditions (Fig. 3C, E, green). On the neural side, near the apical end of the basilar papilla (Stone et al., 2004), proliferation was prominent in controls, with 36.3% of supporting cells incorporating BrdU over a 24-hour period (cf. 3C' with 3C” and 3G; 105 ± 16 BrdU+ cells versus 289 ± 21 nuclei /10,000 μm2, n=12). Mitotic figures were also seen at high power (Fig. 3D, arrows). Application of 10 μM AG1478 reduced the number of BrdU labeled cells by 76% in the same region (Fig. 3E, G; 25 ± 8 BrdU+ cells /10,000 μm2, n=9, p=0.0002). The reduction in BrdU incorporation was not due to supporting cell death, as nuclei were observed in similar densities in the supporting cell layer in both conditions (289 ± 21 nuclei in control versus 284 ± 20 nuclei in a 10,000 μm2 area) and supporting cell nuclei in AG1478 showed no fragmentation (Fig. 3F). These results show that, as in dissociated perinatal mammalian supporting cells, EGFR signaling is necessary for the regenerative wave of cell cycle re-entry by avian supporting cells in the intact basilar papilla after hair cell ablation.

PI3K activation is required for p75+ supporting cell proliferation in both mice and birds

To determine which downstream pathways are likely responsible for mediating the EGFR-dependent proliferative response, we tested specific inhibitors to a variety of intracellular signaling pathways in our mouse supporting cell proliferation assay (reviewed in (Schlessinger, 2005). We found no significant effect on overall proliferation using inhibitors to mitogen-activated protein kinase kinase (MAP2K1, PD98059, 40 μM), protein kinase C (PKC, BIM-1, 10 μM), c-src (SU6656, 25 μM) or STAT3 (STAT3i, 20 μM) (data not shown). In contrast, phosphoinositol receptor kinase (PI3K) activity was necessary for proliferation of mouse p75+ supporting cells (Fig. 4A). 20 μM of the PI3K inhibitor LY294002 blocked proliferation at 24 hours by 98%, reducing BrdU incorporation from 25.4 ± 1.7% in control cultures to 0.4 ± 0.5% (n=13, p=10−14). At 40 hours, LY294002 blocked proliferation by 82%, reducing the fraction of BrdU+ cells from 78.0 ± 3.9% to 14.2 ± 0.4% (n=3, p=10–6).This effect was dose dependent, starting at 5 μM (Fig. 4B). Supporting cell survival after 24 hours in 20 μM LY294002 was not significantly different from control (840 ± 101 cells per culture in control vs. 740 ± 90 cells per culture in LY294002, p=0.47). Moreover, similar to control and 1 μM AG1478-containing cultures, only 1.4% of p75+ supporting cells cultured in 20 μM LY294002 for 20 hours were Annexin-V-positive (Supplemental Figure 2C).

Figure 4. PI3K activity is necessary for cell cycle re-entry in both chick basilar papilla and purified mouse supporting cells.

Figure 4

Open in a new tab

A. LY294002, a PI3K catalytic subunit inhibitor, blocks BrdU uptake. Mouse supporting cells were pulsed from 20 to 24 hours or from 20 to 40 hours, as indicated in either control (green bars) or 1 μM LY294002 (orange bars). These conditions measure initial cell cycle re-entry (by 24 hours, n=13, p=10−14, t-test) and overall cell cycle re-entry (by 40 hours, n=3, p=10−6, t-test).

B. Dose response of LY294002. Three or more mouse supporting cell cultures were pulsed with BrdU from 20 to 24 hours with varying doses of LY294002.

C. PI3K activity is also required for supporting cell proliferation in the chick. 3–12 organs were treated with gentamycin, followed by varying concentrations of LY294002, and proliferation was quantified in the region shown in Fig. 1. All error bars represent s.e.m.

Blocking PI3K activity using LY294002 treatment also reduced supporting cell proliferation in streptomycin-treated organ cultures of chicken basilar papilla (Fig. 4C). 10 μM LY294002 inhibited BrdU uptake by 91.4% (10 ± 6 BrdU+ cells/10,000 μm2 in LY294002 compared to 105 ± 16 BrdU+ cells/ 10,000 μm2, n=4, p=0.005). Chicken cells were highly sensitive to inhibition of PI3K, as significant reduction in proliferation was seen at 1 μM LY294002 in chicken organ culture, compared to 10 μM in cultures of purified mouse p75+ cells (Fig. 4, cf. B with C). Similar to inhibition of EGFR signaling, application of LY294002 does not reduce the density of supporting cell nuclei (270 ± 22 nuclei in 10 μM LY294002 vs 289 ± 21 nuclei in control, per 10,000 μm2). These data suggest that PI3K is a likely down-stream effector of EGFR signaling for proliferation in mouse and chicken supporting cells.

EGFR signaling promotes mouse p75+ supporting cell proliferation by down-regulating the cell cycle inhibitor p27Kip1

Mouse supporting cells express high levels of the cyclin-dependent kinase inhibitor p27Kip1, and p27Kip1 mutant mice show sporadic, aberrant cell cycle re-entry in the postnatal mouse cochlea, suggesting that it normally acts to maintain the post-mitotic state of supporting cells (Chen and Segil, 1999; Lowenheim et al., 1999). While freshly purified p75+ mouse cochlear supporting cells express p27Kip1, they down-regulate p27Kip1 protein (Fig. 5A) and mRNA levels (Fig. 5B) during the first 24 hours of culture as they re-enter the cell cycle (Fig. 2M). We tested whether down-regulation of p27Kip1 protein depends on EGFR or PI3K activity (Fig. 5C–H). By 40 hours in vitro, only 7.8% ± 0.8% of cells cultured in control conditions express p27Kip1 protein (Fig. 5A, C), and these cells did not enter S-phase as shown by their lack of BrdU incorporation (p27Kip1+/BrdU−, Fig. 5C, F, I). In contrast, 47.1% ± 5.0 % of p75+ supporting cells cultured for 40 hours in AG1478 were p27Kip1+/BrdU− (Fig. 5D, G, I, n=7, p=10−5). Similarly, 40.0 ± 10.0 % of p75+ supporting cells cultured for 40 hours in LY294002 were p27Kip1+/BrdU− (Fig. 6E, H, I, n=3, p=0.0008). These data show that EGFR signaling and PI3K signaling are necessary to down-regulate p27Kip1 protein in a subset of cultured p75+ supporting cells.

Figure 5. EGFR and PI3K signaling are each necessary to down-regulate p27Kip1 protein and promote cell cycle re-entry.

Figure 5

Open in a new tab

A. Quantification of the relative fraction of p27Kip1+ cells with time after plating. The percent of p27Kip1+ cells decreases from 88% to 30.9% ± 2.0% over the first 24 hours (n=11, p=4*10−8 ANOVA and t-test). Between 3 and 11 cultures were quantified per time point.

B. Quantification of p27Kip1 mRNA in purified supporting cells over time in culture. 3 cultures were assessed by QPCR in triplicate for levels of p27Kip1 and L19 messages for each time point, and fold was calculated relative to the mRNA levels in an aliquot of the same cells lysed immediately after purification.

C–K. Purified supporting cells were cultured with or without inhibitors as indicated, pulsed with BrdU from 20 to 40 hours (green, C–E) to label all dividing cells. Cultures were counterstained with anti-p27Kip1 (red). P27Kip1 immunoreactivity is shown together with BrdU (C–E), to illustrate a lack of co-localization, and alone (F–H), to illustrate relative levels of staining. DAPI was used to reveal nuclei (white, I–K). Non-dividing cells expressing p27Kip1 appear red in the upper panels. Size bar: 50 μm.

L. Quantification of the non-dividing p27Kip1+ cells over time in cultures with or without inhibitors. In control cultures, significantly fewer non-dividing p27Kip1+ cells are seen at both 24 hours and 40 hours (n=7, p=10−8, t-test). At 40 hours, significantly more p27+ G1 cells are seen in AG1478 (47.1% ± 5.0, n=7, p=10−4, t-test) and in LY294002 (40.0% ± 10.0, n=3, p=0.0008, t-test) compared to control cultures. Bars represent averages of 3–11 cultures per time point and condition. All error bars represent s.e.m.

Figure 6. Supporting cell cycle re-entry requires down-regulation of p27Kip1 by the EGFR pathway.

Figure 6

Open in a new tab

A–C. Purified supporting cells from wild-type mice were cultured with or without inhibitors as indicated and pulsed with BrdU from 20 to 40 hours (green) to label all dividing cells.

D–F Same fields as above, stained with DAPI.

G–L. Same experiment as (A–F), except supporting cells were isolated from p27Kip1 knockout mice.

M. Quantification of cultures presented in (A–L). Significantly more cells from mutant animals re-enter the cell cycle compared to wild-type in AG1478 only (KO: n=3, p=0.002, t-test). Bars represent an average of 3 cultures per condition, ± s.e.m.

N. Summary diagram of signaling mechanisms deduced from data presented here. In quiescent supporting cells, p27Kip1 maintains the cells in a post-mitotic state. Once activated after dissociation, EGFR and PI3K signaling causes p27Kip1 down-regulation (dotted lines) to promote proliferation. PI3K signaling is also required independently of p27Kip1 (see I, M).

To determine whether EGFR signaling was also necessary to down-regulate p27Kip1 mRNA levels, we used QPCR of cDNA derived from p75+ supporting cell cultures treated with AG1478 or vehicle control. Supporting cell p27Kip1 mRNA levels declined to 16.3 ± 2.0% of their starting levels in control cultures after 24 hours, correlating with cell cycle re-entry (Fig. 5B). In contrast, p75+ supporting cells cultured with 1 μM AG1478 had significantly higher levels of p27Kip1 message (41.5 ± 3.0% of starting levels in AG1478 compared to 16.3 ± 2.0% in control, n=3, p=0.007). Thus, EGFR signaling likely regulates p27Kip1 through a transcriptional mechanism.

These results suggested that one function of EGFR signaling in cell cycle re-entry is down-regulation of p27Kip1. To test this hypothesis, we purified p75+ supporting cells from wild-type and p27Kip1 knockout animals and cultured them with and without EGFR inhibitors. As with wild-type p75+ supporting cells, 88.9% ± 0.5% of p75+ cells derived from the p27Kip1 knockout re-entered S-phase in the first 40 hours (Fig.67A, G and M). However, in the presence of 1 μM AG1478, significantly more p27Kip1-KO p75+ cells re-entered S-phase compared to wild-type cells (Fig. 6B, H, M, 58.1% ± 6.9% vs. 23.0 ± 3.7%, n=3, p=0.002). These results indicate that for a significant portion of the purified p75+ supporting cell population, EGFR signaling down-regulates p27Kip1 prior to cell cycle re-entry.

In contrast, there was no significant difference in cell cycle re-entry when wild-type and knockout p75+ supporting cells were cultured in the PI3K inhibitor LY294002 (Fig. 6C, I, M). This suggests that in purified p75+ supporting cells, PI3K also functions down-stream of an additional signal that does not rely on the down-regulation of p27Kip1 to maintain the post-mitotic state of supporting cells (Fig. 6N).

Discussion

In spite of the failure of mammalian cochlear regeneration, perinatal rodent supporting cells retain a latent capacity to re-enter the cell cycle and differentiate into hair cells when grown in dissociated cell culture (Diensthuber et al., 2009; Lou et al., 2007; Oiticica et al., 2010; Savary et al., 2007; White et al., 2006; Zhai et al., 2005). We have taken advantage of this observation to identify a cellular signaling pathway required for cell cycle re-entry by mammalian supporting cells and we have compared these requirements to those in a naturally regenerating model, the chick basilar papilla. We discovered that EGFR signaling is required for cell cycle re-entry by purified p75+ mouse supporting cells grown in dissociated culture, and that this requirement is conserved by proliferating supporting cells during regeneration of the chicken auditory organ, the basilar papilla. Taken together with our data indicating involvement of the downstream effector of EGFR signaling PI3K, our data suggest that some of the factors driving mitotic regeneration in the chicken cochlea may be present in a latent state in mammals.

We show that mouse cochlear p75+ supporting cells with latent regeneration capacity express both receptors and ligands for the EGFR family and that EGFR signaling regulates proliferation in cultured mouse cochlear p75+ supporting cells (Fig. 2). These cells re-enter the cell cycle with similar kinetics to other quiescent populations such as liver or epidermal cells (Clausen et al., 1986; Michalopoulos et al., 1982). Inhibition of EGFR signaling reduced the fraction of mouse p75+ supporting cells that re-entered the cell cycle by over 70% without altering cell survival.

In light of our findings, it is interesting that adding EGF to organotypic cultures of the rodent organ of Corti has no effect on supporting cell division (Daudet et al., 2002; Romand and Chardin, 1999). The structural integrity of the claudin-rich tight junctions that characterize the apical surface of the organ of Corti may prevent polypeptides from interacting with receptors like EGFR, that are present on the lateral walls of sensory cells (cf. Fig. 2B). This age-dependent decline in proliferative potential correlates with the maturation of tight junctions (Gu et al., 2007), and with the development of large, actin-rich cortical bands (Burns et al., 2008) that may also restrict the localization of cell surface receptors such as EGFR. Consistent with this idea, another member of the EGF family, TGFα, has a mitogenic effect on rodent utricles that declines with age (Kuntz and Oesterle, 1998; Yamashita and Oesterle, 1995).

We also show that EGFR inhibition blocks S-phase re-entry in supporting cells in chicken basilar papilla organ cultures treated with streptomycin, indicating that EGFR signaling is necessary for chicken supporting cells to re-enter the cell cycle after damage (Fig. 3). This inhibition occurs without altering the timing or extent of hair cell death or supporting cell survival. QPCR results suggest that both Egfr and ErbB4 are expressed in normal and hair cell ablated basilar papilla, consistent with a role in regulating supporting cell activity (Fig. 3). This study joins a growing body of work identifying a number of signaling systems that influence proliferation in the basilar papilla. RNA interference studies have identified Wnt4 as necessary for damage-induced proliferation (Alvarado et al., 2011). In cultures of undamaged basilar papilla, a TGFβ family member, activin (also called INHBA), has been reported to regulate proliferative turnover (McCullar et al., 2010). Many studies show that TGFβ signaling is a common antagonist of EGFR signaling (Kubota et al., 2000; Xu et al., 2010). Further experiments will be necessary to determine if these pathways act on different populations, or how they combine to regulate cell replacement in the damaged organ.

PI3K was the only EGFR downstream signaling intermediary that we found to be necessary for proliferation of mouse cochlear p75+ supporting cells (Fig. 4). We also showed PI3K activity was necessary for proliferation in regenerating chicken basilar papilla (Fig. 4). Early studies on cAMP-mediated signals in the chicken basilar papilla suggested that PKA activity promotes supporting cell proliferation, but the extrinsic signaling molecule was never determined (Navaratnam et al., 1996). We note that while cAMP-dependent signaling is not a canonical down-stream pathway for EGFR signaling, it synergizes with NRG1 activation of EGFR family members during Schwann cell proliferation (Kim et al., 1997; Monje et al., 2008).

Signaling events in proliferation have been better characterized in the vestibular system. For example, perinatal mouse utricular supporting cells proliferate in response to EGFR family ligands in organ culture (Montcouquiol and Corwin, 2001b; Yamashita and Oesterle, 1995), and PI3K, PKC, PKA and MAP2K1 are all implicated in proliferation for both mouse and bird utricle organ cultures (Montcouquiol and Corwin, 2001a; Montcouquiol and Corwin, 2001b; Witte et al., 2001). In contrast, our data with dissociated mouse cochlear p75+ supporting cells shows that only PI3K inhibitors were able to block proliferation. One explanation for the difference might be that cellular dissociation overrides the requirement for PKC and MEK. It is also possible that by isolating supporting cells from their environment, an unknown inhibitory signal has been eliminated. In any case, our studies suggest common signaling mechanisms through EGFR and the PI3K pathways are shared between birds, in which supporting cell proliferation happens naturally, and mice, in which supporting cell proliferation can be triggered by dissociation and culture.

P27Kip1 is needed to maintain the post-mitotic state of mammalian supporting cells. In the absence of p27Kip1 in vivo, supporting cells stochastically re-enter the cell cycle at postnatal times (Chen and Segil, 1999; Lowenheim et al., 1999). We previously found that the continued expression of p27Kip1 inversely correlated with cell cycle re-entry by purified supporting cells; and this observation suggested that older supporting cells are unable to re-enter the cell cycle because of continued p27Kip1 expression (White et al., 2006). Notably, supporting cells lacking p27Kip1 do not uniformly undergo uncontrolled cell division in vivo, indicating that additional cell cycle restraints are likely to be in place.

Here we show that EGFR signaling is necessary for p27Kip1 down-regulation in nearly half of p75+ mammalian cochlear supporting cells and their subsequent cell cycle entry after purification (Fig. 5). A similar proportion of cells proceeded into S-phase when EGFR signaling was blocked, if the cells were derived from the p27Kip1 knockout mouse (Fig. 6). Thus, regulating p27Kip1 levels by manipulating EGFR signaling may be an important part of future hair cell regeneration strategies. Interestingly, although the PI3K inhibitor LY294002 blocks p27Kip1 down-regulation and cell cycle re-entry to the same relative degree as blocking EGFR signaling (cf. Fig. 2 and Fig. 4), it does not block cell cycle re-entry in a p27Kip1-dependent manner (Fig. 6). This suggests that additional signaling pathways restraining cell cycle re-entry in supporting cells may be operating through a PI3-kinase-dependent, but p27Kip1-independent, mechanism.

These observations indicate that EGFR-dependent regulation of p27Kip1 likely plays an important role in the stability of the post-mitotic state of a substantial subpopulation of the perinatal supporting cells. It suggests that if the pathways that promote hair cell regeneration in birds could be activated in mammals, p27Kip1 might be down-regulated as a consequence (Fig. 5).

Conclusion

Hair cell loss as a result of environmental factors, combined with underlying genetic susceptibility, is the major cause of hearing loss in humans. The discovery that birds are able to recover from hair cell loss via mitotic regeneration fueled hopes that a similar process could be stimulated in humans; however, little progress has been made in understanding the molecular basis for the failure of hair cell regeneration in experimental mammalian models. Our demonstration that a crucial pathway in avian hair cell regeneration, the EGFR pathway, is conserved in perinatal mammalian supporting cells provides an important target for future studies that seek to influence the latent endogenous proliferative capacity of this resident progenitor population.

Supplementary Material

01
02

Highlights.

We study proliferation in auditory regeneration, comparing mice and chickens.

Mouse cochlear supporting cells require EGFR for mitosis in stem cell culture.

Chicken auditory supporting cell mitosis in regeneration also requires EGFR.

Proliferation in both systems also requires phospho-inositol kinase 3 signaling.

EGF receptor signaling in the mouse acts through down-regulation of the cyclin-dependent kinase inhibitor p27Kip1.

Acknowledgements

W. Makmura and J.F. Llamas for expert animal care, F. Della-Ripa for PCR, S. Chavira of the University of Southern California Flow Facility for FACS assistance, Robin Gibson for chicken QPCR, and Jialin Shang for technical assistance with chicken cochlear duct cultures. This work was supported by the following grants: NIH R03 DC5-7015 (PMW), NIH R01 DC03969 (JSS), NIH R01 DC04661 (JSS), DC006185 (AKG and NS), and DC004189 (NS).

Footnotes

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

The authors have no conflict of interest.

References

  1. Alvarado DM, Hawkins RD, Bashiardes S, Veile RA, Ku YC, Powder KE, Spriggs MK, Speck JD, Warchol ME, Lovett M. An RNA interference-based screen of transcription factor genes identifies pathways necessary for sensory regeneration in the avian inner ear. J Neurosci. 2011;31:4535–43. doi: 10.1523/JNEUROSCI.5456-10.2011. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Bermingham-McDonogh O, Oesterle EC, Stone JS, Hume CR, Huynh HM, Hayashi T. Expression of Prox1 during mouse cochlear development. J Comp Neurol. 2006;496:172–86. doi: 10.1002/cne.20944. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Brignull HR, Raible DW, Stone JS. Feathers and fins: non-mammalian models for hair cell regeneration. Brain Res. 2009;1277:12–23. doi: 10.1016/j.brainres.2009.02.028. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Burns J, Christophel JJ, Collado MS, Magnus C, Carfrae M, Corwin JT. Reinforcement of cell junctions correlates with the absence of hair cell regeneration in mammals and its occurrence in birds. J Comp Neurol. 2008;511:396–414. doi: 10.1002/cne.21849. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Busse D, Doughty RS, Ramsey TT, Russell WE, Price JO, Flanagan WM, Shawver LK, Arteaga CL. Reversible G(1) arrest induced by inhibition of the epidermal growth factor receptor tyrosine kinase requires up-regulation of p27(KIP1) independent of MAPK activity. J Biol Chem. 2000;275:6987–95. doi: 10.1074/jbc.275.10.6987. [DOI] [PubMed] [Google Scholar]
  6. Casciola-Rosen L, Rosen A, Petri M, Schlissel M. Surface blebs on apoptotic cells are sites of enhanced procoagulant activity: Implications for coagulation events and antigenic spread in systemic lupus erythematosus. P.N.A.S. 1996;93:1624–1629. doi: 10.1073/pnas.93.4.1624. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Chardin S, Romand R. Regeneration and mammalian auditory hair cells. Science. 1995;267:707–709. doi: 10.1126/science.7839151. [DOI] [PubMed] [Google Scholar]
  8. Chen P, Segil N. p27(Kip1) links cell proliferation to morphogenesis in the developing organ of Corti. Development. 1999;126:1581–90. doi: 10.1242/dev.126.8.1581. [DOI] [PubMed] [Google Scholar]
  9. Clausen OP, Kirkhus B, Schjolberg AR. Cell cycle progression kinetics of regenerating mouse epidermal cells: an in vivo study combining DNA flow cytometry, cell sorting, and [3H]dThd autoradiography. J Invest Dermatol. 1986;86:402–5. doi: 10.1111/1523-1747.ep12285672. [DOI] [PubMed] [Google Scholar]
  10. Corwin JT, Cotanche DA. Regeneration of sensory hair cells after acoustic trauma. Science. 1988;240:1772–4. doi: 10.1126/science.3381100. [DOI] [PubMed] [Google Scholar]
  11. Daudet N, Ripoll C, Lenoir M. Transforming growth factor-alpha-induced cellular changes in organotypic cultures of juvenile, amikacin-treated rat organ of corti. J Comp Neurol. 2002;442:6–22. doi: 10.1002/cne.1418. [DOI] [PubMed] [Google Scholar]
  12. Daudet N, Vago P, Ripoll C, Humbert G, Pujol R, Lenoir M. Characterization of atypical cells in the juvenile rat organ of corti after aminoglycoside ototoxicity. J Comp Neurol. 1998;401:145–62. [PubMed] [Google Scholar]
  13. Diensthuber M, Oshima K, Heller S. Stem/progenitor cells derived from the cochlear sensory epithelium give rise to spheres with distinct morphologies and features. J Assoc Res Otolaryngol. 2009;10:173–90. doi: 10.1007/s10162-009-0161-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Doetzlhofer A, White PM, Johnson JE, Segil N, Groves AK. In vitro growth and differentiation of mammalian sensory hair cell progenitors: a requirement for EGF and periotic mesenchyme. Dev Biol. 2004;272:432–47. doi: 10.1016/j.ydbio.2004.05.013. [DOI] [PubMed] [Google Scholar]
  15. Fero ML, Rivkin M, Tasch M, Porter P, Carow CE, Firpo E, Polyak K, Tsai LH, Broudy V, Perlmutter RM, Kaushansky K, Roberts JM. A syndrome of multiorgan hyperplasia with features of gigantism, tumorigenesis, and female sterility in p27(Kip1)-deficient mice. Cell. 1996;85:733–44. doi: 10.1016/s0092-8674(00)81239-8. [DOI] [PubMed] [Google Scholar]
  16. Gestwa G, Wiechers B, Zimmermann U, Praetorius M, Rohbock K, Kopschall I, Zenner HP, Knipper M. Differential expression of trkB.T1 and trkB.T2, truncated trkC, and p75(NGFR) in the cochlea prior to hearing function. J Comp Neurol. 1999;414:33–49. doi: 10.1002/(sici)1096-9861(19991108)414:1<33::aid-cne3>3.0.co;2-m. [DOI] [PubMed] [Google Scholar]
  17. Gu R, Montcouquiol M, Marchionni M, Corwin JT. Proliferative responses to growth factors decline rapidly during postnatal maturation of mammalian hair cell epithelia. Eur J Neurosci. 2007;25:1363–72. doi: 10.1111/j.1460-9568.2007.05414.x. [DOI] [PubMed] [Google Scholar]
  18. Hume CR, Kirkegaard M, Oesterle EC. ErbB expression: the mouse inner ear and maturation of the mitogenic response to heregulin. J Assoc Res Otolaryngol. 2003;4:422–43. doi: 10.1007/s10162-002-3008-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Jones JT, Ballinger MD, Pisacane PI, Lofgren JA, Fitzpatrick VD, Fairbrother WJ, Wells JA, Sliwkowski MX. Binding interaction of the heregulinbeta egf domain with ErbB3 and ErbB4 receptors assessed by alanine scanning mutagenesis. J Biol Chem. 1998;273:11667–74. doi: 10.1074/jbc.273.19.11667. [DOI] [PubMed] [Google Scholar]
  20. Kim HA, DeClue JE, Ratner N. cAMP-dependent protein kinase A is required for Schwann cell growth: interactions between the cAMP and neuregulin/tyrosine kinase pathways. J Neurosci Res. 1997;49:236–47. [PubMed] [Google Scholar]
  21. Kubota K, Goto S, Eto K, Hayashi S. EGF receptor attenuates Dpp signaling and helps to distinguish the wing and leg cell fates in Drosophila. Development. 2000;127:3769–76. doi: 10.1242/dev.127.17.3769. [DOI] [PubMed] [Google Scholar]
  22. Kuntz AL, Oesterle EC. Transforming growth factor alpha with insulin stimulates cell proliferation in vivo in adult rat vestibular sensory epithelium. J Comp Neurol. 1998;399:413–23. [PubMed] [Google Scholar]
  23. Li H, Corrales CE, Wang Z, Zhao Y, Wang Y, Liu H, Heller S. BMP4 signaling is involved in the generation of inner ear sensory epithelia. BMC Dev Biol. 2005;5:16. doi: 10.1186/1471-213X-5-16. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 2001;25:402–8. doi: 10.1006/meth.2001.1262. [DOI] [PubMed] [Google Scholar]
  25. Lou X, Zhang Y, Yuan C. Multipotent stem cells from the young rat inner ear. Neurosci Lett. 2007;416:28–33. doi: 10.1016/j.neulet.2006.12.061. [DOI] [PubMed] [Google Scholar]
  26. Lowenheim H, Furness DN, Kil J, Zinn C, Gultig K, Fero ML, Frost D, Gummer AW, Roberts JM, Rubel EW, Hackney CM, Zenner HP. Gene disruption of p27(Kip1) allows cell proliferation in the postnatal and adult organ of corti. Proc Natl Acad Sci U S A. 1999;96:4084–8. doi: 10.1073/pnas.96.7.4084. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Lumpkin EA, Collisson T, Parab P, Omer-Abdalla A, Haeberle H, Chen P, Doetzlhofer A, White P, Groves A, Segil N, Johnson JE. Math1-driven GFP expression in the developing nervous system of transgenic mice. Gene Expr Patterns. 2003;3:389–95. doi: 10.1016/s1567-133x(03)00089-9. [DOI] [PubMed] [Google Scholar]
  28. McCullar JS, Ty S, Campbell S, Oesterle EC. Activin potentiates proliferation in mature avian auditory sensory epithelium. J Neurosci. 2010;30:478–90. doi: 10.1523/JNEUROSCI.5154-09.2010. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Michalopoulos G, Cianciulli HD, Novotny AR, Kligerman AD, Strom SC, Jirtle RL. Liver regeneration studies with rat hepatocytes in primary culture. Cancer Res. 1982;42:4673–82. [PubMed] [Google Scholar]
  30. Monje PV, Athauda G, Wood PM. Protein kinase A-mediated gating of neuregulin-dependent ErbB2-ErbB3 activation underlies the synergistic action of cAMP on Schwann cell proliferation. J Biol Chem. 2008;283:34087–100. doi: 10.1074/jbc.M802318200. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Montcouquiol M, Corwin JT. Brief treatments with forskolin enhance s-phase entry in balance epithelia from the ears of rats. J Neurosci. 2001a;21:974–82. doi: 10.1523/JNEUROSCI.21-03-00974.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Montcouquiol M, Corwin JT. Intracellular signals that control cell proliferation in mammalian balance epithelia: key roles for phosphatidylinositol-3 kinase, mammalian target of rapamycin, and S6 kinases in preference to calcium, protein kinase C, and mitogen-activated protein kinase. J Neurosci. 2001b;21:570–80. doi: 10.1523/JNEUROSCI.21-02-00570.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Navaratnam DS, Su HS, Scott SP, Oberholtzer JC. Proliferation in the auditory receptor epithelium mediated by a cyclic AMP-dependent signaling pathway. Nat Med. 1996;2:1136–9. doi: 10.1038/nm1096-1136. [DOI] [PubMed] [Google Scholar]
  34. Oesterle EC, Tsue TT, Reh TA, Rubel EW. Hair-cell regeneration in organ cultures of the postnatal chicken inner ear. Hear Res. 1993;70:85–108. doi: 10.1016/0378-5955(93)90054-5. [DOI] [PubMed] [Google Scholar]
  35. Oiticica J, Barboza-Junior LC, Batissoco AC, Lezirovitz K, Mingroni-Netto RC, Haddad LA, Bento RF. Retention of progenitor cell phenotype in otospheres from guinea pig and mouse cochlea. J Transl Med. 2010;8:119. doi: 10.1186/1479-5876-8-119. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Osherov N, Levitzki A. Epidermal-growth-factor-dependent activation of the src-family kinases. Eur J Biochem. 1994;225:1047–53. doi: 10.1111/j.1432-1033.1994.1047b.x. [DOI] [PubMed] [Google Scholar]
  37. Richardson GP, Forge A, Kros CJ, Fleming J, Brown SD, Steel KP. Myosin VIIA is required for aminoglycoside accumulation in cochlear hair cells. J Neurosci. 1997;17:9506–19. doi: 10.1523/JNEUROSCI.17-24-09506.1997. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Romand R, Chardin S. Effects of growth factors on the hair cells after ototoxic treatment of the neonatal mammalian cochlea in vitro. Brain Res. 1999;825:46–58. doi: 10.1016/s0006-8993(99)01211-1. [DOI] [PubMed] [Google Scholar]
  39. Ruben RJ. Development of the inner ear of the mouse: a radioautographic study of terminal mitoses. Acta Otolaryngol. Suppl. 1967;220:1–44. [PubMed] [Google Scholar]
  40. Ryals BM, Rubel EW. Hair cell regeneration after acoustic trauma in adult Coturnix quail. Science. 1988;240:1774–6. doi: 10.1126/science.3381101. [DOI] [PubMed] [Google Scholar]
  41. Savary E, Hugnot JP, Chassigneux Y, Travo C, Duperray C, Van De Water T, Zine A. Distinct population of hair cell progenitors can be isolated from the postnatal mouse cochlea using side population analysis. Stem Cells. 2007;25:332–9. doi: 10.1634/stemcells.2006-0303. [DOI] [PubMed] [Google Scholar]
  42. Schlessinger J. Connections Map in the Database of Cell Signaling. Vol. 2010 2005. Epidermal Growth Factor Receptor Pathway. [Google Scholar]
  43. Shang J, Cafaro J, Nehmer R, Stone J. Supporting cell division is not required for regeneration of auditory hair cells after ototoxic injury in vitro. J Assoc Res Otolaryngol. 2010;11:203–22. doi: 10.1007/s10162-009-0206-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Shin SY, Yokoyama T, Takenouchi T, Munekata E. The chemical synthesis and binding affinity to the EGF receptor of the EGF-like domain of heparin-binding EGF-like growth factor (HB-EGF) J. Pept. Sci. 2003;9:244–50. doi: 10.1002/psc.450. [DOI] [PubMed] [Google Scholar]
  45. Stankovic J, Rio C, Xia A, Sugawara M, Adams JC, Liberman MC, Corfas G. Survival of adult spiral ganglion neurons requires erbB receptor signaling in the inner ear. J Neurosci. 2004;24:8651–61. doi: 10.1523/JNEUROSCI.0733-04.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Stephens SD. A case of gentamicin accentuated hearing loss. J Laryngol Otol. 1968;82:803–8. doi: 10.1017/s0022215100069486. [DOI] [PubMed] [Google Scholar]
  47. Stone JS, Shang JL, Tomarev S. cProx1 immunoreactivity distinguishes progenitor cells and predicts hair cell fate during avian hair cell regeneration. Dev Dyn. 2004;230:597–614. doi: 10.1002/dvdy.20087. [DOI] [PubMed] [Google Scholar]
  48. Tucci DL, Rubel EW. Physiologic status of regenerated hair cells in the avian inner ear following aminoglycoside ototoxicity. Otolaryngol Head Neck Surg. 1990;103:443–50. doi: 10.1177/019459989010300317. [DOI] [PubMed] [Google Scholar]
  49. White PM, Doetzlhofer A, Lee YS, Groves AK, Segil N. Mammalian cochlear supporting cells can divide and trans-differentiate into hair cells. Nature. 2006;441:984–7. doi: 10.1038/nature04849. [DOI] [PubMed] [Google Scholar]
  50. Witte MC, Montcouquiol M, Corwin JT. Regeneration in avian hair cell epithelia: identification of intracellular signals required for S-phase entry. Eur J Neurosci. 2001;14:829–38. doi: 10.1046/j.0953-816x.2001.01695.x. [DOI] [PubMed] [Google Scholar]
  51. Xu Y, Baker D, Quan T, Baldassare JJ, Voorhees JJ, Fisher GJ. Receptor type protein tyrosine phosphatase-kappa mediates cross-talk between transforming growth factor-beta and epidermal growth factor receptor signaling pathways in human keratinocytes. Mol Biol Cell. 2010;21:29–35. doi: 10.1091/mbc.E09-08-0710. [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. Yamashita H, Oesterle EC. Induction of cell proliferation in mammalian inner-ear sensory epithelia by transforming growth factor alpha and epidermal growth factor. Proc Natl Acad Sci U S A. 1995;92:3152–5. doi: 10.1073/pnas.92.8.3152. [DOI] [PMC free article] [PubMed] [Google Scholar]
  53. Yu Y, Weber T, Yamashita T, Liu Z, Valentine MB, Cox BC, Zuo J. In vivo proliferation of postmitotic cochlear supporting cells by acute ablation of the retinoblastoma protein in neonatal mice. J Neurosci. 2010;30:5927–36. doi: 10.1523/JNEUROSCI.5989-09.2010. [DOI] [PMC free article] [PubMed] [Google Scholar]
  54. Zhai S, Shi L, Wang BE, Zheng G, Song W, Hu Y, Gao WQ. Isolation and culture of hair cell progenitors from postnatal rat cochleae. J Neurobiol. 2005;65:282–93. doi: 10.1002/neu.20190. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

01
NIHMS347571-supplement-01.tif (5.4MB, tif)
02
NIHMS347571-supplement-02.tif (3.2MB, tif)

RESOURCES