Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2013 Mar 1.
Published in final edited form as: Arthritis Rheum. 2012 Mar;64(3):788–798. doi: 10.1002/art.33395

IRF5 activation in monocytes of SLE patients is triggered by circulating autoantigens independent of type I IFN

Rivka C Stone 1,2, Di Feng 1,2, Jing Deng 3, Sukhwinder Singh 3, Lisong Yang 1,2, Patricia Fitzgerald-Bocarsly 3, Maija-Leena Eloranta 4, Lars Rönnblom 4, Betsy J Barnes 1,2
PMCID: PMC3288585  NIHMSID: NIHMS328792  PMID: 21968701

Abstract

Objective

Genetic variants of interferon regulatory factor 5 (IRF5) are associated with susceptibility to systemic lupus erythematosus (SLE). IRF5 regulates the expression of proinflammatory cytokines and type I interferons (IFN) believed to be involved in SLE pathogenesis. The aim of this study was to determine the activation status of IRF5 by assessing its nuclear localization in immune cells of SLE patients and healthy donors, and to identify SLE triggers of IRF5 activation.

Methods

IRF5 nuclear localization in subpopulations of peripheral blood mononuclear cells (PBMC) from 14 genotyped SLE patients and 11 healthy controls was assessed using imaging flow cytometry. IRF5 activation and function were examined after ex vivo stimulation of healthy donor monocytes with SLE serum or components of SLE serum. Cellular localization was determined by ImageStream and cytokine expression by Q-PCR and ELISA.

Results

IRF5 was activated in a cell type-specific manner; monocytes of SLE patients had constitutively elevated levels of nuclear IRF5 compared to NK and T cells. SLE serum was identified as a trigger for IRF5 nuclear accumulation; however, neither IFNα nor SLE immune complexes could induce nuclear localization. Instead, autoantigens comprised of apoptotic/necrotic material triggered IRF5 nuclear accumulation in monocytes. Production of cytokines IFNα, TNFα and IL6 in monocytes stimulated with SLE serum or autoantigens was distinct yet correlated with the kinetics of IRF5 nuclear localization.

Conclusion

This study provides the first formal proof that IRF5 activation is altered in monocytes of SLE patients that is in part contributed by the SLE blood environment.

Systemic lupus erythematosus (SLE) is a complex systemic autoimmune disorder characterized by multiple immunologic abnormalities that lead to a break in self-tolerance and the production of autoantibodies targeting nucleic acids and associated proteins. Patients display elevated type I IFN in their serum and IFNα-induced gene transcripts in their blood cells that correlates with disease activity and severity (reviewed in (1)). While the underlying etiology of SLE remains obscure, significant evidence documents the importance of genetic risk factors and environmental stressors. Genetic variants of IFN regulatory factor 5 (IRF5) have been strongly associated with the risk of SLE in large-scale genetic association studies of patients with different ancestral backgrounds (2–5). IRF5 is a transcription factor that controls inflammatory and immune responses. It regulates the expression of type I IFNs, IFN stimulated genes (ISGs), and inflammatory cytokines/chemokines in response to pathogenic stimuli (6–9); it is also a critical mediator of cellular apoptosis (10, 11).

In recent work, we have shown that IRF5 expression and alternative splicing were significantly upregulated in primary blood cells of SLE patients (12). In particular, elevated IRF5 protein expression in monocytes of SLE patients was associated with the IRF5 SLE homozygous risk haplotype (4xCGGGG indel, T-allele of SNP rs2004640, A-allele of SNP rs10954213, and C-allele of SNP rs10488631) (12). Basal/constitutive IRF5 expression in immune cells of healthy donors differs significantly between immune cell subpopulations but is generally cytoplasmic and highest in monocytes and plasmacytoid dendritic cells (PDC) as compared to T, B and NK cells (13).

Each of these immune cell subpopulations display aberrant activation and function in SLE that is likely to contribute to disease pathogenesis (14). Monocytes/macrophages (Mo/Mϕ) have been increasingly recognized to play a dynamic role in the initiation and perpetuation of SLE given their hallmark functions in phagocytosis and antigen presentation (15, 16). Mo are a key component of the innate immune system involved in the regulation of the adaptive immune response (17). The Mo/Mϕ system, including conventional DC, has versatile cellular functions aimed to defend, regulate inflammation, and induce immunity; consequently, it maintains a central role in initiating the immune response. Deficiencies in any of these cellular functions would be expected to contribute to systemic autoimmunity. Indeed, recent studies in lupus patients have identified numerous Mo/Mϕ defects involving aberrant activation as measured by surface protein expression, deregulation of cytokine production, and defective phagocytic capacity (16, 18, 19). The mechanisms underlying these abnormalities remain unclear.

Given the association of elevated IRF5 expression in Mo of SLE patients with the IRF5 risk haplotype (12), we sought to examine the “activation” status of IRF5 in SLE Mo as compared to other immune cell subpopulations. IRF5 is constitutively localized to the cytoplasm in unstimulated cells (7) and generally requires a stimulus that leads to activation/nuclear localization in order for it to function as a transcription factor. We and others have demonstrated that IRF5 becomes post-translationally modified in response to a variety of stimuli leading to its translocation from the cytoplasm to the nucleus (6, 7, 9, 20–22). In this study, we assess the in vivo “activation” status of IRF5 in immune cells of genotyped SLE patients and healthy donors using Amnis ImageStream technology to detect IRF5 cellular localization and determine the impact of circulating serum factors on this dynamic process.

MATERIALS AND METHODS

Patients and samples

Serum and peripheral blood mononuclear cell (PBMC) samples from 14 Swedish patients with SLE were obtained from the rheumatology clinic at Uppsala University Hospital (UUH) in Sweden; PBMC and serum from 11 healthy controls were obtained from Uppsala University Hospital or New Jersey Medical School (NJMS) in Newark, NJ. Each of the patients fulfilled at least four of the classification criteria for SLE as defined by the American College of Rheumatology (ACR) with a median ACR index of 6 (range 5–8). Clinical disease activity at the time of blood sampling was assessed with the modified SLE disease activity index (mSLEDAI-2K) where complement and anti-DNA antibodies were omitted. The median mSLEDAI-2K value was 1 (range 0–26) showing that most patients had low or no clinical disease activity at the time of blood collection. All study subjects provided informed consent to participate in the study, and the study was approved by institutional and regional ethical boards at both institutions.

Genotyping

Subjects were genotyped at the rs2004640, rs10954213, and rs10488631 SNPs in 250ng of DNA extracted from blood samples of study subjects using the Illumina Golden Gate assay (Illumina, San Diego, CA, USA), as described (5, 12). The 5 bp CGGGG indel of IRF5 was genotyped by PCR amplification followed by size separation using 4% agarose gels, or using an ABI 3770 capillary sequencer (Applied Biosystems, Foster City, CA, USA).

PBMC processing and Amnis ImageStream

PBMCs were obtained from SLE patients and healthy donors from UUH and processed immediately following phlebotomy (12). Cells were surface-stained with PE-conjugated anti-CD14 Abs (Mo), anti-CD56 (NK cell), or anti-CD3 (T cell) and fixed in 1% formaldehyde (Fisher Scientific, Pittsburgh, PA, USA) at UUH. Fixed cells were then shipped via Fedex to NJMS. Upon receipt of cells, they were permeabilized with 0.1% Triton X-100 (Fisher Scientific) and intracellularly stained with polyclonal anti-IRF5 antibody (32.5 ng/uL; Cell Signaling, Danvers, MA) followed by FITC-conjugated anti-rabbit secondary antibody (10 ng/uL; BD Pharmigen, San Jose, CA); nuclei were stained with DRAQ5 (10 μM) immediately before acquisition. Samples were acquired using the ImageStream 100 flow cytometer and analyzed with IDEAS software (Amnis Corporation, Seattle, WA, USA) as previously described (23–27). In brief, single focused cells were identified by gating on DRAQ5-positive events with high DRAQ5 aspect ratios (minor axis divided by major axis, measure of single event) and high nuclear contrast (measured by the Gradient RMS feature). Nuclear localization of IRF5 was measured using a morphology mask to determine a similarity score, which quantifies the correlation of pixel values of the DRAQ5 and IRF5 images on a per cell basis. A similarity score >1 was used as a cut-off for nuclear-localized IRF5; cells in individual bins were visually inspected to confirm subcellular localization (values < or >1).

IFNα immunoassay

Serum IFNα levels were measured by a dissociation-enhanced lanthanide fluoroimmunoassay (DELFIA); on the solid phase were anti-IFNα mAbs LT27:273 and LT27:293, and for detection europium-labeled LT27:297 anti-IFNα mAb (28). The detection level of the assay was ≥1 U IFNα/ml and the standard was calibrated against the NIH reference leukocyte IFNα GA-23-902-530.

IFNα reporter cell assay

The reporter cell assay for IFNα is used to measure the ability of patient sera to cause IFN-induced gene expression (29). 2×105 reporter cells (HeLa, no. CCL-2; American Type Tissue Collection) were cultured with 25% sera for 6 h and total cellular mRNA isolated using Qiagen RNeasy Plus Mini kit. 1 ug mRNA was reverse-transcribed and quantitative real-time PCR performed using Power SYBR Green master mix (Applied Biosystems) and primers for IFIT-1 (IFIT-1 F: AGAACGGCTGCCTAATTTACAG; IFIT-1 R: GCTCCAGACTATCCTTGACCTG) and beta-actin (12). All reactions were performed in the 7300 Real-Time PCR System (Applied Biosystems) under the following conditions: 1 cycle of 45°C (3 min) and 95°C (10 min), followed by 40 cycles of 95°C for 15 sec and 60°C for 1 min. The delta delta Ct method was used to calculate fold IFIT-1 induction over untreated cells.

In vitro serum stimulation

Fresh Mo from healthy donors (n=4) at NJMS were isolated by positive selection with anti-CD14 microbeads (Miltenyi Biotec, Auburn, CA, USA). Fresh PBMCs or purified Mo were treated with 10% serum for the indicated timepoints. For neutralization experiments, rabbit polyclonal IFNα neutralizing antibody (100 ug/mL; PBL Interferon Source, Piscataway, NJ, USA) or isotype control rabbit IgG (R&D Systems, Minneapolis, MN, USA) was premixed with serum prior to stimulation. At each timepoint, cells were surface-stained with PE-conjugated anti-CD14 Ab and fixed in 1% formaldehyde. IRF5 intracellular staining and measurement of nuclear localization with Amnis ImageStream was performed as described above.

Fluorescent microscopy

Immortalized macrophages from C57BL/6 mice were plated on coverslips and transfected with 6 ug GFP-tagged IRF5 V3/V4 using Superfect reagent (Invitrogen, Carlsbad, CA, USA). 16 h post-transfection, cells were trypsinized, re-plated and treated with 2% healthy or SLE serum for an additional 2 h. Slides were DAPI-mounted and representative images captured on a Zeiss Axiovert 200 fluorescence microscope. Axiovision software was used to approximate transfection efficiency and % nuclear localization in GFP-positive cells.

Apoptotic/necrotic stimulations

Fresh PBMCs from healthy donors at UUH and NJMS were stimulated for 3.5 h with supernatants of UV light-treated (apoptotic) or freeze-thawed (necrotic) U937 cells alone or in combination with SLE IgG as described (30). Cells were surface-stained with PE-conjugated anti-CD14 Ab and measurement of IRF5 nuclear localization with Amnis ImageStream was performed as detailed above. Cells from UUH were shipped frozen after surface-staining and fixation with 1% formaldehyde.

ELISA and real-time quantitative PCR (Q-PCR)

Purified Mo from healthy donors (n=4) at NJMS were isolated by positive selection with anti-CD14 microbeads (Miltenyi Biotec, Auburn, CA, USA) and stimulated with serum or apoptotic/necrotic material as described above. Supernatants and cells were harvested at the timepoints indicated. Supernatants were assayed by ELISA to detect secreted IFNα (Bristol-Myers Squibb, Cat. BMS216MST), TNFα (BD, Cat. 555212) and IL6 (BioLegend; Cat. 430501) following manufacturer’s instructions. Q-PCR was performed as previously described (12). Briefly, total RNA was extracted from cells using RNeasy Plus Mini Kit (Qiagen), cDNA was prepared using qScript cDNA supermix kit (Quanta Biosciences), and Q-PCR was performed using iTaq SYBR Green Supermix (Bio-rad). Primer sequences used were as follows: IFNA F: 5′-CCTGGCTGTGAGGAAATACTT-3 and R: 5′-AGGATCTCATGATTTCTGCTCTG-3′; TNFA F: 5′-AGGCGGTGCTTGTTCCTCA-3′ and R: 5′-GTTCGAGAAGATGATCTGACTGCC-3′; IL6 F: 5′-TCTCCACAAGCGCCTTCG-3′ and R: 5′-CTCAGGGCTGAGATGCCG-3′; b-actin F: 5′-ATGCTCTCCCTCACGCCATC-3′ and R: 5′-CACGCACGATTTCCCTCTCA-3′. All reactions were performed in the 7300 Real-Time PCR System (Applied Biosystems) under the following conditions: 1 cycle of 45°C (3 min) and 95°C (10 min), followed by 40 cycles of 95°C for 15 sec and 60°C for 1 min. The delta delta Ct method was used to calculate fold induction.

Statistical analysis

For normally distributed variables, differences between groups were analyzed by the Students t test. For variables not normally distributed, the Mann-Whitney U test was used. Normality was assessed by the Shapiro-Wilk test on sample sizes greater than 4. Data are presented as mean ± SD (normal distribution) or median ± interquartile range (non-normal distribution). The repeated measures ANOVA with Bonferroni’s multiple comparison post-test was used to compare % IRF5 translocation induced by healthy donor serum vs. SLE serum over time. p<0.05 was considered significant. Statistical analyses were performed using Prism 4.0 (GraphPad Software, San Diego, CA) or JMP 8.0.1 (SAS, Cary, NC).

RESULTS

IRF5 is activated in Mo of SLE patients

All patients were genotyped at IRF5 (rs2004640, rs10954213, rs10488631 and the CGGGG indel) and haplotypes are shown in Supplementary Fig. 1. The cellular localization of endogenous IRF5 was examined in PBMC of genotyped patient samples as well as age- and sex-matched healthy donor controls from UUH. PBMC were stained with extracellular surface markers and intracellular IRF5 and DRAQ5. Specific cell populations (Mo, T and NK cells) were gated on and IDEAS software used to calculate the percentage of nuclear translocated IRF5 using a similarity/morphology score >1 which corresponded to high correlations between DRAQ5 and IRF5 pixel values per cell (23–27). Positive IRF5 intracellular staining was verified using isotype control antibodies (Fig. 1B) and specificity for IRF5 and its isoforms was determined by Western blot (Supplementary Fig. 2 and data not shown). Representative images of the gating strategy, histograms of similarity/morphology scores between a healthy donor and an SLE patient, and cell images from individual bins of an SLE patient with similarity scores < or >1 are shown in Fig. 1A.

Figure 1. IRF5 is activated in Mo of SLE patients.

Figure 1

Open in a new tab

(A) Strategy of gating on CD14+/IRF5+ Mo in purified PBMC from healthy donors or SLE patients. Representative histograms show the correlation between pixel intensities of IRF5 and DRAQ5 of single Mo from a healthy donor and SLE patient. Images of Mo are from selected bins (green lines 1 and 2 on histogram plot of SLE patient) showing different similarity scores; <1 shows cytoplasmic IRF5 (panel 1), > 1 shows nuclear IRF5 (panel 2). (B) Histogram of relative IRF5 expression in immune cell subpopulations determined by staining intensities of IRF5 and isotype control antibodies. (C) Graphic summary of IRF5 nuclear translocation in different immune cell subpopulations from healthy donors (n=9) and SLE patients (n=14). Plotted values are the mean±SD; p value determined by Student’s t test. (D) Expression of IRF5 in monocytes of healthy donors and SLE patients. The geometric mean fluorescence intensity (MFI) was determined using Amnis IDEAS software. Plotted values are the mean±SD.

Analysis of the percent nuclear-localized IRF5 in CD14+/IRF5+ monocytes from all SLE patients examined gave a mean value of 26% as compared to ~4% in healthy donors (Fig. 1C, inset). This difference was highly significant (p<0.0001); the percent nuclear-localized IRF5 in SLE patients ranged from 19–36% whereas in healthy donors 2–6% of CD14+/IRF5+ cells showed nuclear-localized IRF5. Only a small increase in IRF5 nuclear localization was observed in NK and T cells from SLE patients (Fig. 1C). While Mo express much higher levels of IRF5 than T and NK cells (Fig. 1B), it is unlikely that the observed increase in IRF5 nuclear localization in Mo of SLE patients compared to healthy donors was due to differences in IRF5 expression since levels of expression were similar between healthy donors and SLE patients yet cellular localization was distinct (Fig. 1D). Stratification of patients by haplotype (Supplementary Fig. 1) provided little correlation with IRF5 nuclear localization in Mo of SLE patients; patients were stratified by individual genetic variants, combinations of each, and by homozygous risk vs. homozygous protective haplotypes (data not shown). Lack of a correlation may be due to the small number of patients sampled in this study; nonetheless, IRF5 nuclear localization data from patients homozygous risk (n=4) versus homozygous protective (n=3) versus heterozygous at the risk alleles (n=7) was not statistically different (data not shown), suggesting that IRF5 activation in SLE may be genotype-independent. Further studies will be required to definitively rule-out or support a role for genotype in IRF5 activation.

SLE serum induces IRF5 nuclear translocation

Both intrinsic and extrinsic factors contribute to the phenotype and function of lupus Mo (reviewed in (31)). Intrinsic defects in surface marker expression (32) and phagocytosis (33) have been shown in lupus Mo, and SLE serum itself contributes to dysregulated surface marker expression, phagocytosis and cytokine production (reviewed in (31)). To determine whether the SLE blood environment contributes to IRF5 activation, we examined endogenous IRF5 cellular localization ex vivo in purified Mo from healthy donors that were stimulated with serum from healthy donors or SLE patients. IRF5 translocation was monitored over time by ImageStream analysis. At all timepoints examined, SLE serum induced greater IRF5 nuclear translocation than healthy donor serum (p<0.0001) (Fig. 2A). Similar results were obtained after stimulation of PBMC from healthy donors with SLE or healthy donor serum and measuring IRF5 cellular localization in CD14-positive Mo (data not shown).

Figure 2. SLE serum induces IRF5 nuclear translocation and secretion of IRF5-regulated proinflammatory cytokines IL6, TNFα and IFNα.

Figure 2

Open in a new tab

(A) Purified Mo from healthy donors (n=5) were stimulated with 10% healthy donor serum (n=3) or SLE patient serum (n=6) for the indicated time periods. Experiments were performed in duplicate on independent cell donors and sera. Plotted values are the mean±SD; p values were determined by the repeated measures ANOVA with Bonferroni’s multiple comparison post-test to compare values at individual time-points between the two groups. ***p<0.0001. (B) Concentration of TNFα, IL6 (C) and IFNα (D) in supernatants of purified healthy donor Mo (n=4; individual donor responses marked by colored circles) treated with healthy donor serum or SLE serum over the indicated time periods. Basal cytokine levels in serum alone are shown (open circles). Individual concentrations are plotted with means (line); p values were determined by two-tailed t test. *p<0.05, **p<0.001, ***p<0.0001.

The “activation” capacity of SLE serum was further confirmed in a second in vitro system where murine Mϕ were transfected with a GFP-tagged IRF5 expression plasmid and treated with healthy donor or SLE serum. 2 h post-stimulation, GFP-IRF5 was detected in the nucleus of SLE and not healthy donor serum-stimulated cells, as visualized by the co-localization of GFP-IRF5 and DAPI nuclear stain (Supplemental Fig. 3).

The functional relevance of SLE serum-induced IRF5 nuclear translocation was determined by measuring expression of IRF5-regulated proinflammatory cytokines IL6, TNFα and IFNα (9). Purified healthy donor Mo were stimulated with healthy or SLE serum and supernatants and cells harvested for ELISA and Q-PCR, respectively. TNFα expression was significantly upregulated at 6 h post-stimulation with SLE serum (Fig. 2B), and IL6 expression showed a similar trend at this timepoint (Fig. 2C) All three cytokines were significantly upregulated by 24 h post-stimulation with SLE serum (Figs. 2B–D). A similar increase in IL6 and TNFα expression was observed at the transcript level (Supplementary Fig. 4A). In all cases, enhanced cytokine expression occurred after and correlated with IRF5 nuclear localization. Together, these data support the notion that SLE blood provides an “activating” environment for IRF5 in Mo leading to downstream cytokine induction.

IFNa upregulates IRF5 expression but does not induce nuclear localization

Dysregulation of the type I IFN pathway is believed to be key to SLE pathogenesis since many patients have high circulating levels of IFNα in their serum and IFNα administration to individuals without any autoimmune condition can trigger lupus-like disease (34–36). We have previously demonstrated that IRF5 transcripts derived from non-coding exon 1c, corresponding to IRF5 V3, were specifically upregulated in different immune cell subpopulations in response to IFNα treatment (13). Here, we extend upon these findings to show that total IRF5 protein expression is significantly upregulated in Mo from healthy donors, as compared to NK or T cells, in response to IFNα stimulation (Fig. 3A).

Figure 3. IFNα upregulates IRF5 expression but does not induce nuclear translocation.

Figure 3

Open in a new tab

(A) IRF5 cell type-specific response to IFNα. Intracellular IRF5 expression was analyzed by flow cytometry after gating on immune cell subpopulations in purified PBMC of healthy donors (n=3). Cells were stimulated with 1,000 U/ml rIFNα for 24 h. Plotted values are the mean±SD from three independent experiments; p value determined by paired t test. (B) NDV and not IFNα induces IRF5 nuclear localization. PBMC (n=3) or purified Mo (n=3) from healthy donors were mock stimulated, stimulated with 1,000 U/ml of IFNα or 240 PFU of NDV (upper right inset) for the indicated time periods. Plotted values are the median±interquartile range from independent experiments. (C) Same as in Fig. 2A except PBMC from healthy donors (n=5) were incubated with healthy donor serum (n=3;≤1 U/ml), SLE sera having high (n=4; 7–18 U/ml) and low (n=5; ≤1 U/ml) IFNα. Plotted values are the median±interquartile range from independent experiments; n.s. – not significant. (D) IFNα neutralizing antibodies have no effect on SLE sera-induced IRF5 nuclear translocation. PBMCs from healthy donors (n=3) were stimulated with high (n=3; 7–18 U/ml) and low (n=3; ≤1 U/ml) IFNα containing sera pretreated with IFNα neutralizing or rabbit isotype control antibodies for 2 h. Change in % IRF5 translocation induced by neutralizing versus isotype antibody-treated serum is plotted. Plotted values are the median±interquartile range from independent experiments. The ability of IFNα neutralizing antibodies to abrogate IFNα signaling was confirmed by reporter assay measuring IFIT1 expression (upper right inset).

We have also demonstrated the ability of different stimuli to upregulate IRF5 expression resulting in nuclear accumulation via a complex model of post-translational modification (20, 21). Given the high circulating levels of IFNα in SLE serum, we sought to determine whether IFNα could be the stimulus that was inducing constitutive IRF5 nuclear localization in SLE patients. Purified PBMC or Mo from healthy donors were treated with IFNα over a timecourse and IRF5 cellular localization was examined by ImageStream after gating on CD14+ Mo. At all concentrations of IFNα (100, 1,000 and 10,000 U/ml) used to stimulate cells over multiple timepoints (0, 30 min, 1, 2, 3, 4, 6 and 24 h), none yielded IRF5 nuclear localization (Fig. 3B and data not shown). As a positive control, cells were infected with Newcastle Disease Virus (NDV). NDV has been shown to induce phosphorylation and nuclear accumulation of IRF5 in immortalized human cell lines (6, 7). As expected, a greater percentage of NDV-infected Mo had nuclear IRF5 as compared to mock-infected controls at 6 and 16 h (Fig. 3B inset).

To confirm that type I IFNs in SLE sera are not the “activating” stimulus for IRF5, PBMC from healthy donors were treated with healthy donor serum or SLE serum containing high (7–18 U/ml) and low (≤1 U/ml) levels of IFNα. Serum IFNα levels were determined by the IFNα immunoassay and IFNα activity by the reporter assay. Cellular localization of IRF5 in CD14+ Mo was determined by ImageStream. Data in Fig. 3C reveal no significant difference in the ability of high and low IFN-containing sera to induce IRF5 nuclear localization, while significant differences were observed between healthy donor and SLE serum (p<0.05), as expected (Fig. 2A). Additionally, we used IFNα neutralizing antibodies to support that IFNα in SLE serum is not the “activating” stimulus for IRF5 nuclear localization. For these studies, healthy donor PBMC were stimulated with high and low IFN-containing sera that was pretreated with IFNα neutralizing antibody or isotype control antibody. The change in percent IRF5 nuclear translocation induced by serum containing neutralizing vs. isotype control antibodies was calculated following determination of cellular localization. Results recapitulate findings in Fig. 3C showing no change in IRF5 cellular localization after pretreatment of serum with IFNα neutralizing antibodies (Fig. 3D). The IFNα reporter cell assay was used to confirm that the IFNα neutralizing antibodies were working to shut down IFNα signaling, as shown by the loss of IFN-induced IFIT1 gene expression (Fig. 3D inset). Taken together, these data clearly confirm that IFNα in SLE serum is not the “activating” stimulus for IRF5. Equally important is the finding that upregulation of IRF5 expression by a given stimulus, such as IFNα, is not sufficient to induce nuclear localization.

Apoptotic/necrotic material induces IRF5 nuclear localization

In addition to IFNα, other potential candidates such as autoantigens and autoantigen-containing immune complexes (IC) circulate in SLE serum and might induce nuclear localization of IRF5. One source of SLE autoantigens is apoptotic and necrotic cellular debris that is thought to result from increased apoptosis and reduced clearance in lupus (37, 38). To test whether these circulating factors could trigger IRF5 activation, healthy donor PBMC were stimulated with supernatants containing apoptotic or necrotic material alone or in combination with SLE IgG to form ICs in vitro (30), and IRF5 subcellular localization was measured. We observed significant accumulation of IRF5 in the nucleus of CD14+ Mo as early as 3.5 h post-treatment with apoptotic (p=0.0318) and necrotic (p=0.0055) material but not when either was combined with IC-generating SLE IgG; IgG alone had no significant effect (Fig 4A).

Figure 4. Apoptotic and necrotic material released by dying cells triggers IRF5 nuclear localization and secretion of IRF5-regulated cytokines TNFα and IFNα.

Figure 4

Open in a new tab

(A) PBMC from healthy donors were stimulated for 3.5 h with supernatants containing apoptotic or necrotic material alone or in combination with SLE IgG. % IRF5 nuclear translocation was determined in CD14+ monocytes by ImageStream. Plotted values are mean±SD from two independent healthy donors; p values determined by Student’s t-test. (B) Concentration of TNFα, IL6 (C) and IFNα (D) in supernatants of purified Mo from four healthy donors treated with apoptotic or necrotic material for 24 h, or left untreated (Untx). Plotted values are the mean±SD from four independent donors; p values determined by the two-tailed t test. *p<0.05.

Similar to Figs. 2B–D, we tested the functional consequence of apoptotic/necrotic-induced IRF5 nuclear translocation by measuring IRF5-regulated proinflammatory cytokines IL6, TNFα and IFNα in supernatants and cells. Expression of secreted proteins and cellular transcripts were measured after stimulation of purified healthy donor Mo with control, apoptotic, or necrotic supernatants. At 24 h post-stimulation, TNFα and IFNα levels were elevated in response to apoptotic or necrotic material (Fig. 4B&D); low levels of IL6 could also be detectedC). A similar increase in IFNα levels was detected at 6 h post-stimulation with either material (data not shown). An increase in IFNA transcripts was observed for necrotic stimulations (Supplementary Fig. 4B). Once again, as seen with SLE serum stimulations, IRF5 nuclear translocation preceded cytokine expression, though the profile and kinetics of cytokines expressed were different.

DISCUSSION

Data presented here clearly demonstrate that IRF5 is constitutively “activated” in Mo of SLE patients. IRF5 is primarily cytoplasmic in unstimulated healthy donor cells independent of cell type, and nuclear accumulation is considered to be a general marker of activation; this has been confirmed by traditional Western blotting of cytoplasmic and nuclear extracts, as well as by Imagestream analysis (6–8, 20, 21). We have previously demonstrated that individual IRF5 isoforms have distinct cellular expression, localization, and function (13), thus the cell type-specific nature of our observations could be explained in part by an intrinsic difference in lupus Mo. For instance, a distinct profile of IRF5 isoforms could be expressed in Mo of SLE patients, as compared to healthy donors, that are more sensitive to activation stimuli or are constitutively nuclear in the absence of activating stimuli. These possibilities are currently under investigation in our laboratory. The lack of a correlation between IRF5 genotype and IRF5 activation may be in part due to the limited number of patient samples analyzed, but given the ability of SLE serum to induce significant nuclear accumulation of IRF5 in healthy donor PBMC and/or purified Mo (Fig. 2A), a role for the IRF5 SLE genotype, or other intrinsic differences, in IRF5 activation is diminished. Further studies will be required to clarify the exact contribution of an IRF5 SLE genotype, intrinsic differences in IRF5 isoform expression, and the SLE blood environment to constitutive IRF5 activation in monocytes of SLE patients.

SLE serum provides an activation trigger for IRF5, albeit the trigger is not type I IFN. Instead, our data demonstrate a role for circulating nucleic acid-containing autoantigens in IRF5 activation. Interestingly, ICs generated by combining apopotic and necrotic material with SLE IgG did not induce IRF5 nuclear localization. In pDCs, IC are thought to be internalized via FcγRIIa where they reach the endosomes and stimulate Toll-like receptor (TLR) 7 or 9 in cells (reviewed in (39)), and IRF5 is a known critical mediator of MyD88-dependent TLR7/9 signaling (9, 22). However, little to no TLR7/9 are expressed in human primary Mo (40), yet SLE serum retained its ability to induce IRF5 nuclear localization ex vivo in purified Mo from healthy donors. These findings support a TLR7/9-independent mechanism for IRF5 activation in Mo that is mediated in part by circulating autoantigens derived from apoptotic/necrotic cells. The DNA-dependent activator of IRFs (DAI) (also called DLM-1/ZBP1) may be a good candidate for this TLR7/9-independent sensing mechanism of extracellular nucleic acids from dying cells, i.e. apoptotic/necrotic debris, since DAI is highly expressed in Mo/Mϕ (41) and has been shown to signal through IRF3 (42). However, a role for IRF5 in this pathway has yet to be defined and mouse embryonic fibroblasts (MEFs) lacking Irf5 have normal DAI-induced IFNB or IFNA4 expression (42). Other candidate DNA sensors that have been shown to incorporate IRFs in their signaling pathways include leucine-rich repeat (in Flightless I) interacting protein-1 (Lrrfip1) and IFN-inducible protein IFI16 (reviewed in (43)).

Following phagocytic engulfment by Mo/Mϕ, apoptotic/necrotic cellular debris in SLE serum could be triggering a pathogenic inflammatory response (reviewed in (44)) in which IRF5 is activated as a downstream mediator resulting in altered cytokine production. Indeed, data in Figs. 2 and 4 support this. Even though our in vitro system of generating ICs could not activate IRF5 in Mo, we can not exclude an in vivo role for circulating ICs in SLE serum to activate IRF5 via a TLR7/9-independent manner, such as by FcγRIIa cross-linking on the surface of Mo leading to proinflammatory cytokine production (45). Further characterization of the triggers and mechanisms of IRF5 nuclear accumulation in Mo of SLE patients will be critical to our understanding of how dysregulation of IRF5 expression/activation in SLE contributes to disease pathogenesis. Given the current known functions for IRF5 in regulating cytokine/chemokine expression and cellular apoptosis, it would not be surprising to find that constitutively activated IRF5 in Mo of SLE patients contributes to their dysfunction. Results from these types of studies should provide new strategies for intervention in the lupus disease process.

Supplementary Material

Supp Fig S1
Supp Fig S2
Supp Fig S3
Supp Fig S4

Acknowledgments

We thank Ms. Anne Trönnberg for excellent technical assistance and Ms. Rezvan Kiani for collecting the blood samples. This work was supported by grants from the National Institute of Health (NIH)/National Institute of Arthritis and Musculoskeletal and Skin Diseases (NIAMS; 5R03AR054070), the Arthritis Foundation and the Alliance for Lupus Research (to BJB), the Swedish Research Council, the Swedish Rheumatism Association, the Torsten and Ragnar Söderberg Foundation, the King Gustaf V 80-year Foundation and Combine, the Alliance for Lupus Research (to LR), and the King Gustaf V 80-year Foundation (to MLE).

References

  • 1.Ronnblom L, Alm GV, Eloranta ML. The type I interferon system in the development of lupus. Semin Immunol. 2011;23(2):113–21. doi: 10.1016/j.smim.2011.01.009. [DOI] [PubMed] [Google Scholar]
  • 2.Graham RR, Kyogoku C, Sigurdsson S, Vlasova IA, Davies LR, Baechler EC, et al. Three functional variants of IFN regulatory factor 5 (IRF5) define risk and protective haplotypes for human lupus. Proc Natl Acad Sci U S A. 2007;104(16):6758–63. doi: 10.1073/pnas.0701266104. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Kelly JA, Kelley JM, Kaufman KM, Kilpatrick J, Bruner GR, Merrill JT, et al. Interferon regulatory factor-5 is genetically associated with systemic lupus erythematosus in African Americans. Genes Immun. 2008;9(3):187–94. doi: 10.1038/gene.2008.4. [DOI] [PubMed] [Google Scholar]
  • 4.Shin HD, Sung YK, Choi CB, Lee SO, Lee HW, Bae SC. Replication of the genetic effects of IFN regulatory factor 5 (IRF5) on systemic lupus erythematosus in a Korean population. Arthritis Res Ther. 2007;9(2):R32. doi: 10.1186/ar2152. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Sigurdsson S, Goring HH, Kristjansdottir G, Milani L, Nordmark G, Sandling JK, et al. Comprehensive evaluation of the genetic variants of interferon regulatory factor 5 (IRF5) reveals a novel 5 bp length polymorphism as strong risk factor for systemic lupus erythematosus. Hum Mol Genet. 2008;17(6):872–81. doi: 10.1093/hmg/ddm359. [DOI] [PubMed] [Google Scholar]
  • 6.Barnes BJ, Kellum MJ, Field AE, Pitha PM. Multiple regulatory domains of IRF-5 control activation, cellular localization, and induction of chemokines that mediate recruitment of T lymphocytes. Mol Cell Biol. 2002;22(16):5721–40. doi: 10.1128/MCB.22.16.5721-5740.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Barnes BJ, Moore PA, Pitha PM. Virus-specific activation of a novel interferon regulatory factor, IRF-5, results in the induction of distinct interferon alpha genes. J Biol Chem. 2001;276(26):23382–90. doi: 10.1074/jbc.M101216200. [DOI] [PubMed] [Google Scholar]
  • 8.Barnes BJ, Richards J, Mancl M, Hanash S, Beretta L, Pitha PM. Global and distinct targets of IRF-5 and IRF-7 during innate response to viral infection. J Biol Chem. 2004;279(43):45194–207. doi: 10.1074/jbc.M400726200. [DOI] [PubMed] [Google Scholar]
  • 9.Takaoka A, Yanai H, Kondo S, Duncan G, Negishi H, Mizutani T, et al. Integral role of IRF-5 in the gene induction programme activated by Toll-like receptors. Nature. 2005;434(7030):243–9. doi: 10.1038/nature03308. [DOI] [PubMed] [Google Scholar]
  • 10.Barnes BJ, Kellum MJ, Pinder KE, Frisancho JA, Pitha PM. Interferon regulatory factor 5, a novel mediator of cell cycle arrest and cell death. Cancer Res. 2003;63(19):6424–31. [PubMed] [Google Scholar]
  • 11.Yanai H, Chen HM, Inuzuka T, Kondo S, Mak TW, Takaoka A, et al. Role of IFN regulatory factor 5 transcription factor in antiviral immunity and tumor suppression. Proc Natl Acad Sci U S A. 2007;104(9):3402–7. doi: 10.1073/pnas.0611559104. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Feng D, Stone RC, Eloranta ML, Sangster-Guity N, Nordmark G, Sigurdsson S, et al. Genetic variants and disease-associated factors contribute to enhanced interferon regulatory factor 5 expression in blood cells of patients with systemic lupus erythematosus. Arthritis Rheum. 2010;62(2):562–73. doi: 10.1002/art.27223. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Mancl ME, Hu G, Sangster-Guity N, Olshalsky SL, Hoops K, Fitzgerald-Bocarsly P, et al. Two discrete promoters regulate the alternatively spliced human interferon regulatory factor-5 isoforms. Multiple isoforms with distinct cell type-specific expression, localization, regulation, and function. J Biol Chem. 2005;280(22):21078–90. doi: 10.1074/jbc.M500543200. [DOI] [PubMed] [Google Scholar]
  • 14.Kyttaris VC, Katsiari CG, Juang YT, Tsokos GC. New insights into the pathogenesis of systemic lupus erythematosus. Curr Rheumatol Rep. 2005;7(6):469–75. doi: 10.1007/s11926-005-0054-3. [DOI] [PubMed] [Google Scholar]
  • 15.Auger MJ, Ross JA. The biology of macrophage. In: Lewis CE, McGee JO, editors. The Macrophage. Oxford: Oxford University Press; 2008. pp. 2–74. [Google Scholar]
  • 16.Katsiari CG, Liossis SN, Sfikakis PP. The pathophysiologic role of monocytes and macrophages in systemic lupus erythematosus: a reappraisal. Semin Arthritis Rheum. 2010;39(6):491–503. doi: 10.1016/j.semarthrit.2008.11.002. [DOI] [PubMed] [Google Scholar]
  • 17.Unanue ER. The regulation of lymphocyte functions by the macrophage. Immunol Rev. 1978;40:227–55. doi: 10.1111/j.1600-065x.1978.tb00408.x. [DOI] [PubMed] [Google Scholar]
  • 18.Baumann I, Kolowos W, Voll RE, Manger B, Gaipl U, Neuhuber WL, et al. Impaired uptake of apoptotic cells into tingible body macrophages in germinal centers of patients with systemic lupus erythematosus. Arthritis Rheum. 2002;46(1):191–201. doi: 10.1002/1529-0131(200201)46:1<191::AID-ART10027>3.0.CO;2-K. [DOI] [PubMed] [Google Scholar]
  • 19.Steinbach F, Henke F, Krause B, Thiele B, Burmester GR, Hiepe F. Monocytes from systemic lupus erythematous patients are severely altered in phenotype and lineage flexibility. Ann Rheum Dis. 2000;59(4):283–8. doi: 10.1136/ard.59.4.283. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Hu G, Barnes BJ. IRF-5 is a mediator of the death receptor-induced apoptotic signaling pathway. J Biol Chem. 2009;284(5):2767–77. doi: 10.1074/jbc.M804744200. [DOI] [PubMed] [Google Scholar]
  • 21.Hu G, Mancl ME, Barnes BJ. Signaling through IFN regulatory factor-5 sensitizes p53-deficient tumors to DNA damage-induced apoptosis and cell death. Cancer Res. 2005;65(16):7403–12. doi: 10.1158/0008-5472.CAN-05-0583. [DOI] [PubMed] [Google Scholar]
  • 22.Schoenemeyer A, Barnes BJ, Mancl ME, Latz E, Goutagny N, Pitha PM, et al. The interferon regulatory factor, IRF5, is a central mediator of toll-like receptor 7 signaling. J Biol Chem. 2005;280(17):17005–12. doi: 10.1074/jbc.M412584200. [DOI] [PubMed] [Google Scholar]
  • 23.Danis B, George TC, Goriely S, Dutta B, Renneson J, Gatto L, et al. Interferon regulatory factor 7-mediated responses are defective in cord blood plasmacytoid dendritic cells. Eur J Immunol. 2008;38(2):507–17. doi: 10.1002/eji.200737760. [DOI] [PubMed] [Google Scholar]
  • 24.Fanning SL, George TC, Feng D, Feldman SB, Megjugorac NJ, Izaguirre AG, et al. Receptor cross-linking on human plasmacytoid dendritic cells leads to the regulation of IFN-alpha production. J Immunol. 2006;177(9):5829–39. doi: 10.4049/jimmunol.177.9.5829. [DOI] [PubMed] [Google Scholar]
  • 25.George TC, Fanning SL, Fitzgerald-Bocarsly P, Medeiros RB, Highfill S, Shimizu Y, et al. Quantitative measurement of nuclear translocation events using similarity analysis of multispectral cellular images obtained in flow. J Immunol Methods. 2006;311(1–2):117–29. doi: 10.1016/j.jim.2006.01.018. [DOI] [PubMed] [Google Scholar]
  • 26.Wen F, Ellingson SM, Kyogoku C, Peterson EJ, Gaffney PM. Exon 6 variants carried on systemic lupus erythematosus (SLE) risk haplotypes modulate IRF5 function. Autoimmunity. 2011;44(2):82–9. doi: 10.3109/08916934.2010.491842. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Calzada-Nova G, Schnitzlein WM, Husmann RJ, Zuckermann FA. North american porcine reproductive and respiratory syndrome viruses inhibit type I interferon production by plasmacytoid dendritic cells. J Virol. 2011;85(6):2703–13. doi: 10.1128/JVI.01616-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Vallin H, Blomberg S, Alm GV, Cederblad B, Ronnblom L. Patients with systemic lupus erythematosus (SLE) have a circulating inducer of interferon-alpha (IFN-alpha) production acting on leucocytes resembling immature dendritic cells. Clin Exp Immunol. 1999;115(1):196–202. doi: 10.1046/j.1365-2249.1999.00772.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Hua J, Kirou K, Lee C, Crow MK. Functional assay of type I interferon in systemic lupus erythematosus plasma and association with anti-RNA binding protein autoantibodies. Arthritis Rheum. 2006;54(6):1906–16. doi: 10.1002/art.21890. [DOI] [PubMed] [Google Scholar]
  • 30.Lovgren T, Eloranta ML, Bave U, Alm GV, Ronnblom L. Induction of interferon-alpha production in plasmacytoid dendritic cells by immune complexes containing nucleic acid released by necrotic or late apoptotic cells and lupus IgG. Arthritis Rheum. 2004;50(6):1861–72. doi: 10.1002/art.20254. [DOI] [PubMed] [Google Scholar]
  • 31.Li Y, Lee PY, Reeves WH. Monocyte and macrophage abnormalities in systemic lupus erythematosus. Arch Immunol Ther Exp (Warsz) 2010;58(5):355–64. doi: 10.1007/s00005-010-0093-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Cairns AP, Crockard AD, McConnell JR, Courtney PA, Bell AL. Reduced expression of CD44 on monocytes and neutrophils in systemic lupus erythematosus: relations with apoptotic neutrophils and disease activity. Ann Rheum Dis. 2001;60(10):950–5. doi: 10.1136/ard.60.10.950. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Gaipl US, Voll RE, Sheriff A, Franz S, Kalden JR, Herrmann M. Impaired clearance of dying cells in systemic lupus erythematosus. Autoimmun Rev. 2005;4(4):189–94. doi: 10.1016/j.autrev.2004.10.007. [DOI] [PubMed] [Google Scholar]
  • 34.Baechler EC, Batliwalla FM, Karypis G, Gaffney PM, Ortmann WA, Espe KJ, et al. Interferon-inducible gene expression signature in peripheral blood cells of patients with severe lupus. Proc Natl Acad Sci U S A. 2003;100(5):2610–5. doi: 10.1073/pnas.0337679100. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Ho V, McLean A, Terry S. Severe systemic lupus erythematosus induced by antiviral treatment for hepatitis C. J Clin Rheumatol. 2008;14(3):166–8. doi: 10.1097/RHU.0b013e3181775e80. [DOI] [PubMed] [Google Scholar]
  • 36.Hooks JJ, Moutsopoulos HM, Geis SA, Stahl NI, Decker JL, Notkins AL. Immune interferon in the circulation of patients with autoimmune disease. N Engl J Med. 1979;301(1):5–8. doi: 10.1056/NEJM197907053010102. [DOI] [PubMed] [Google Scholar]
  • 37.Munoz LE, van Bavel C, Franz S, Berden J, Herrmann M, van der Vlag J. Apoptosis in the pathogenesis of systemic lupus erythematosus. Lupus. 2008;17(5):371–5. doi: 10.1177/0961203308089990. [DOI] [PubMed] [Google Scholar]
  • 38.Rumore PM, Steinman CR. Endogenous circulating DNA in systemic lupus erythematosus. Occurrence as multimeric complexes bound to histone. J Clin Invest. 1990;86(1):69–74. doi: 10.1172/JCI114716. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Ronnblom L. Potential role of IFNalpha in adult lupus. Arthritis Res Ther. 2010;12 (Suppl 1):S3. doi: 10.1186/ar2884. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Hornung V, Rothenfusser S, Britsch S, Krug A, Jahrsdorfer B, Giese T, et al. Quantitative expression of toll-like receptor 1–10 mRNA in cellular subsets of human peripheral blood mononuclear cells and sensitivity to CpG oligodeoxynucleotides. J Immunol. 2002;168(9):4531–7. doi: 10.4049/jimmunol.168.9.4531. [DOI] [PubMed] [Google Scholar]
  • 41.Fu Y, Comella N, Tognazzi K, Brown LF, Dvorak HF, Kocher O. Cloning of DLM-1, a novel gene that is up-regulated in activated macrophages, using RNA differential display. Gene. 1999;240:157–163. doi: 10.1016/s0378-1119(99)00419-9. [DOI] [PubMed] [Google Scholar]
  • 42.Takaoka A, Wang ZC, Choi MK, Yanai H, Negishi H, Ban T, Lu Y, Miyagishi M, Kodama T, Honda K, Ohba Y, Taniguchi T. DAI (DLM-1/ZBP1) cytosolic DNA sensor and an activator of innate immune response. Nature. 2007;448:501–505. doi: 10.1038/nature06013. [DOI] [PubMed] [Google Scholar]
  • 43.Sharma S, Fitzgerald KA. Innate immune sensing of DNA. PLos Pathogens. 2011;7(4):e1001310. doi: 10.1371/journal.ppat.1001310. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Green DR, Ferguson T, Zitvogel L, Kroemer G. Immunogenic and tolerogenic cell death. Nat Rev Immunol. 2009;9(5):353–63. doi: 10.1038/nri2545. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Debets JM, Van der Linden CJ, Dieteren IE, Leeuwenberg JF, Buurman WA. Fc-receptor cross-linking induces rapid secretion of tumor necrosis factor (cachectin) by human peripheral blood monocytes. J Immunol. 1988;141(4):1197–201. [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supp Fig S1
NIHMS328792-supplement-Supp_Fig_S1.pdf (58.2KB, pdf)
Supp Fig S2
NIHMS328792-supplement-Supp_Fig_S2.pdf (171.8KB, pdf)
Supp Fig S3
NIHMS328792-supplement-Supp_Fig_S3.pdf (74.3KB, pdf)
Supp Fig S4
NIHMS328792-supplement-Supp_Fig_S4.pdf (31.7KB, pdf)

RESOURCES