α–Synuclein Increases the Cellular Level of Phospholipase Cβ1

Abstract

α-Synuclein is a conserved protein that is a key component in neurodegenerative plaques [1, 2]. α-Synuclein binds strongly to phospholipase Cβ (PLCβ) and promotes Ca²⁺ release in cells. Here, we show that expression of α-synuclein increases the cellular level of PLCβ1 in two neuronal cell lines: PC12 and SK-N-S-SH. The increase in PLCβ1 is not accompanied by changes in the level of RNA or in ubiquitination. Instead, we find that α-synuclein protects PLCβ1 from trypsin digestion and from degradation by the Ca⁺² activated protease calpain. Calpain removes the C-terminal region of the enzyme which mediates activation by Gα_q. We find that in SK-N-SH cells, α-synuclein reduced degradation of PLCβ1 by calpain during Ca²⁺ signaling allowing the enzyme to remain sensitive to Gα_q activation. Taken together, our studies show that α-synuclein protects the integrity of PLCβ1 and its ability to be activated by Gα_q, which may in turn impact Ca²⁺ signaling.

1 INTRODUCTION

α-Synuclein is a small protein that is highly expressed in brain tissues (see [1]). α-Synuclein is the major component of neurodegenerative plaques and mutations are associated with sporadic forms of familial Parkinson’s disease [5–8]. This association with neurogenerative disorders has sparked much interest in the physical and cellular properties of the protein. To date, α-synuclein has been found only in vertebrates and is highly conserved from humans to songbirds [2]. This high degree of conservation suggests an important role in the cell although its function is still unknown.

α-Synuclein binds to many proteins (see [3]) and also to lipid membranes (e.g.[10–13]). Studies using knock-out mice point to a role in neural plasticity responses [14], and show a connection between α-synuclein and ApoE and Aβ peptides [4], suggesting a role in lipid trafficking. It is notable that many of α-synuclein potential partners are involved in lipid signaling pathways (see [5]).

We have previously found that membrane binding of α-synuclein is promoted by PI(4,5)P₂ and Ca²⁺ suggesting that it might be involved in the PLC signaling pathway [6]. PLCβ enzymes are activated by the Gα_q family of G proteins in response to specific neurotransmitters and hormones. PLCβs catalyze the hydrolysis of PI(4,5)P₂ to generate the release of Ca²⁺ from intracellular stores and activate protein kinase C. There are four known types of PLCβ with varying tissue distribution and sensitivity to G proteins. PLCβ1 is the most sensitive to Gα_q and has the least sensitivity to Gβγ subunits. In contrast, PLCβ2 and PLCβ3 are sensitive to both Gα_q and Gβγ subunits.

Our previous study found that α-synuclein associates with PLCβ1–3 with a high affinity reducing their basal activity by ~50% [6]. This association strongly enhanced activation by Gβγ subunits although it did not appear to affect activation by Gα_q subunits [6]. We have extended those studies to include interactions between α-synuclein and PLCβ1, which are both highly expressed in neuronal cells. In the course of these studies, we observed that as the cellular level of α-synuclein increases, so does the level of PLCβ1, but not vice versa. This observation led to a series of experiments showing that α-synuclein protects the enzyme from calpain digestion and preserves regulation by Gα_q. Our studies show α-synuclein that can serve as a protective agent that may potentially impact the cell signaling. The results also imply that removal of one or more protein partners will promote self-association and aggregation of α-synuclein.

2 MATERIALS AND METHODS

2.1 Cell culture and transfection

HEK TAP-PLCβ1 cells were a generous gift from Dr. Loren Runnels (UMDNJ Piscataway, NJ) and have been described [7]. SK-N-SH cells and PC12 cells were obtained from ATCC (HTB-11, CRL-1721). Both HEK TAP-PLCβ1 and SK-N-SH cells were maintained in Dulbecco’s modified Eagle’s medium (DMEM, GIBCO 11965) supplemented with 10% fetal bovine serum, 50 units/ml penicillin, and 50 µg/ml streptomycin sulfate. PC12 cells were cultured in DMEM medium supplemented with 10% horse serum, 5% fetal bovine serum, 50 units/ml penicillin, and 50 µg/ml streptomycin sulfate. All cells were incubated at 37 °C with 5% CO₂. Tetracycline was added to a final concentration 1µg/ml to induce PLCβ1 expression in HEK TAP-PLCβ1 cells. Nerve growth factor (NGF, Sigma, St. Louis, MO) was added to a final concentration of 100 ng/ml to induce PC12 cells differentiation. Plasmids were introduced into cells grown at 80–90% confluency by electroporation for PC12 cells (http://www.sciencedirect.com/science/article/pii/S0003986111000701-b0030) and calcium phosphate precipitation for HEK TAP-PLCβ1 cells. The protein expression of endogenous α-synuclein in SK-N-SH cells was knocked down using small interference RNA α-synuclein (Dharmacon Inc.) according to the manufacturer's instructions along with the negative control purchased from the manufacturer. The cells were incubated for 72 hours post knock down at 37°C in 5% CO₂. Western blot analysis showed this procedure produces ~80% gene silencing.

2.2 Protein purification

His₆-PLCβ1 and PLCβ2 were expressed in Sf9 cells using a baculovirus system with minor modifications [17]. A C-terminal truncation mutant of PLCβ2 using for some of the control studies is actually a chimeric construct of PLCβ2 and PLCδ1 described in [8]. α-Synuclein, γ-synuclein and the PHβ2/PLCδ1 chimera were expressed in Escherichia coli and purified on a Ni²⁺ column using previously reported methods (see [9]). Expression and purity was assessed by Western blot analysis using commercial antibodies, purchased from Abcam (α-synuclein and γ-synuclein), and Santa Cruz Biochemicals (PLCβ1).

2.3 Enzyme digestion experiments

Digestion studies used purified proteins and were carried out by western blot analysis using anti- PLCβ1 (Santa Cruz Biochemicals sc-136040), or by assessing the loss in PLCb1 activity. PLCβ1 activity was assessed by measuring the ability of 20–50 nM enzyme to hydrolyze [³H]PI(4,5)P₂ dispersed on 2 mM sonicated phosphatidylserine:phosphatidylethanolamine: PI(4,5)P₂ (2:1:0.5, v/v) membranes as described previously [10]. Trypsin digestion was carried out by adding 0.17 µg/ml (final concentration) to PLCβ1 alone or incubated with a stoichiometric amount of α-synuclein at 25°C for specific times as noted in the text. μ-Calpain digestion was carried out similarly by adding μ-calpain in 800µM calcium to pre-incubated PLCβ1- α-synuclein complexes.

Calpain digestion studies in SK-N-SH cells either untreated or transfected with siRNA(α-synuclein) (Dharmacon, Inc.), were carried out by increasing intracellular calcium by adding 1µM of the calcium ionophore A23187 to the cell media DMEM containing 1.05 mM calcium. Cells were incubated at 37°C, 5% CO₂ for 0, 1, 2 and 4 hours. Control studies added 10µM calpain inhibitor into the medium prior to addition of A23187, or did not contain A23187.

2.4 Pull down study to assess ubiquitination

SK-N-SH wild type cells and α-synuclein knock down cells were harvested and resuspended in lysis buffer containing 150mM NaCl, 2mM MgCl₂, 20mM Hepes (pH7.4) with 5mM 2-mercaptoethanol, 10ug/ml leupeptin, 10ug/ml aprotinin and 1mM PMSF. After homogenization, cells lysates were spun down at 10,000xg, 4°C to remove cell debris and unbroken nuclei. Streptavidin beads were washed twice with PBS. 20ul streptavidin beads were added to the cell lysate and the mixture was rotated for 1 hour at 4°C. The resin was spun down gently and the supernatant removed. The resin was then washed twice with 50mM Tris pH 8.0, 150mM KCl, 2mM EDTA, 5mM 2-mercaptoethanol, 1mM PMSF. PLCβ1 was eluted by adding buffer containing 2mM biotin and incubated on ice for 30min. The pulled-down proteins were assayed by western blotting using anti-PLCβ1 and anti-ubiquitin antibodies.

2.5 Mass spectrometry

PLCβ2 bands alone or subjected to calpain digestion were isolated on SDS PAGE electrophoresis. The bands were cut and removed, digested by trypsin and the peptides were analyzed by LC/MS/MS on a Thermo LTQ XL at the Proteomics Center at Stony Brook University.

2.6 RNA extraction, cDNA synthesis and real-time PCR analysis

Total RNA extraction, cDNA synthesis and real-time PCR were performed as described previously [11]. Briefly, control HEK cells and HEK cells overexpressing α-synuclein were rinsed twice in PBS prior to lysis in RLT buffer containing 1% β-mercaptoethanol (Qiagen, Valencia, CA). Total RNA was extracted from the cell lysate using the RNeasy Maxi Kit (Qiagen, Valencia, CA) with DNAse I treatment to eliminate genomic DNA contamination. The RNA was quantitated by spectrophotometry, the samples were diluted to nominally identical concentrations and then quantitated a second time. First strand cDNA was synthesized from 5µg total RNA using the Superscript III Reverse Transcriptase (Invitrogen, Carlsbad, CA). The cDNA samples were diluted 1:16 and real-time PCR was performed using the QuantiTect SyBr Green PCR kit (Qiagen, Valencia, CA) in an ABI 7300 Real Time PCR System (Applied Biosystems,). Each experimental sample was analyzed in triplicates. Threshold crossing points were converted into expression values automatically using the method by Larionov et al. [12]. Three primer pairs were used to amplify three different regions of PLCβ1, all within the common region between the two PLCβ1 isoforms previously reported [13]. The primer pairs were validated for equal efficiency using rat brain tissue as a positive control: (1) forward: 5’ GAAGCAAGAGCAGGTCCAAG 3’, reverse: 5’ACACAGCGACATCCAGACAG 3’; (2) forward: 5’ CGGCCAGGCTATCACTACAT 3’, reverse: 5’ ATTCACCCCATTCTCTGCTG 3’;(3) forward: 5’ GGCTGGGAACTCGTCTGTAG 3’, reverse: 5’ TAAGGAGGGCATCACCAAAG 3’. PLCb1 gene expression in each sample was normalized using 18S and 28S as internal controls. The results from each primer pair were averaged. The specificity of amplification was verified by sequencing the amplicons from each sample.

3. RESULTS

3.1 The presence of α-synuclein increases the protein level of PLCβ 1 in cultured cells

We observed that when α-synuclein is over-expressed in PC12 cells, the cellular level of PLCβ1 is greatly enhanced (see Fig. 1A). This effect is highly reproducible and occurs in a human neuroblastoma cell line SK-N-SH, in which both PLCβ1 and α-synuclein are endogenously expressed and in HEK293 cells that express low levels of PLCβ1 and no detectable α-synuclein (Fig. 1B–C). Additionally, down-regulation of α-synuclein by siRNA treatment lowers the cellular amount of PLCβ1 (Fig. 1C) In contrast, over-expression of PLCβ1 did not affect the expression levels of α-synuclein (Fig. 1C). These results show that α-synuclein may increases the cellular level of PLCβ1 in several cell types.

Figure 1. α-Synuclein increases the cellular level of PLCβ1.

A- Western blot showing the change in the level of PLCβ1 with over-expression of α-synuclein in PC12 cells. Rat aortic smooth muscle cells (A10), which do not express either PLCβ1 or α-synuclein were used as a control. Band intensities normalized to tubulin and averaged for 3 data sets are shown on the right. B- The same study as in A showing a reduced, but still significant effect in non-neuronal HEK293 cells. C- Studies in the neuronal cell line SK-H-SN. Left - Lanes 1–2 show that the level of α-synuclein is not affected by over-expression of PLCβ1 (n=3). Lanes 3–4 show an increase in PLCβ1 when α-synuclein was expressed at a level that was 29% over endogenous as determined by band density and correcting for β-actin levels. Lanes 5–6 show a reduction in the level of PLCβ1 when cells are treated with si(RNA) α-synuclein. Right – Control study showing changes in protein levels using a non-targetting siRNA (siRNA for GAPDH). siRNA(GAPDH) did not result in any changes in a-synuclein or PLCβ1 levels relative to actin.

To determine whether α-synuclein is regulating the transcription of PLCβ1, we measured the message level of PLCβ1 in HEK293 cells that were transfected with α-synuclein or empty vector, using real-time PCR. The assay used three different PLCβ1 primer pairs to amplify distinct sites of the molecule (see Methods). All pairs gave identical results: expression of α-synuclein did not significantly change the transcript level of PLCβ1 (normalized values were 1.5 ± 0.4 empty vector versus 1.0 ± 0.4 α-synuclein, n=3). Thus, the increase in expression levels of PLCβ1 that occurs in the presence of α-synuclein is due to a post-transcriptional mechanism.

3.2 α-Synuclein prevents PLCβ1 degradation by proteases

The above results suggest that the increase of PLCβ1 with α-synuclein occurs at the protein level. We first tested whether the presence of α-synuclein alters PLCβ1 degradation through the ubiquitination pathway. We monitored the amount of ubiquitin-PLCβ1 with when α-synuclein levels are reduced using siRNA(α-synuclein) in SK-H-SH cells or when α-synuclein is over-expression in HEK293 cells. The results, shown in Figure 2, suggest that the ubiquitination of PLCβ1 is not greatly affected by α-synuclein.

Figure 2. α-Synuclein does not affect the ubiquitination state of PLCβ1.

A - Endogenous PLCβ1 in SK-N-SH cells untreated and treated with si(RNA)-α-synuclein was immuno-precipitated and probed for ubiquitin using a monoclonal antibody (n=2). B – Change in PLCβ1 ubiquitination with α-synuclein over-expression in HEK293 cells where the ubiquitin band shown corresponds to the PLCβ1 band identified by western blotting, stripping and reprobing. Note that in both A and B the lanes were loaded with similar amounts of PLCβ1 so that the degree of ubiquitination can be more easily compared.

Another mechanism through which α-synuclein could increase the protein level of PLCβ1 is by protecting the enzyme from protease digestion. For these studies, we used purified protein expressed bacterially, dialyzed extensively and stored in 10% glycerol at −80°C. It has been reported that detergent-purified α-synuclein is an unfolded monomer, while native α-synuclein is a folded tetramer [14]. By native gel electrophoresis, we find that our preparation is approximately half monomer and half tetramer, and that its circular dichroism spectrum is identical to the one reported by Bartels and coworkers [14] (data not shown). We are presently determining whether α-synuclein associates to PLCβ1 as a monomer or tetramer.

We carried out an initial series of studies in which we compared the digestion of PLCβ1 and a mixture of PLCβ1 and α-synuclein (1:10) by trypsin. Trypsin cleaves peptide bonds of amino acids with positively charged side chains. We monitored digestion by both changes in activity, through ³H-PI(4,5)P₂ hydrolysis, and western blotting of PLCβ1 (the amount of enzyme used was too low to be detected by coomassie staining). Digestion was followed for 1–5 minutes and was quenched by the addition of excess antitrypsin inhibitor. The results (Fig. 3) show a clear protection of PLCβ1 digestion by α-synuclein.

Fig. 3. α-Synuclein protects PLCβ1 from trypsin digestion.

Top – Trypsin digestion (0.16 mg/ml final) of PLCβ1 at 37°C alone (lanes 1, 2) or with a 1:1 molar amount of α-synuclein. Bottom – loss of PLCβ1 activity, as seen by ³H-IP₃ production by trypsin alone or at a 1:1 molar amount of α-synuclein.

Trypsin digestion of proteins occurs in lysozymes and it is not clear whether protection of PLCβ1 by α-synuclein would give rise to the increased cellular levels seen in Figure 1. However, it has been found that cellular PLCβ1 is cleaved by the calcium- sensitive protease, calpain resulting in 80 and 43 kDa protein products [15]. Calpain is a non-lysozymal protease that targets Cys residues contained in particular tertiary structural elements rather than sequence, and calpain has been shown to cleave a site in the C-terminus of the PLCβ1 (see [16]). We repeated the digestion study using μ-calpain and found that α-synuclein provides moderate but significant protection of PLCβ1 from calpain-mediated proteolysis (Fig. 4A). Interestingly, calpain treatment produced a more active enzyme (Fig. 4B); an effect that does not occur in the presence of α-synuclein.

Fig. 4. Calpain cleavage of PLCβ 1 produces a fragment that is protected by α-synuclein.

A – Protection of calpain digestion of PLCβ1 by α-synuclein as seen by western blotting. The bar graph underneath correspond to the band intensities normalized to actin. B - A parallel study showing the change in PLCβ1 activity, as seen by ³H-PI production due to calpain alone and in the presence of a 4 fold excess of α-synuclein (left) and PLCβ2 by γ-synuclein (right). C – Protection from calpain digestion of PLCβ2 by α-synuclein and γ-synuclein as visualized by western blotting and silver staining. The red arrow indicates the major band resulting from calpain digestion that is absent in the presence of α-synuclein. Calpain cleavage also produced a more active enzyme as seen by ³H-IP₃ production (right).

To determine whether protection of calpain cleavage was general to other PLCb enzymes, we repeated this study using PLCβ2. We found that both α-synuclein and another family member γ-synuclein, efficiently protected PLCβ2 from calpain digestion (Fig. 4C). Like PLCβ1, calpain cleavage producted an active product but calpain did not digest a PLCβ2 mutant protein missing ~400 C-terminal residues (data not shown). Taken together, these results suggest that in vitro, α-synuclein protects PLCβ1–2 from calpain cleavage of the C-terminus.

3.3 Identification of the calpain cleavage site of PLCβ1

We carried out studies to determine the PLCβ cleavage site protected by α-synuclein. Previously, Rhee and coworkers used a series of monoclonal antibodies to find that calpain cleaves of PLCβ1 at or close to residue 880 [22]. We extended this previous studies to identify the calpain cleavage site of PLCβ2 using mass spectrometry. For these studies, we analyzed the intact protein and the 80 kDa degradation product. We find that the degradation product is missing the residues after 743. Thus, the calpain cleavage site of PLCβ2 is ~140 residues upstream from the site of PLCβ1 and lies at the end of the C2 domain and beginning of the C-terminal region of the enzyme. This result is consistent with our observation that calpain does not cleave the C-terminal deleted enzyme. We note that this 80 kDa fragment was not detected in cells by our commercial antibodies.

3.4 α-Synuclein protects PLCβ1 from calpain degradation in cultured cells

The above studies suggest that α-synuclein may protect PLCβ1 from calpain digestion in cells. We tested this idea in SK-N-SH cells. Activation of μ-calpain was induced by incubating the cells in a high calcium medium and by adding a calcium ionophore. Control studies were carried out in the presence of a calpain inhibitor (see Methods). A typical result is shown in Fig. 5A. The persistent appearance of PLCβ1 at longer digestion times suggests that calpain digestion is not efficient.

Fig. 5. α-Synuclein stabilization PLCβ1 in SK-N-SH cells.

A – Calpain was activated by treating the cells with 1 µM of the Ca²⁺ ionophore A23187 to allow Ca²⁺ entry into the cell and the amount of PLCβ1 degradation was probed in the absence and presence of calpain inhibitor was viewed by western blotting. The graph shows the ratio of band intensity ratio of PLCβ1 to actin. B – Degradation of PLCβ1 with calpain activation in control cells and one were α-synuclein was down-regulated using siRNA.

We then tested whether α-synuclein can protect PLCβ1 from calpain degradation. Since SKN-SH cells express both endogenous α-synuclein and PLCβ1, we modulated the amount of α-synuclein by down-regulating its expression through the use of siRNA. These cells showed little degradation of PLCβ1 after addition of calcium ionophore. However, when the concentration of α-synuclein was reduced, PLCβ1 was strongly degraded (Fig. 5B). Although other mechanisms besides calpain activity may underlie these results, the simplest explanation is that α-synuclein protects PLCβ1 from degradation at high intracellular calcium levels.

4. DISCUSSION

In this study, we have shown that α-synuclein can increase the cellular level of PLCβ through protection from degradation from enzymes such as μ-calpain. α-Synuclein has been the subject of many studies, however, its cellular function remains unclear. In cells, α-synuclein aggregation appears to be promoted by lipids and accumulation of ApoE, Aβ and components of the ubiquitin system (see [17],[4]). Interestingly, α-synuclein can reverse pathogenesis caused by deletion of a pre-synaptic chaperone protein [18]. Taken together, these studies suggest a link between α-synuclein function, lipid interactions and chaperone activity.

Several years ago, we found that α-synuclein can affect the signaling properties of PLCβ enzymes [6]. Since α-synuclein is highly expressed in neuronal lines, we focused this study mainly on PLCβ1 which has highest expression in these cell types [19]. We found that the presence of α-synuclein increases the level of PLCβ1 and that this stabilization does not appear to be due to changes in transcription or in ubitquitin-mediated degradation. Rather, we find that α-synuclein may be protecting PLCβ1 from degradation by proteases. While α-synuclein offers some protection from trypsin digestion, it is unlikely that this process contributes to the observed increase in PLCβ1 in the presence of α-synuclein since digestion by trypsin is lysosomes. However, proteolysis of PLCβ1 by calpain is very likely to be physiologically relevant, since it occurs in the cytosol and is calcium activated. Although regulation of PLCβ1 by calpain in neuronal cells has not yet been explored, calpain cleavage of PLCβ3 in human platelets appears to play an important role in platelet aggregation [20].

PLCβ enzymes are composed of a catalytic domain flanked by several regulatory domains that mediate G protein and membrane association (see [21]). These domains, along with a “lid” that can occlude the active catalytic site, appear inhibitory [22]. Therefore, it is not surprising that removal of the C-terminus by calapin results in a significant increase in enzyme activity. Assuming this increase in PLCβ activity results in a more pronounced release of intracellular Ca²⁺ that, in turn, promotes activation of μ-calpain, then this process can be thought of as a positive feedback loop.

Of the many members of the calpain family, two have been well-characterized: μ-calpain, which is activated at micromolar calcium levels or m-calpain, which is activated at millimolar calcium levels in vitro (for review see [16]). Although calpain targets Cys residues, it appears that specificity is dictated by structural elements as opposed to sequence. We find that calpain cleavage of rat PLCβ2 occurs at the end of its C2 domain at residue 753 with high efficiency. This site can be compared to that of human PLCβ1, for which cleavage by calpain has been reported to occur at residue 880 in the C-terminal domain [15]. The observation that calpain cleaves a Cys residue in the C2 domain of PLCβ2 suggests that it may target Cys residues in other C2 domains, especially in proteins involved in cytoskeletal assembly and disassembly, but this does not seem to be the case. While the higher efficiency of PLCβ2 cleavage by calpain in vitro is most likely due to the strong site at residue 753 as compared to PLCβ1, the lower efficiency in cells might result from endogenous α-synuclein, or factors that occlude the calpain site, such as basal interaction with Gα_q(GDP) [23].

Activation of PLCβ1 by Gα_q results in release of intracellular calcium and opening of calcium channels to raise intracellular calcium and promote activation of μ-calpain. Calpain cleavage of PLCβ1–3 results in enzymes that are detached from Gα_q mediated signals such as those triggered by epinephrine, serotonin and dopamine, thereby diminishing the potential for sustained calcium mobilization. The protection of PLCβ enzymes from calpain cleavage by α-synuclein in SK-N-SH cells show that α-synuclein may prevent uncoupling of PLCβ from G protein regulation and may also affect the cellular localization of the enzyme since Gα_q contacts are lost. This protection may play a prominent role in neuronal cells where both α-synuclein and PLCβ1 are expressed at high levels. It is notable that calpain-degraded PLCβ2–3 can still be activated by Gβγ subunits release by stimulation of any Gα family (see [24]).

Phage-display studies suggest that α-synuclein has many potential binding partners in cells, and we have found that PLCβ1–3 bind very strongly to this protein [6]. It is quite likely that α-synuclein has other cellular binding partners and it may similarly influence their regulation. While PLCβ1 and other α-synuclein binding partners are expected to stabilize α-synuclein structure, it is possible that their loss or their aggregation promotes α-synuclein aggregation and subsequent pathogenesis. In summary, by modulating the cellular levels of specific proteins, α-synuclein might promote particular signaling pathways and cellular events.

Abbreviations

PLCβ

phospholipase Cβ

FRET

Forster resonance energy transfer