Kinesin-2 family in vertebrate ciliogenesis

Abstract

The differentiation of cilia is mediated by kinesin-driven transport. As the function of kinesins in vertebrate ciliogenesis is poorly characterized, we decided to determine the role of kinesin-2 family motors—heterotrimeric kinesin-II and the homodimeric Kif17 kinesin—in zebrafish cilia. We report that kif17 is largely dispensable for ciliogenesis; kif17 homozygous mutant animals are viable and display subtle morphological defects of olfactory cilia only. In contrast to that, the kif3b gene, encoding a heterotrimeric kinesin subunit, is necessary for cilia differentiation in most tissues, although exceptions exist, and include photoreceptors and a subset of hair cells. Cilia of these cell types persist even in kif3b/kif17 double mutants. Although we have not observed a functional redundancy of kif3b and kif17, kif17 is able to substitute for kif3b in some cilia. In contrast to kif3b/kif17 double mutants, simultaneous interference with kif3b and kif3c leads to the complete loss of photoreceptor and hair cell cilia, revealing redundancy of function. This is in agreement with the idea that Kif3b and Kif3c motor subunits form complexes with Kif3a, but not with each other. Interestingly, kif3b mutant photoreceptor cilia differentiate with a delay, suggesting that kif3c, although redundant with kif3b at later stages of differentiation, is not active early in photoreceptor ciliogenesis. Consistent with that, the overexpression of kif3c in kif3b mutants rescues early photoreceptor cilia defects. These data reveal unexpected diversity of functional relationships between vertebrate ciliary kinesins, and show that the repertoire of kinesin motors changes in some cilia during their differentiation.

Cilia and flagella are thin elongated cell surface protrusions that perform diverse biological functions. Motile cilia or flagella of protozoans or sperm cells facilitate the movement of entire cells. In multicellular organisms, motile cilia drive fluid flow in the lumen of ducts and chambers such as kidney tubules or brain ventricles (1, 2). Apart from its ability to generate motion, the cilium is a separate subcellular compartment that features cell surface and cytoplasmic components. These characteristics provide basis for the ability of cilia to mediate signal transduction in a variety of contexts, including developmental signaling by the hedgehog or notch pathways, as well as sensory signal transduction.

As the cilium itself is devoid of protein synthesis, polypeptides that contribute to the structure and function of cilia are transported from the cell body. This transport, referred to as the intraflagellar transport (IFT), relies on the function of two types of plus-end directed motors that are members of the kinesin-2 family (3), named heterotrimeric kinesin-II and homodimeric OSM-3 or KIF17 (4–7). In the flagella of algae Chlamydomonas, mainly kinesin-II is thought to function in IFT (6). In Caenorhabditis elegans, subunits KLP-20, KLP-11, and KAP-1 form the single kinesin-II complex, which functions in parallel to homodimeric OSM-3 (8). Vertebrates, on the contrary, are thought to form two kinesin-II complexes (KIF3A/3B/KAP3 and KIF3A/3C/KAP3) in addition to homodimeric KIF17 (9, 10). Both kinesin-II and kif17 have been proposed to function in vertebrate ciliogenesis (11–13).

Given the diversity of cilia-mediated processes in vertebrate tissues, it appears that kinesins may function differently in cilia of different cells. The analysis of this issue is complicated, however, because kinesin-II mouse knock-outs (KOs) lead to midgestation lethality (12, 13). Consequently, conditional KOs of Kif3a have been performed in several organs, including kidney tubules, pancreas, and skin, and in all cases resulted in a loss of cilia, demonstrating that Kif3a is necessary for ciliogenesis (14–16). As the vertebrate photoreceptor outer segment is among the best characterized cilia-derived structures (17, 18), several studies focused on the role of kinesins in photoreceptor ciliogenesis. A conditional KO of Kif3a in photoreceptor cells revealed a role for the heterotrimeric kinesin II in the transport of opsin and arrestin, but not transducin or peripherin, suggesting the presence of multiple anterograde ciliary motor mechanisms (19). Rod and cone photoreceptors appear to have different requirements for motor proteins: following conditional KOs of Kif3a specifically in rods or in cones, rods degenerate much faster compared with cones (20). Given these results, it appears likely that multiple kinesins contribute to photoreceptor ciliogenesis.

Based on biochemical studies, Kif3a functions as a heterotrimeric complex, consisting of another motor subunit, either Kif3b or Kif3c, and an accessory protein, Kap3 (9, 10, 21). Similar to kif3a, the role of kif3b in different tissues is difficult to evaluate because homozygous mouse mutants die at midgestation, and few, if any, conditional KOs are available (13). The role of kif3c in ciliogenesis also remained obscure, as mouse KOs of this gene do not display any obvious phenotype (22, 23). The contribution of kif17 to vertebrate ciliogenesis is even less clear as its studies produced contradictory results (11, 24).

By using zebrafish as a model system, we show that vertebrate kif3b and kif17 kinesins are required for the formation of different subsets of cilia. Although the loss of kif3b function affects the majority of cilia, cone photoreceptor cilia and a subset of kinocilia in the otic vesicle do not require kif3b function. In contrast to that, among tissues analyzed so far, kif17 function is confined to the morphogenesis of olfactory cilia. Consistent with biochemical studies, kif3b acts redundantly with kif3c in photoreceptor and some hair cell cilia. Interestingly, the repertoire of kinesins that function in photoreceptor cilia changes during development; whereas kif3b alone appears to drive ciliogenesis early on, kif3b and kif3c function redundantly at later stages of differentiation.

Results

jj203 Mutant Embryos Display Cilia Defects.

We identified the jj203 mutant strain following N-ethyl-N-nitrosourea (ENU) mutagenesis. The most obvious external phenotype of jj203 is curved body axis (Fig. 1B). As such a phenotype is characteristic of cilia mutants (25, 26), we investigated ciliogenesis in jj203. The zebrafish embryo and larva feature a number of well characterized ciliated organs (27). Similar to defects in ovl and elipsa loci, which affect IFT particle components, the jj203 mutation results in a shortening or absence of cilia in the olfactory pit (Fig. 1 C and C′), ear macula (Fig. 1 D and D′), lateral line neuromasts (Fig. 1 E and E′), and pronephros (Fig. 1 F and F′). In the Kupffer's vesicle, however, we do not see any obvious cilia defects, possibly because of the presence of maternal contribution (Fig. S1). These observations indicate that the jj203 locus plays a role in ciliogenesis.

Fig. 1.

The jj203 mutant locus encodes the kif3b kinesin subunit. (A) Positional cloning of jj203 mutant locus. Top: Map of the jj203 genomic region and exon/intron structure of the kif3b transcript. Middle: Sequence of the jj203 transcript in WT and mutant animals. Bottom: Approximate diagram of Kif3b protein domain structure. Arrow indicates the site of the stop codon in the jj203 mutant allele. (B) The external phenotype of WT (Upper) and jj203 mutant (Lower) larvae at 5 dpf. (C–F′) Confocal images of WT (C, D, E, and F) and jj203 mutant (C′, D′, E′, and F′) larvae immunostained to visualize ciliogenesis in olfactory epithelium (C and C′), auditory maculae (D and D′), lateral line neuromasts (E and E′), and kidney tubules (F and F′) at 2 dpf (C and C′) or 3 dpf (D–F′). C–E′ show images of whole animals; F and F′ show transverse cryosections. (G–H′) Confocal images of olfactory pits (G and G′) and lateral line neuromasts (H and H’) in zebrafish larvae treated with anti-kif3b or with a control (CMO) antisense morpholino as indicated. (I and I′) Confocal images of anterior auditory maculae in jj203 mutants following overexpression of GFP (I) or kif3b (I′) mRNA. Larvae in C–I′ were stained with anti-acetylated tubulin antibodies (in green) and in some cases counterstained with phalloidin to visualize actin (red). Images in G–I′ were collected at 3 dpf. Arrows in C–I′ indicate cilia.

jj203 Encodes Kif3b Subunit of Heterotrimeric Kinesin II.

To determine the molecular nature of the jj203 locus, we performed positional cloning (Fig. 1A). This effort revealed a single nucleotide substitution (nucleotide 1,105, C to T) in the second exon of the kif3b gene, which introduces a nonsense codon in the place of a glutamine at the position 369 of the polypeptide (Fig. 1A). The truncated mutant protein lacks the coiled-coil stalk domain and the C-terminal tail domain (Fig. 1A). To confirm that defects in the kif3b gene are responsible for the jj203 phenotype, we performed a knockdown with two morpholinos targeted against this gene. This treatment produces a curly body axis phenotype by 3 d postfertilization (dpf), which closely resembles that of jj203 mutant larvae [88% (n = 87) vs. 2% (n = 85) in control morpholino-treated animals]. Cilia length in the olfactory placode and lateral line neuromasts is also obviously shorter in morphant animals (Fig. 1 G–H′). In a complementary experiment, we overexpressed the kif3b mRNA in embryos from crosses between jj203 heterozygotes. This treatment rescues ciliogenesis in the ear of homozygous mutant embryos (n = 7 of 7 vs. 0 of 3 in embryos treated with control GFP mRNA; Fig. 1 I and I′). Taken together, these data demonstrate that a defect in the kif3b gene is responsible for the jj203 phenotype.

kif3b Function Is Not Required in a Subset of Cilia.

Vertebrate photoreceptor cells feature highly differentiated cilia, known as outer segments (17, 18). Loss of IFT genes, such as oval/ift88, leads to outer segment absence (25, 28). At 3 dpf, antibody staining reveals ciliary axoneme at the base of the outer segment in WT animals but not in kif3b^jj203 larvae (Fig. 2A′ vs. 2A). By 5 dpf, however, connecting cilia form in mutants, although they are shorter than the WT ones (Fig. 2B′ vs. 2B; graph in Fig. 2F). Ultrastructural analysis revealed that, at 3 dpf, no outer segments are found in kif3b^jj203 retinae (Fig. 2 C and C′). By 5 dpf, however, outer segments also form in kif3b^jj203 mutants (Fig. 2 D and D′). Mutant and WT outer segments feature similar microtubule organization, including the presence of microtubule singlets at 6 dpf (Fig. 2 E and E′). Nonetheless, outer segments of some mutant photoreceptors are abnormally shaped or broken. These observations suggest that the kif3b^jj203 locus plays a particularly prominent role in the initiation of outer segment formation, whereas another motor contributes to outer segment differentiation in parallel to kif3b at later stages.

Fig. 2.

A subset of cilia differentiate in kif3b mutant embryos. (A, A′, B, and B′) Transverse cryosections through the photoreceptor cell layer (bracket) in WT (A and B) and jj203 mutant (A′ and B′) embryos stained with anti-acetylated tubulin antibody (red) at 3 dpf (A and A′) and 5 dpf (B and B′). (C and D′) EM images of sections through WT (C and D) and jj203 mutant (C′ and D′) photoreceptor cells at 3 dpf (C and C′) and 5 dpf (D and D′). (E and E′) EM images of sections perpendicular to outer segment (OS) microtubules in WT (E) and mutant (E′) photoreceptors. Arrows point to microtubule singlets. Enlargements are shown to the right: mutant (Upper) and WT (Lower). (F) The length of the connecting cilium in WT (blue bars) and mutant (red bars) retinae expressed as the percentage of WT length at 7 dpf. Measurements were performed on confocal images of transverse cryosections stained with anti-acetylated tubulin antibody. Data were collected at 3, 3.5, 4, and 7 dpf as indicated. Sample sizes (number of retinae/number of cilia) are provided. (G and G′) Confocal images of cilia in ear cristae of WT (G) or mutant (G′) embryos stained with anti-acetylated tubulin antibody (in green) and counterstained with phalloidin (in red) at 7 dpf.

Although we determined that cilia are missing in ear maculae of kif3b^jj203 mutants by 3 dpf, the staining of ear of cristae cilia is normal even as late as at 7 dpf (Fig. 2 G and G′). Although we cannot exclude minor defects in the structure of crista cilia, these results indicate that mechanisms of cilia formation are different in maculae and cristae, and that kif3b is not required for the differentiation of cristae cilia at least during the first 7 d of development.

The presence of outer segments in kif3b^jj203 mutants suggests that opsin is transported fairly normally in mutant photoreceptors. To evaluate opsin transport efficiency, we expressed GFP–Opsin–CT44 fusion gene under the control of a heat shock promoter in kif3b^jj203 mutants as described previously (29) (Fig. S1). Heat shock was applied at 5 dpf to eliminate the contribution of rods, which degenerate almost completely by that time (Fig. S2). Larvae were collected at 4, 9, and 24 h after heat shock, and GFP intensity was measured in the photoreceptor cell body. Four hours after heat shock, GFP intensity is much higher in cell bodies of mutant photoreceptors compared with cells in the WT (Fig. S1 D and E). This result indicates that kif3b contributes to opsin transport. Importantly, we found that GFP–opsin fusion is cleared from the cell body by 9 h after heat shock even in the absence of kif3b function (Fig. S1), indicating that another motor mechanism transports opsin in parallel to the kif3b kinesin complex. The persistence of some cilia in kif3b mutant homozygotes is surprising given that kif3a KOs in the mouse result in the absence of cilia (14–16).

kif3b Functions Differently in Rods and Cones.

To assess the ciliary phenotype in photoreceptors of kif3b^jj203 mutant animals further, we carried out whole-mount in situ hybridization using probes to genes specifically expressed in cones or rods. The expression of cone-specific genes, such as cone transducin, cone arrestin, or cone opsins, is normal in kif3b^jj203 animals. On the contrary, the expression of rod-specific genes, such as rod transducin and rod opsin, dramatically decreases in kif3b^jj203 mutants by 5 dpf (Fig. S2) as a result of cell death (Fig. S3). However, rod opsin expression is normal at 3 dpf (Fig. S2A). These results were confirmed by using antibody staining to opsins and the rod-specific Nr2e3 transcription factor (Fig. S2D). Similar to WT cells, cone opsins localize mainly to outer segments of mutant photoreceptors. These data suggest that rod photoreceptors degenerate in mutants between 3 and 5 dpf. In contrast to that, cone photoreceptors survive longer and frequently feature grossly normal outer segments.

kif17 Plays a Minor Role in Ciliogenesis.

The formation of C. elegans cilia involves the function of the homodimeric osm-3 kinesin (30–32). To determine whether this kinesin functions in vertebrate ciliogenesis, perhaps redundantly with the heterotrimeric kinesin II, we investigated mutant phenotypes of its vertebrate orthologue, kif17. We studied a chemically induced mutant allele, kif17^sa0119, which contains a stop codon at position 551 (Fig. 3A). The resulting truncated Kif17 protein lacks 271 C-terminal amino acids. Several lines of evidence suggest that this mutation results in a null or a near-null phenotype. First, it eliminates several highly conserved sequences in the C terminus of the Kif17 protein. Second, the C-terminal region of this polypeptide is involved in cargo interactions (33, 34). Third, this mutation results in a nonsense-mediated decay that severely reduces the kif17 transcript expression (Fig. 3B). Finally, morpholino knockdown of kif17 function in kif17^sa0119 mutant homozygotes does not result in any obvious enhancement of cilia defects (Fig. S4B). kif17^sa0119 mutant homozygotes do not display any obvious external phenotype (Fig. 3 C and C′) and survive to adulthood. Immunostaining did not reveal any ciliogenesis defects in the ear, the retina, the spinal cord, or the pronephric duct of mutant homozygotes (Fig. 3D and Fig. S4). However, the nasal cilia were somewhat shorter at 7 dpf (P < 0.001; Fig. 3 D and E), and 8 dpf (P < 0.01; n ≥ 10 for WT and mutant). In contrast to nematode osm-3 mutant phenotype (30), singlet microtubules persist in nasal cilia of kif17 mutants (Fig. 3D), which continue to be motile (Movies S1 and S2). Antibody staining did not reveal rod opsin or green cone opsin mislocalization in mutant retinae at 5 dpf (Fig. S4). Similarly, we did not observe obvious morphological defects or opsin mislocalization in the retinae of adult mutant homozygotes (Fig. 3F). As kif17 may not be required for opsin localization and may only contribute to its transport, we applied GFP–opsin transient overexpression assay at 4 dpf (Fig. S1). Opsin transport is not affected in this test (Fig. 3G). These results indicate that the kif17 kinesin plays a minor role in cilia formation, and does not contribute to the transport of opsin, the most abundant cargo in photoreceptor cilia.

Fig. 3.

kif17 mutant phenotype. (A) Upper: Sequences of WT and kif17^sa0119 mutant allele. Lower: Diagram of the Kif17 protein. Arrow indicates the site of the stop codon. (B) Upper: Quantitative RT-PCR. Expression level relative to WT is provided. Data were normalized for actin expression (P < 0.05). Lower: RT-PCR amplification of the kif17 transcript in WT and mutant embryos at 5 dpf. (C and C′) External phenotype of WT (C) and kif17^sa0119 (C′) larvae at 7 dpf. (D) Confocal and ultrastructural analysis of cilia in WT and kif17^sa0119 mutants. Larvae were stained with anti-acetylated tubulin antibody to visualize cilia in the nasal pit (a and d) and ear cristae (b and e). c and f, Ultrathin sections perpendicular to the distal tips of olfactory cilia in WT and mutant, respectively. (E) Graph showing the length distribution of nasal cilia in WT and kif17^sa0119 mutants at 7 dpf. Each dot represents the average cilia length measured in a single individual. “n” is the number of individuals analyzed (P ≤ 0.001). (F) Confocal images of transverse cryosections through the retina of adult WT (a and c) and kif17 homozygous mutant (b and d) individuals stained with Zpr-1 (a and b) or anti-rod opsin (c and d) antibodies (green) and counterstained with phalloidin (red). Arrowheads indicate the outer limiting membrane, asterisks the outer plexiform layer. (G) Measurement of opsin transport efficiency from the inner to the outer segment in WT and kif17^sa0119 mutant animals at 4 dpf. The intensity of GFP–opsin signal in the cell body is measured at 4, 9, and 24 h after heat shock. For each data point, 15 to 20 retinae, and 30 to 36 photoreceptors were analyzed. This experiment was performed as published (29) and illustrated in Fig. S1 (*P < 0.05; **P < 0.001).

kif17 Can Substitute for Loss of kif3 Function in Some Cilia.

Given that kif3 and kif17 function redundantly in C. elegans, we tested whether they are functionally interchangeable in a vertebrate. We injected kif17 mRNA into embryos from crosses between two kif3b^jj203 heterozygotes, and found a significant decrease in the frequency of severe curly body phenotype. Four percent (n = 433) of embryos displayed this phenotype, compared with 18% (n = 348) in GFP mRNA-treated controls. Immunostaining revealed that spinal canal cilia but not nasal cilia were rescued at 3 dpf in mutant embryos treated with kif17 mRNA (Fig. S5). We did not observe rescue in control kif3b^jj203 embryos treated with GFP mRNA. These results indicate that kif17 kinesin can substitute for kif3b function to drive ciliogenesis in some tissues.

kif3b;kif17 Double Mutant.

The persistence of cilia in kif3b mutants suggested that kif3 and kif17 may function redundantly. To test this idea, we investigated the phenotype of kif17^sa0119/kif17^sa0119;kif3b^jj203/kif3b^jj203 double homozygotes. Staining with anti-green opsin antibodies in double mutants did not reveal obvious mislocalization of this visual pigment (Fig. 4 A and A′). Similarly, in the absence of both kinesins, cilia of auditory cristae differentiate normally and display normal length (Fig. 4 B, B′, and C). These results indicate that neither kif3b nor kif17 is required for ciliogenesis in cone photoreceptors and in a subset of hair cells. Moreover, unless the third parallel motor mechanism is involved, these two kinesins do not function redundantly in the cilia of these cells.

Fig. 4.

kif3c function in ciliogenesis. (A and A′) Confocal images of transverse cryosections through the retina stained with Zpr-1 (to visualize double cones; green), and anti-green opsin antibodies (red). (B and B′) Confocal images of lateral cristae in whole animals stained with anti-acetylated tubulin antibody to visualize kinocilia (green) and counterstained with phalloidin (red). WT and kif3b^jj203−/−;kif17^{sa0119−/−} double mutant animals were analyzed as indicated. (C) Cilia length in WT, mutant, and double mutant cristae as indicated. The average WT length is set at 100%. “n” is the number of individuals analyzed. (D) A schematic drawing of the exon/intron structure for the kif3c and kif3c-like genes. Morpholino-targeted exons are in color. Target sites are indicated as red horizontal bars. (E) Confocal images of lateral cristae in whole animals stained as in B. The number of individuals tested that differentiate cilia is indicated in lower left corner of each panel. (F) Confocal images of transverse cryosections through the retina stained with an anti-acetylated tubulin antibody to visualize cilia (arrows). For E and F, genotypes are indicated below. Brackets indicate the photoreceptor cell layer, arrowheads the outer limiting membrane. (G) The frequency of photoreceptor cilia at 4 dpf in different mutant/morphant backgrounds as indicated. (H) The frequency of photoreceptor cilia in kif3b^−/− mutant homozygotes at 3 dpf, following rescue with kif3c or control GFP mRNA. In G and H, each dot represents the number of cilia per an arbitrary segment of the photoreceptor cell layer in a single retina. (I and I′) Confocal images of photoreceptor cilia (arrows) at 3 dpf visualized as in F. (J) Relative sizes of apical opsin-positive compartments (presumably outer segments) in kif3b^jj203 homozygous mutant and phenotypically WT animals treated with kif3c or control GFP mRNA. Each dot represents the total size of apical opsin-positive domains on a single section through the retina, adjusted for the length of the photoreceptor cell layer. The average WT size equals 100%. (K) Efficiency of GFP–opsin transport in kif3c morphants measured as in Fig. S1. “n” is the number of photoreceptors analyzed. A minimum of 30 sections from six retinae were used to calculate each data point. In G, H, and J, “n” is the number of retinae analyzed. In all images, apical direction is up (*P < 0.05; **P < 0.001).

kif3b and kif3c Display Redundant Functions.

The Kif3c kinesin subunit is thought to form complexes with Kif3a (9, 10). Although the mouse Kif3c protein appears to be absent from the photoreceptor cell layer (10, 22, 23), we considered the possibility that the zebrafish kif3c functions redundantly with kif3b. The zebrafish has two kif3c-related genes, which we will refer to as kif3c and kif3c-like (Fig. 4D and Fig. S6). To block their expression, we designed anti-splice site morpholinos and verified their efficiency by real-time-PCR (Fig. S7). We tested the idea that in the absence of kif3b, these kinesins may be necessary for the formation of cilia in cristae and in photoreceptor cells. This turned out to be the case: although neither kif3c nor kif3c-like morphants display cilia defects, simultaneous morpholino knockdown of kif3c and kif3c-like in kif3b^jj203 mutants results in a loss of cristae and photoreceptor cilia (Fig. 4 E and F; graph in Fig. 4G). Subsequent single knockdowns of kif3c or kif3c-like revealed that kif3c, but not kif3c-like, functions redundantly with kif3b (P < 0.0001; Fig. 4G).

Developmental Changes in Kinesin Repertoire.

The redundancy of kif3c and kif3b function becomes obvious only at 4 dpf after photoreceptor cilia are formed in kif3b mutants, suggesting that kif3c does not function during early stages of ciliogenesis. GFP–opsin transient overexpression assay in kif3c morphants at 3 dpf did not reveal significant differences in opsin transport efficiency between kif3c and control morphants at 3 dpf (Fig. 4K), indicating that, consistent with the kif3b phenotype, kif3c does not contribute to this process at this stage. By 5 dpf, however, GFP-opsin transport was somewhat slower in kif3c morphants compared with control animals (P < 0.05; Fig. 4K). To further test the idea that the absence of cilia at the early stages of photoreceptor differentiation in kif3b mutants is caused by the absence of kif3c function, we overexpressed kif3c mRNA in kif3b^jj203 mutant homozygotes. This treatment resulted in a significant rescue of body curvature (13% vs. 23% following kif3c and GFP RNA injections, respectively; n = 520 and 261, respectively) and cilia differentiation in kif3b^jj203 mutants at 3 dpf (P < 0.001; Fig. 4 H, I, and I′) and 4 dpf (P < 0.001; Fig. S8B). Finally, this treatment increased opsin accumulation at the apical terminus of the photoreceptor cell, a phenotype that most likely reflects outer segment formation (P < 0.001; Fig. 4J and Fig. S8A). An incomplete rescue is most likely a result of limited stability of injected mRNA. Based on these results, we propose that the functional repertoire of ciliary kinesins undergoes a developmental change during photoreceptor differentiation: whereas only kif3b drives cilia formation early on, kif3b and kif3c perform this function at later stages. The significance of this developmental change is not clear, but it may facilitate the transport of the massive amount of cargo that needs to be moved from the cell body into the outer segment.

Discussion

Experiments presented in this work reveal that kif3b and kif17, the two kinesins known to play major roles in nematode ciliogenesis, display very different contributions to the formation of vertebrate cilia. In C. elegans, the homodimeric kif17/osm-3 kinesin is required for the differentiation of distal microtubule singlets of amphidial channel cilia (30). In addition, in this set of cilia, and in the cilia of AWC cells, the homodimeric and the heterotrimeric kinesin function redundantly. In contrast to channel cilia, kif17/osm-3 is not required for the differentiation of distal singlets in neighboring AWB amphidial cilia, although the two kinesins still function redundantly (35). Functional interactions between kinesins are even more complex in the cephalic male cilia (32). Our data reveal that diverse functional relationships also exist between vertebrate ciliary kinesins (Fig. S9).

A limited role for kif17 in zebrafish ciliogenesis, especially in double mutants with kif3b, is surprising, given the prominent function of this kinesin in C. elegans cilia (31, 36). In vertebrates, the function of kif17 has been studied in tissue culture as well as in mouse and zebrafish models. Tissue culture studies provided evidence that kif17 is necessary for the transport of a cyclic nucleotide-gated channel subunit but not for the elongation of cilia (37), whereas the mouse KO analysis revealed a role in learning and memory (24). Our studies demonstrate a function for kif17 in the morphogenesis of a subset of vertebrate cilia. However, the role of kif17 is surprisingly limited. Combined with previous studies, our data indicate that kif17 functions in the transport of structural and signaling components in a limited subset of cilia.

The results of our analysis are in agreement with reports that kif3c KO mice are viable and do not display photoreceptor defects (22, 23). However, a redundancy of kif3c/kif3b function in photoreceptor cells is surprising in light of previous reports that kif3c is primarily expressed in ganglion cell axons and in amacrine cells (9, 10). The same studies reported that Kif3c is structurally related to Kif3b and, similar to Kif3b, associates with Kif3a, which suggests that Kif3b and Kif3c proteins may function redundantly as alternative binding partners of Kif3a. Although redundancy of kif3b and kif3c function has been hypothesized (9, 22), to our knowledge, this is the first study to demonstrate that it actually exists. In the ear, this redundancy is limited to cilia in a subset of auditory hair cells. Hair cells that display the redundancy of function are very similar to those that do not. This may be a result of somewhat different cargo requirements. Cilia of hair cells in cristae are particularly long, so they may require a more robust transport compared with neighboring cells in ear maculae. Similarly, somewhat different cargo molecules are transported in rod and cone cilia, which may account for differences of kif3b^jj203 phenotype in these two cell types (18, 38). Further biochemical analysis as well as in vivo imaging of IFT movement will be necessary to fully understand the diversity of kinesin functions in cilia.

Interestingly, cilia formation in photoreceptor cells is initially driven by kif3b only. At later stages, kif3c also contributes to ciliogenesis in this cell type and is largely sufficient to drive the differentiation of outer segments. This, to our knowledge, is the first example of a developmental change in the repertoire of ciliary kinesins during differentiation of a single cell type. The outer segments of kif3b mutant homozygotes, although relatively robust, do not appear to be entirely normal. It remains to be investigated whether this results from quantitative differences in kinesin expression, or reflects differences in cargo specificity between Kif3c and Kif3b kinesins.

Materials and Methods

Animals.

Zebrafish strains were maintained following the standard protocols approved by the Tufts University Animal Care Committee.

Genetic Screen.

ENU mutagenesis was performed as described (39). To enhance our ability to identify subtle photoreceptor defects, we crossed a transgene that expresses GFP in rod photoreceptors into ENU-mutagenized animals. Mutants were identified in the F2 generation by using the early pressure screening approach (40).

Knockdown and Rescue Experiments.

Morpholino knockdowns and rescue experiments were performed as described previously (25, 26). During rescue experiments, embryos were genotyped by sequencing. The following morpholinos were used: kif3c-like, GACGTACTTGAATTTCATCTCTCTT; kif3c, TCAGTCCTCA GACACATACC TTAAA; kif3b (ATG), AGCTCTTGCT TTTAGACATT TTGAC; kif3b (SP), AGCTTGAAGT TTCTAACCTT AACT; and kif17 (SP) the same as in the study of Insinna et al. (11): TTGTAAACTG GTTACCTGGA TTGTC. Knockdown efficiency was confirmed by using the following RT-PCR primers: for kif3c, ATCCGCGACCTGCTCACCAAAG and CAGTGATGATGAAGATGGCGTGAG; for kif3c-like, AACGAGGGATGCTGGCGAAAGA and TGGTCTCTTCATCTTGTTCA.

Immunohistochemistry.

Sectioning and immunohistochemistry were performed by using standard protocols (27). The following antibodies were used: anti-acetylated α-tubulin (1:500; Sigma), zpr3 (1:1,000; Zebrafish International Resource Center), zpr1 (1:250; Zebrafish International Resource Center), anti–γ-tubulin (1:500; Sigma), anti-green opsin (gift from Thomas Vihtelic), and anti-Nr2e3 (gift from Jeremy Nathans).

Opsin Transport Analysis.

Opsin transport was analyzed as described previously (29). GFP–opsin fusion construct was injected into kif17 or kif3b mutant homozygotes or, alternatively, injected together with anti-kif3c morpholinos into WT embryos.

Quantitative PCR.

kif17 transcripts were amplified from 5-d-old WT or kif17 homozygous mutant larvae. β-actin was used as an internal reference control. Analysis was performed by using Qiagen SYBR Green PCR Kit on a Stratagene MX3000 cycler with the following settings: 95 °C for 30 s, 57 °C for 1 min, and 72 °C for 1 min for 40 cycles. The data were collected from three independent experiments (each in triplicate). The relative expression level of kif17 transcripts in WT and mutant larvae were analyzed with Qiagen REST 2009 software. The following primers were used for amplification: kif17 forward, GCTTCACAAGAACAGGCTAAG; kif17 reverse, CATCTCAAACTCTGCCTGTAG; β-actin forward, ATGGATGATGAAATTGCCGCAC; and β-actin reverse, ACCATCACCAGAGTCCATCACG.

Videomicroscopy and Image Analysis.

To image nasal cilia movement, larvae were embedded head down in 1% agarose on a glass bottom dish and filmed using a QuantEM 512SC camera and a 63× water immersion lens on a Zeiss Axio Observer Z1 inverted microscope. To evaluate ciliogenesis in the photoreceptor cell layer, cilia were counted relative to the length of the outer limiting membrane on each confocal image. For the analysis of rod opsin distribution, the areas of apical rod opsin accumulation were selected with the wand tool (tolerance of 20), and their sizes were calculated by using ImageJ software (National Institutes of Health).