Abstract
The antibiotic susceptibility rates of 363 clinical Bacteroides fragilis group isolates collected from 17 centers in Argentina during the period from 2006 to 2009 were as follows: piperacillin-tazobactam, 99%; ampicillin-sulbactam, 92%; cefoxitin, 72%; tigecycline, 100%; moxifloxacin, 91%; and clindamycin, 52%. No metronidazole resistance was detected in these isolates during this time period. Resistance to imipenem, doripenem, and ertapenem was observed in 1.1%, 1.6%, and 2.3% of B. fragilis group strains, respectively. B. fragilis species showed a resistance profile of 1.5% to imipenem, 1.9% to doripenem, and 2.4% to ertapenem. This is the first report of carbapenem resistance in Argentina. The cfiA gene was present in 8 out of 23 isolates, all of them belonging to the B. fragilis species and displaying reduced susceptibility or resistance to carbapenems (MICs ≥ 4 μg/ml). Three out of eight cfiA-positive isolates were fully resistant to carbapenems, while 5 out of 8 isolates showed low-level resistance (MICs, 4 to 8 μg/ml). The inhibition by EDTA was a good predictor of the presence of metallo-β-lactamases in the fully resistant B. fragilis strains, but discrepant results were observed for low-level resistant isolates. B. fragilis was more susceptible to antimicrobial agents than other Bacteroides species. Bacteroides vulgatus species was the most resistant to ampicillin-sulbactam and piperacillin-tazobactam, and B. thetaiotaomicron/ovatus strains showed the highest level of resistance to carbapenems, with an unknown resistance mechanism. B. vulgatus and the uncommon non-Bacteroides fragilis species were the most resistant to moxifloxacin, showing an overall resistance rate of 15.1%.
INTRODUCTION
The increasing resistance to antimicrobial agents among anaerobic bacteria has become a global problem in the past 2 decades, particularly within the species that make up the Bacteroides fragilis group, the most frequently isolated species in clinical infections, in which resistance to metronidazole, carbapenems, and β-lactam–β-lactamase inhibitor combinations has been reported (14–16, 29).
Antimicrobial susceptibility testing has been recommended only in particular clinical situations and microorganisms (6). Antimicrobial resistance rates vary in different countries and also among the different medical centers within the same country (2, 15, 20). Therefore, both periodic local and national susceptibility studies and the evaluation of new therapeutic agents are necessary to provide data for an appropriate empirical antimicrobial therapy (18).
In Argentina, the Subcomisión de Bacterias Anaerobias de la Asociación Argentina de Microbiología (SADEBAC-AAM) conducts regular monitoring and surveillance of these bacteria. The results of the first national survey of antibiotic susceptibility in the B. fragilis group are reported here.
(This study was presented in part at the 50th Interscience Conference on Antimicrobial Agents and Chemotherapy in Boston, MA, September 2010.)
MATERIALS AND METHODS
Bacterial isolates.
Between 2006 and 2009, a total of 363 nonduplicate clinical isolates belonging to the B. fragilis group were collected from 17 centers in Argentina. The isolates collected from centers in Ciudad Autónoma de Buenos Aires, Argentina, were from the Hospital General de Agudos Dr. E. Tornú (77 isolates), Hospital Nacional de Pediatría Prof. Dr. J. P. Garrahan (70 isolates), Hospital Alemán (69 isolates), Instituto de Investigaciones Médicas Alfredo Lanari-UBA (22 isolates), Hospital de Infecciosas F. J. Muñiz (22 isolates), Sanatorio Mitre (7 isolates), Hospital Dr. P. Piñero (5 isolates), and Sanatorio Mater Dei (2 isolates). In Córdoba, the isolates were from Clínica Reina Fabiola (25 isolates), Hospital Nacional de Clínicas (14 isolates), and Clínica Privada de Río Cuarto (2 isolates). Twenty-one isolates were from the Hospital Dr. J. C. Perrando, Resistencia, in Chaco. Ten isolates were from the Hospital Provincial de Neuquén in Neuquén (10 isolates), and nine isolates were from the HIGA Dr. A Piñero, Junin, in Buenos Aires Province. Two isolates were from the Hospital Eva Perón in San Martín, five isolates were from the Clínica Regional Privada, San Genaro, in Santa Fe, and one isolate was from the Hospital Central Mendoza in Mendoza.
The isolates were recovered from the abdomen (58%), genital tract (13%), blood (12%), skin and soft tissues (8.5%), as well as from other body sites (8%).
The species distribution of the isolates was as follows. A total of 198 isolates were Bacteroides fragilis, 69 were Bacteroides thetaiotaomicron/ovatus, 30 were Bacteroides caccae, and 27 were Bacteroides vulgatus. Thirty-nine isolates were less frequently isolated species. Of the 39 isolates, 7 were Parabacteroides (Bacteroides) distasonis, 7 were Bacteroides uniformis, 7 were Bacteroides stercoris, and 2 were Bacteroides merdae, and 16 isolates of the Bacteroides fragilis group could not be fully identified to the species level (Bacteroides spp.). The isolates were stored at −70°C in glycerol broth and subcultured onto sheep blood brucella agar for further testing.
Antimicrobial agents.
Standard powders of ampicillin, sulbactam, piperacillin, tazobactam, cefoxitin, imipenem, clindamycin, metronidazole, and moxifloxacin antibiotics were kindly supplied by INEI-ANLIS Dr. Carlos G. Malbrán, Argentina. Ertapenem was provided by Merck & Co, West Point, PA. Doripenem was provided by Janssen-Cilag, Argentina, and tigecycline was provided by Wyeth Pharmaceutical, Argentina.
Antimicrobial susceptibility testing.
MICs were determined according to the reference agar dilution method of the Clinical and Laboratory Standards Institute (CLSI Document M11-A7) (6) with brucella agar supplemented with 5 μg/ml hemin, 1 μg/ml vitamin K, and 5% laked sheep blood. Agar dilution test plates were inoculated with approximately 105 CFU/spot using a Steers multipoint replicator and incubated at 37°C for 48 h in an anaerobic chamber.
The MIC was defined as the lowest concentration of an antimicrobial agent that will markedly reduce growth occurring on the test plate compared with the anaerobic control plate. Reference strains B. fragilis ATCC 25285 and B. thetaiotaomicron ATCC 29741 were used as controls. Results were recorded only when the MICs corresponding to the control organisms were within the range specified by the CLSI. The breakpoints recommended by the CLSI in CLSI Document M11-A7 (6) were used for most antibiotics. The breakpoints established by the CLSI for carbapenems (imipenem and ertapenem) were used for doripenem, and the breakpoints recommended by the Food and Drug Administration (FDA) were used for tigecycline, as there are no published susceptibility criteria recommendations for this drug (Tygacil package insert; Wyeth Pharmaceuticals). In this study, those isolates displaying carbapenem MICs of 4 μg/ml (susceptible) or 8 μg/ml (intermediate) were considered to have decreased susceptibility.
Phenotypic screening for MBLs.
Inhibition of metallo-β-lactamases (MBLs) by EDTA was evaluated in those isolates that displayed decreased susceptibility or resistance to carbapenems. A reduction of at least 3 dilutions of the MIC of imipenem in the presence of 0.4 mM EDTA with respect to the MIC of imipenem alone was considered positive.
Detection of the cfiA gene.
PCR amplification for detection of the cfiA gene was performed in those isolates that displayed resistance or decreased susceptibility to carbapenems, using the following primers (5′-3′) described by Kato et al. (13): GBI-1 (CCCAACTCTCGGACAAAAGTG) and GBI-2 (AGTGAATCGGTGAATCCATG). Total DNA was obtained by the boiling method. PCR amplification was run for 30 cycles, with 1 cycle consisting of 1 min at 95°C and 1 min at 57°C. Twenty-two isolates with carbapenem MICs of ≤2 μg/ml were also included.
RESULTS
Antimicrobial susceptibilities of all isolates expressed as MIC range, MIC50, MIC90, and percentage of susceptibility are summarized in Table 1.
Table 1.
In vitro activity of 10 antimicrobial agents against 363 isolates of the Bacteroides fragilis group
| Organism (no. of isolates) and antimicrobial agent(s) | MIC (μg/ml) |
% of isolates with the indicated susceptibility: |
||||
|---|---|---|---|---|---|---|
| Range | 50% | 90% | Susceptible | Intermediate | Resistant | |
| Bacteroides fragilis (198) | ||||||
| Ampicillin-sulbactam | 0.125–128 | 1 | 8 | 97.0 | 1.5 | 1.5 |
| Piperacillin-tazobactam | ≤0.03–>512 | 0.25 | 2 | 98.5 | 0.0 | 1.5 |
| Cefoxitin | 1–256 | 16 | 32 | 82.8 | 11.1 | 6.1 |
| Ertapenem (126) | 0.06–>64 | 0.25 | 4 | 96.0 | 1.6 | 2.4 |
| Imipenem | ≤0.015–>64 | 0.125 | 0.5 | 98.5 | 0.0 | 1.5 |
| Doripenem (159) | 0.03–>64 | 0.25 | 1 | 97.5 | 0.6 | 1.9 |
| Clindamycin | ≤0.125–>256 | 1 | >256 | 74.7 | 2.5 | 22.7 |
| Metronidazole | ≤0.06–4 | 0.5 | 1 | 100.0 | 0.0 | 0.0 |
| Moxifloxacin | 0.06–64 | 0.5 | 2 | 89.9 | 2.0 | 8.1 |
| Tigecycline | ≤0.03–4 | 0.125 | 1 | 100 | 0.0 | 0.0 |
| Bacteroides thetaiotaomicron/ovatus (69) | ||||||
| Ampicillin-sulbactam | 0.5–32 | 0.5 | 1 | 87.0 | 8.7 | 4.3 |
| Piperacillin-tazobactam | ≤0.03–64 | ≤0.03 | 4 | 98.6 | 1.4 | 0.0 |
| Cefoxitin | 4–128 | 4 | 32 | 49.3 | 27.5 | 23.2 |
| Ertapenem (49) | 0.125–>64 | 0.12 | 1 | 89.8 | 4.1 | 4.1 |
| Imipenem | ≤0.015–16 | ≤0.015 | 0.125 | 98.6 | 0.0 | 1.4 |
| Doripenem (58) | 0.125–64 | 0.125 | 0.25 | 96.6 | 0.0 | 3.4 |
| Clindamycin | ≤0.125–>256 | ≤0.125 | 4 | 42.0 | 18.8 | 39.1 |
| Metronidazole | ≤0.06–2 | ≤0.06 | 0.5 | 100.0 | 0.0 | 0.0 |
| Moxifloxacin | 0.125–64 | 0.125 | 1 | 89.9 | 2.9 | 7.2 |
| Tigecycline | ≤0.03–2 | ≤0.03 | 0.125 | 100.0 | 0.0 | 0.0 |
| Bacteroides caccae (30) | ||||||
| Ampicillin-sulbactam | 0.5–16 | 1 | 4 | 90 | 10 | 0 |
| Piperacillin-tazobactam | ≤0.03–8 | 0.25 | 4 | 100 | 0 | 0 |
| Cefoxitin | 4–128 | 16 | 64 | 63.3 | 16.7 | 20 |
| Ertapenem (19) | 0.125–8 | 0.5 | 4 | 94.7 | 5.3 | 0 |
| Imipenem | ≤0.015–2 | 0.125 | 0.5 | 100 | 0 | 0 |
| Doripenem (25) | 0.125–8 | 0.25 | 1 | 96 | 4 | 0 |
| Clindamycin | ≤0.125–>256 | 1 | >256 | 63.3 | 10 | 26.7 |
| Metronidazole | ≤0.06–4 | 0.5 | 1 | 100 | 0 | 0 |
| Moxifloxacin | 0.125–16 | 0.5 | 4 | 86.7 | 6.7 | 6.7 |
| Tigecycline | ≤0.03–4 | 0.5 | 1 | 100.0 | 0 | 0.0 |
| Bacteroides vulgatus (27) | ||||||
| Ampicillin-sulbactam | 0.125–128 | 4 | 16 | 74.1 | 18.5 | 7.4 |
| Piperacillin-tazobactam | 0.25–512 | 2 | 8 | 96.3 | 0.0 | 3.7 |
| Cefoxitin | 0.5–128 | 8 | 32 | 81.5 | 7.4 | 11.1 |
| Ertapenem (24) | 0.125–2 | 0.5 | 1 | 100.0 | 0.0 | 0.0 |
| Imipenem | ≤0.015–4 | 0.25 | 1 | 100.0 | 0.0 | 0.0 |
| Doripenem | 0.06–1 | 0.25 | 0.5 | 100.0 | 0.0 | 0.0 |
| Clindamycin | ≤0.125–>256 | 0.5 | >256 | 66.7 | 3.7 | 29.6 |
| Metronidazole | 0.25–4 | 0.5 | 1 | 100.0 | 0.0 | 0.0 |
| Moxifloxacin | 0.06–128 | 1 | 8 | 81.5 | 3.7 | 14.8 |
| Tigecycline | ≤0.03–2 | 0.06 | 0.5 | 100.0 | 0.0 | 0.0 |
| Uncommon B. fragilis group species (39)a | ||||||
| Ampicillin-sulbactam | ≤0.125–32 | 2 | 16 | 87.2 | 10.3 | 2.6 |
| Piperacillin-tazobactam | ≤0.03–64 | 1 | 8 | 97.4 | 2.6 | 0.0 |
| Cefoxitin | 4–128 | 16 | 64 | 61.5 | 20.5 | 17.9 |
| Ertapenem (34) | 0.06–16 | 0.5 | 2 | 97.1 | 0.0 | 2.9 |
| Imipenem | 0.03–4 | 0.25 | 0.5 | 100.0 | 0.0 | 0.0 |
| Doripenem (37) | 0.125–4 | 0.25 | 1 | 100.0 | 0.0 | 0.0 |
| Clindamycin | ≤0.125–>256 | 2 | >256 | 51.3 | 7.7 | 41.0 |
| Metronidazole | 0.06–4 | 0.5 | 2 | 100.0 | 0.0 | 0.0 |
| Moxifloxacin | ≤0.03–64 | 1 | 16 | 79.5 | 5.1 | 15.4 |
| Tigecycline | ≤0.03–4 | 0.125 | 1 | 100.0 | 0.0 | 0.0 |
The 39 uncommon isolates of the B. fragilis group species were found to belong to the following species: Parabacteroides (Bacteroides) distasonis, 7 isolates; Bacteroides uniformis, 7 isolates; Bacteroides stercoris, 7 isolates; Bacteroides merdae, 2 isolates; and Bacteroides spp., 16 isolates.
The overall susceptibility rates to β-lactams were as follows: imipenem, 99%; piperacillin-tazobactam, 99%; doripenem, 98%; ertapenem, 96%; ampicillin-sulbactam 92%; and cefoxitin, 72%. The susceptibility profiles for the other antibiotics were as follows: metronidazole, 100%; tigecycline, 100%; moxifloxacin, 91%; and clindamycin, 52%.
B. fragilis was the most susceptible species with respect to the majority of the agents tested and showed the highest rates of susceptibility to ampicillin-sulbactam, cefoxitin, and clindamycin. B. vulgatus remained susceptible to carbapenems, despite showing the lowest rates of susceptibility to β-lactam–β-lactamase inhibitor combinations.
Emergence of resistance to carbapenems and piperacillin-tazobactam was observed in this study. For B. fragilis isolates, nonsusceptible rates (including resistant and intermediate strains) to imipenem, doripenem, and ertapenem were 1.5%, 2.5% and 4%, respectively, and 0.6%, 2%, and 4.8% for other species of the B. fragilis group, with B. thetaiotaomicron/ovatus being the most resistant.
Among the resistant isolates, three B. fragilis isolates and one B. thetaiotaomicron/ovatus isolate recovered from blood, bone, pericardial fluid, and abdominal fluid sources showed carbapenem MICs of ≥16 μg/ml.
Correspondence of the phenotypic screening of the MBLs and genotypic detection of the cfiA gene for all the isolates with decreased susceptibility or resistance to carbapenems are shown in Table 2. The cfiA gene was present in 8 out of 23 isolates, all corresponding to the B. fragilis species. Three out of eight cfiA-positive isolates were resistant to carbapenems and showed inhibition by EDTA. The other five isolates showed decreased susceptibility to ertapenem and doripenem, and only three strains scored positive in the phenotypic screening. The cfiA gene was not detected in any other species of the group, not even in carbapenem-resistant B. thetaiotaomicron/ovatus. Moreover, the cfiA gene was not detected in the 22 isolates with carbapenem MICs of ≤2 μg/ml.
Table 2.
Phenotypic and genotypic characterization of MBLs in carbapenem-resistant isolates and isolates with decreased susceptibility
| Organism(s) | Center | MIC (μg/ml)a |
EDTA inhibition | cfiA gene | |||
|---|---|---|---|---|---|---|---|
| ERT | IMI | IMI+EDTA | DOR | ||||
| B. fragilis | 2 | >64 | >64 | ≤0.015 | >64 | + | + |
| 1 | >64 | 32 | 0.125 | >64 | + | + | |
| 1 | 32 | 32 | 0.06 | 32 | + | + | |
| 1 | 8 | 4 | ≤0.015 | 4 | + | − | |
| 3 | 8 | 0.5 | 0.125 | 4 | − | + | |
| 1 | 4 | 2 | ≤0.015 | 2 | + | − | |
| 1 | 4 | 1 | 0.125 | 4 | + | + | |
| 1 | 4 | 1 | 0.125 | 4 | + | + | |
| 2 | 4 | 0.5 | 0.125 | 4 | − | + | |
| 1 | 4 | 0.5 | 0.125 | 1 | − | − | |
| 2 | 4 | 0.5 | 0.125 | 1 | − | − | |
| 5 | 4 | 0.25 | 0.03 | 8 | + | + | |
| 6 | 4 | 0.06 | ≤0.015 | 4 | − | − | |
| 8 | 4 | 0.25 | 0.03 | 2 | + | − | |
| B. caccae | 1 | 8 | 2 | 0.125 | 8 | + | − |
| 4 | 4 | 0.5 | 0.125 | 1 | − | − | |
| 3 | 4 | 0.5 | ≤0.015 | 0.5 | + | − | |
| B. thetaiotaomicron/ovatus | 3 | >64 | 16 | 8 | 64 | − | − |
| 4 | 32 | 4 | 0.5 | 16 | + | − | |
| 1 | 8 | 2 | 0.5 | 4 | − | − | |
| 1 | 8 | 1 | ≤0.015 | 4 | + | − | |
| 7 | 4 | 0.5 | ≤0.015 | 1 | + | − | |
| B. stercoris | 1 | 16 | 4 | ≤0.015 | 4 | + | − |
ERT, ertapenem; IMI, imipenem; DOR, doripenem.
The overall susceptibility rate to moxifloxacin was 91%. Nevertheless, isolates from the uncommon species [Parabacteroides (Bacteroides) distasonis, Bacteroides uniformis, Bacteroides stercoris, Bacteroides merdae, and Bacteroides spp.] and B. vulgatus showed the highest moxifloxacin resistance rates, up to 15.4% and 14.8%, respectively, doubling the rates observed in the other species.
No metronidazole- or tigecycline-resistant isolates were observed. However, tigecycline MIC90 values among the different species ranged between 0.125 and 1 μg/ml, below the FDA breakpoint. Clindamycin showed the lowest activity among all the antibiotics tested, ranging from 42% for B. thetaiotaomicron/ovatus to 74.7% for B. fragilis species.
Slight variations were observed in the antimicrobial activity profiles of B. fragilis species according to the source of isolate (Table 3). However, for skin and soft tissue isolates, cefoxitin displayed better activity, while clindamycin and moxifloxacin were the least active. Similarly, non-B. fragilis species recovered from skin and soft tissues showed higher resistance to clindamycin, moxifloxacin, and also cefoxitin (Table 3).
Table 3.
In vitro activity of 10 antimicrobial agents against 363 isolates of Bacteroides fragilis grouped by the source of the isolate
| Source of isolate and organism (no. of isolates) | % of isolates susceptible to the following antimicrobial agenta: |
|||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| AMS | PTZ | FOX | ETP | IMI | DOR | CLI | MXF | TIG | MTZ | |
| Abdomen | ||||||||||
| B. fragilis (102) | 96 | 99 | 83 | 95 | 99 | 98 | 75 | 92 | 100 | 100 |
| Non-B. fragilis species (108) | 85 | 98 | 65 | 95 | 99 | 99 | 58 | 87 | 100 | 100 |
| Skin and soft tissues | ||||||||||
| B. fragilis (35) | 100 | 100 | 94 | 100 | 100 | 100 | 65 | 79 | 100 | 100 |
| Non-B. fragilis species (16) | 69 | 94 | 38 | 92 | 100 | 93 | 44 | 81 | 100 | 100 |
| Genital tract | ||||||||||
| B. fragilis (9) | 100 | 100 | 67 | 100 | 100 | 100 | 78 | 89 | 100 | 100 |
| Non-B. fragilis species (21) | 95 | 100 | 76 | 100 | 100 | 100 | 67 | 95 | 100 | 100 |
| Othersb | ||||||||||
| B. fragilis (15) | 87 | 93 | 67 | 92 | 93 | 93 | 80 | 100 | 100 | 100 |
| Non-B. fragilis species (15) | 87 | 100 | 33 | 92 | 100 | 92 | 13 | 87 | 100 | 100 |
| Blood | ||||||||||
| B. fragilis (30) | 96 | 100 | 90 | 95 | 97 | 96 | 66 | 83 | 100 | 100 |
| Non-B. fragilis species (12) | 92 | 100 | 67 | 100 | 100 | 100 | 50 | 75 | 100 | 100 |
AMS, ampicillin-sulbactam; PTZ, piperacillin-tazobactam; FOX, cefoxitin; ETP, ertapenem; IMI:, imipenem; DOR, doripenem; CLI, clindamycin; MXF, moxifloxacin; TIG, tigecycline; MTZ, metronidazole.
The other sources included bones (11 isolates), pericardial fluid (2 isolates), middle ears (6 isolates), lung (1 isolate), head and neck abscesses (3 isolates), hematomas (3 isolates), and surgical wounds (4 isolates).
DISCUSSION
As reported previously elsewhere in the world, variability in the resistance patterns among the species of the B. fragilis group and the emergence of resistance to some of the most active β-lactams was observed (2, 8, 12, 16, 17, 27).
In this study, the ampicillin-sulbactam susceptibility rates of B. fragilis and non-B. fragilis species were 97% and 85%, respectively. No increase in the resistance to ampicillin-sulbactam has been observed compared with previous studies conducted in Argentina, so the combination of these two drugs remains a good therapeutic option for anaerobic bacterial infections (8, 15).
Although carbapenems constitute the most active β-lactams against these microorganisms, the emergence of resistance to carbapenems and also to piperacillin-tazobactam in Argentina is reported here. Imipenem resistance due to metallo-β-lactamases has been reported since 1986 (7); however, it remains infrequent in the United States and Europe, ranging from 0.4% to 1.5%, similar to what was observed in this study (2, 17, 25, 26, 28).
The production of metallo-β-lactamase (5) CfiA was reported to be responsible for resistance to carbapenems in B. fragilis as early as 1990 (1, 23). The inhibition by EDTA was a very good predictor for the presence of metallo-β-lactamases in the highly resistant B. fragilis strains, but discrepant results were observed for strains with decreased susceptibility. Phenotypic detection could be improved using ertapenem instead of imipenem, especially in low-level CfiA-producing bacteria, as was already described for meropenem by Bogaerts et al. (4).
Only a small percentage of B. fragilis strains carrying the cfiA gene express the protein at a level high enough to classify the strain as resistant. High-level resistance has been associated with the presence of an insertion element that may provide an efficient promoter immediately upstream of the cfiA gene (13, 21, 22). In our samples, the presence of the cfiA gene was confirmed in 8 out of 23 isolates of the B. fragilis group displaying resistance or decreased susceptibility to carbapenems. The estimated prevalence of cfiA in clinically imipenem-susceptible B. fragilis isolates (imipenem MICs ≤ 4 μg/ml) was 2.5%, as was described in the literature (31).
The overall moxifloxacin susceptibility rate remained higher than that reported by Snydman et al. and Betriu et al. (65.5% and 86.1%, respectively) (2, 28). In our isolates, moxifloxacin resistance was variable among species and ranged from as low as 6.7% for B. caccae to almost double in B. vulgatus (14.8%) and the less common species of the group (15.4%). Even at very different levels, the same was previously observed by Snydman et al. (27.4% and 54.7% for B. fragilis and B. vulgatus, respectively), and Betriu et al. (9% and 25% for B. fragilis and B. uniformis, respectively). It is noteworthy that an 8-fold increase in MIC90 values after 10 years of monitoring was reported. Moxifloxacin activity should be monitored because of the gradual decrease of MIC values to resistance levels (10, 19, 20, 26).
Previous reports have already shown that resistance to both clindamycin and cefoxitin makes their empirical use unacceptable (2, 8, 30). Compared with our last surveys, resistance to clindamycin increased from 16% to 25% within B. fragilis, and, even worse, from 44 to 48% in non-B. fragilis species (8). It is clear that clindamycin should no longer be used without prior susceptibility testing. For cefoxitin, the range of susceptibility was similar to that of previous studies (global susceptibility about 60%).
In agreement with previous reports, metronidazole and tigecycline are still the most active agents. In our case, MIC90 values for tigecycline ranged from 0.125 to 1 μg/ml, well below the 4 to 8 μg/ml values reported by other authors, and unlike Betriu et al. (3) and Grisold et al. (11), no resistance of any kind was found. It is also important to highlight that not a single metronidazole-resistant isolate was found in Argentina, which is different from the situation in European countries and the United States (9, 14, 17, 24, 27).
We want to make doctors and scientists aware of the emergence of B. fragilis group isolates resistant to carbapenems and to piperacillin-tazobactam in Argentina. Among these isolates, the presence of the cfiA metallo-β-lactamase gene could be responsible for the resistance or decreased susceptibility observed in some isolates of B. fragilis sensu stricto. However, additional studies should be performed in order to determine the mechanisms involved in the regulation of the expression of the cfiA gene, the clinical relevance of reduced susceptibility, and the challenge to discover clues about the mechanisms responsible for the resistance observed in non-B. fragilis isolates.
ACKNOWLEDGMENTS
This study was partially supported by Fundación Alberto J. Roemmers, Buenos Aires, Argentina. M.R. and G.G. are members of Carrera del Investigador Científico, CONICET, Argentina.
We are grateful to Marcelo Galas and members of the Laboratorio de Antimicrobianos, INEI-ANLIS Dr. Carlos G. Malbrán, Argentina, for their encouragement, contributing to the collection of strains, and sending the strains needed to conduct this study.
Members of the Anaerobe Surveillance Team are M. Bottiglieri, M. Rocchi, I. A. Marqués, M. Machain, M. C. Mauro, M. R. Nuñez, and D. Ballester.
Footnotes
Published ahead of print 9 January 2012
REFERENCES
- 1. Bandoh K, Muto Y, Watanabe K, Katoh N, Ueno K. 1991. Biochemical properties and purification of metallo-beta-lactamase from Bacteroides fragilis. Antimicrob. Agents Chemother. 35:371–372 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2. Betriu C, et al. 2008. Resistance trends of the Bacteroides fragilis group over a 10-year period, 1997 to 2006, in Madrid, Spain. Antimicrob. Agents Chemother. 52:2686–2690 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3. Betriu C, Culebras E, Gomez M, Rodriguez-Avial I, Picazo JJ. 2005. In vitro activity of tigecycline against Bacteroides species. J. Antimicrob. Chemother. 56:349–352 [DOI] [PubMed] [Google Scholar]
- 4. Bogaerts P, et al. 2008. Evaluation of a new meropenem-EDTA double-ended Etest strip for the detection of the cfiA metallo-beta-lactamase gene in clinical isolates of Bacteroides fragilis. Clin. Microbiol. Infect. 14:973–977 [DOI] [PubMed] [Google Scholar]
- 5. Bush K, Jacoby GA, Medeiros AA. 1995. A functional classification scheme for beta-lactamases and its correlation with molecular structure. Antimicrob. Agents Chemother. 39:1211–1233 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6. Clinical and Laboratory Standards Institute 2007. Methods for antimicrobial susceptibility testing of anaerobic bacteria, 7th ed Approved standard M11-A7. Clinical and Laboratory Standards Institute, Wayne, PA [Google Scholar]
- 7. Cuchural GJ, Jr, Malamy MH, Tally FP. 1986. Beta-lactamase-mediated imipenem resistance in Bacteroides fragilis. Antimicrob. Agents Chemother. 30:645–648 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8. Fernandez Canigia L, et al. 2007. Susceptibility trends of Bacteroides fragilis group isolates from Buenos Aires, Argentina. Rev. Argent. Microbiol. 39:156–160 [PubMed] [Google Scholar]
- 9. Gal M, Brazier JS. 2004. Metronidazole resistance in Bacteroides spp. carrying nim genes and the selection of slow-growing metronidazole-resistant mutants. J. Antimicrob. Chemother. 54:109–116 [DOI] [PubMed] [Google Scholar]
- 10. Golan Y, et al. 2003. Emergence of fluoroquinolone resistance among Bacteroides species. J. Antimicrob. Chemother. 52:208–213 [DOI] [PubMed] [Google Scholar]
- 11. Grisold AJ, et al. 2007. In vitro activity of ten antibiotics, including tigecycline, against Bacteroides species in Austria. Eur. J. Clin. Microbiol. Infect. Dis. 26:525–527 [DOI] [PubMed] [Google Scholar]
- 12. Hecht DW. 2006. Anaerobes: antibiotic resistance, clinical significance, and the role of susceptibility testing. Anaerobe 12:115–121 [DOI] [PubMed] [Google Scholar]
- 13. Kato N, Yamazoe K, Han CG, Ohtsubo E. 2003. New insertion sequence elements in the upstream region of cfiA in imipenem-resistant Bacteroides fragilis strains. Antimicrob. Agents Chemother. 47:979–985 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14. Katsandri A, Avlamis A, Pantazatou A, Houhoula DP, Papaparaskevas J. 2006. Dissemination of nim-class genes, encoding nitroimidazole resistance, among different species of Gram-negative anaerobic bacteria isolated in Athens, Greece. J. Antimicrob. Chemother. 58:705–706 [DOI] [PubMed] [Google Scholar]
- 15. Litterio M, et al. 2004. “In vitro” activity of ten antimicrobial agents against anaerobic bacteria. A collaborative study, 1999–2002. Rev. Argent. Microbiol. 36:130–135 (In Spanish.) [PubMed] [Google Scholar]
- 16. Liu CY, et al. 2008. Increasing trends in antimicrobial resistance among clinically important anaerobes and Bacteroides fragilis isolates causing nosocomial infections: emerging resistance to carbapenems. Antimicrob. Agents Chemother. 52:3161–3168 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17. Nagy E, Urban E, Nord CE, ESCMID Study Group on Antimicrobial Resistance in Anaerobic Bacteria 2011. Antimicrobial susceptibility of Bacteroides fragilis group isolates in Europe: 20 years of experience. Clin. Microbiol. Infect. 17:371–379 [DOI] [PubMed] [Google Scholar]
- 18. Nguyen MH, et al. 2000. Antimicrobial resistance and clinical outcome of Bacteroides bacteremia: findings of a multicenter prospective observational trial. Clin. Infect. Dis. 30:870–876 [DOI] [PubMed] [Google Scholar]
- 19. Oteo-Iglesias J, Alos JI, Gomez-Garces JL. 2002. Increase in resistance to new fluoroquinolones from 1998 to 2001 in the Bacteroides fragilis group. J. Antimicrob. Chemother. 50:1055–1057 [DOI] [PubMed] [Google Scholar]
- 20. Papaparaskevas J, et al. 2008. Moxifloxacin resistance is prevalent among Bacteroides and Prevotella species in Greece. J. Antimicrob. Chemother. 62:137–141 [DOI] [PubMed] [Google Scholar]
- 21. Podglajen I, Breuil J, Bordon F, Gutmann L, Collatz E. 1992. A silent carbapenemase gene in strains of Bacteroides fragilis can be expressed after a one-step mutation. FEMS Microbiol. Lett. 70:21–29 [DOI] [PubMed] [Google Scholar]
- 22. Podglajen I, Breuil J, Collatz E. 1994. Insertion of a novel DNA sequence, 1S1186, upstream of the silent carbapenemase gene cfiA, promotes expression of carbapenem resistance in clinical isolates of Bacteroides fragilis. Mol. Microbiol. 12:105–114 [DOI] [PubMed] [Google Scholar]
- 23. Rasmussen BA, Gluzman Y, Tally FP. 1990. Cloning and sequencing of the class B beta-lactamase gene (ccrA) from Bacteroides fragilis TAL3636. Antimicrob. Agents Chemother. 34:1590–1592 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24. Seifert H, Dalhoff A. 2010. German multicentre survey of the antibiotic susceptibility of Bacteroides fragilis group and Prevotella species isolated from intra-abdominal infections: results from the PRISMA study. J. Antimicrob. Chemother. 65:2405–2410 [DOI] [PubMed] [Google Scholar]
- 25. Snydman DR, Jacobus NV, McDermott LA. 2008. In vitro activities of doripenem, a new broad-spectrum carbapenem, against recently collected clinical anaerobic isolates, with emphasis on the Bacteroides fragilis group. Antimicrob. Agents Chemother. 52:4492–4496 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26. Snydman DR, et al. 2011. Update on resistance of Bacteroides fragilis group and related species with special attention to carbapenems 2006–2009. Anaerobe 17:147–151 [DOI] [PubMed] [Google Scholar]
- 27. Snydman DR, et al. 2010. Lessons learned from the anaerobe survey: historical perspective and review of the most recent data (2005–2007). Clin. Infect. Dis. 50(Suppl. 1):S26–S33 [DOI] [PubMed] [Google Scholar]
- 28. Snydman DR, et al. 2007. National survey on the susceptibility of Bacteroides fragilis group: report and analysis of trends in the United States from 1997 to 2004. Antimicrob. Agents Chemother. 51:1649–1655 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29. Snydman DR, et al. 2002. National survey on the susceptibility of Bacteroides fragilis Group: report and analysis of trends for 1997–2000. Clin. Infect. Dis. 35:S126–S134 [DOI] [PubMed] [Google Scholar]
- 30. Wybo I, et al. 2007. Third Belgian multicentre survey of antibiotic susceptibility of anaerobic bacteria. J. Antimicrob. Chemother. 59:132–139 [DOI] [PubMed] [Google Scholar]
- 31. Yamazoe K, et al. 1999. Distribution of the cfiA gene among Bacteroides fragilis strains in Japan and relatedness of cfiA to imipenem resistance. Antimicrob. Agents Chemother. 43:2808–2810 [DOI] [PMC free article] [PubMed] [Google Scholar]