Skip to main content
Antimicrobial Agents and Chemotherapy logoLink to Antimicrobial Agents and Chemotherapy
. 2012 Mar;56(3):1609–1612. doi: 10.1128/AAC.05539-11

Molecular Identification of Extended-Spectrum-β-Lactamase Genes from Enterobacteriaceae Isolated from Healthy Human Carriers in Switzerland

Nadine Geser a, Roger Stephan a, Bozena M Korczak b, Lothar Beutin c, Herbert Hächler a,
PMCID: PMC3294945  PMID: 22155836

Abstract

In this study, fecal samples from 586 healthy humans were investigated to determine the occurrence of extended-spectrum-β-lactamase (ESBL)-producing Enterobacteriaceae in Swiss people. A total of 5.8% of the human fecal samples yielded ESBL producers, and all of the 34 isolated strains were Escherichia coli. PCR analysis revealed that 14 strains produced CTX-M-15, 10 produced CTX-M-1, 7 strains produced CTX-M-14, and 2 strains produced CTX-M-2 ESBLs. One strain produced SHV-12 ESBL. Of the 34 isolates, 15 produced additional TEM-1 broad-spectrum β-lactamases. By serotyping, a high degree of diversity among the strains was found.

TEXT

Antimicrobial resistance in bacteria has emerged as a problem in both human and veterinary medicine. One of the currently most important resistance mechanisms in Enterobacteriaceae, which reduces the efficacy even of modern expanded-spectrum cephalosporins (except cephamycins and carbapenems) and monobactams, is based on plasmid-mediated production of extended-spectrum β-lactamases (ESBL). Until now, more than 600 ESBL variants are known. Among them, the over 100 CTX-M enzymes so far reported may be grouped into five main subgroups (3). As a matter of growing concern, resistance caused by ESBLs is often associated with resistance to other classes of antibiotics like fluoroquinolones, aminoglycosides, and trimethoprim-sulfamethoxazole (5, 15). In the past few years, there has been an increase in the detection of ESBL-producing strains in the general community (26). Three studies have been published about ESBL prevalence in healthy humans, establishing prevalences between 6 and 7% (25, 26, 36). More recently, several alarming studies have reported the dissemination of ESBL-producing Enterobacteriaceae to (i) healthy food-producing animals in several countries in Europe and Asia (7, 8, 16, 27, 35) and (ii) food products like meat, fish, and raw milk (17, 19, 20). Moreover, ESBL producers are also reported increasingly among infection-associated enterobacterial isolates in France (9, 23), Italy (4), the Czech Republic (21), and Austria (10). These studies were the reason to look for ESBL producers also in Switzerland, a country—located between the mentioned ones—with a tight policy of antibiotic prescription and a low level of multidrug resistance in bacteria (12). The aim of the present study was to screen for the occurrence of ESBL-producing Enterobacteriaceae in healthy human carriers in Switzerland and to further characterize isolated strains and ESBLs.

In an ongoing study of routine stool samples from staff members of meat-processing companies, fecal samples were collected from September to November 2010 from 586 healthy humans. The native samples were transported in sterile tubes without transport medium and were processed within 24 h of collection. All samples were collected in urban areas, and each person was tested only once. The population consisted of adults without diarrhea aged between 20 and 60 years, a quarter being female.

One loopful of each sample was enriched for 24 h at 37°C in 10 ml of EE broth (BD, Franklin Lakes, NJ), streaked onto Brilliance ESBL agar (Oxoid, Hampshire, United Kingdom), and incubated at 37°C for 24 h under aerobic conditions. Colonies of different morphology were selected and subcultured onto triple sugar iron (TSI) agar (BD, Franklin Lakes, NJ) at 37°C for 24 h. Nonfermenters were discarded, and oxidase-negative colonies were subjected to identification by API ID 32 E (bioMérieux, Marcy l'Etoile, France). Serotyping was performed according to standard methods (32).

All isolated strains were subjected to susceptibility testing against 15 antimicrobial agents (Table 1) by the disk diffusion method according to CLSI protocols and evaluated according to CLSI criteria (6). Presumptive ESBL producers were confirmed on Mueller-Hinton agar plates using Etest-ESBL strips containing cefotaxime, cefepime, or ceftazidime, each alone and in combination with clavulanic acid (bioMérieux, Marcy l'Etoile, France).

Table 1.

Identification and further characterization of the 34 ESBL producers isolated from fecal samples of 586 healthy human carriers in Switzerlanda

Sample no. Serotyped β-Lactamase(s) identified β-Lactam antibiotic resistance
Further resistances
AM AMC CF CXM CPD CTX CAZ FEP FOX
1519 O2:H48 CTX-M-1 and TEM-1c r s r r r r sb sb s
1038 O8:H21 CTX-M-1 r s r r r r sb ib s SXT, TE, CIP
1582 O11:H12 CTX-M-1 r s r r r r sb sb s TE
2238 O23:H16 CTX-M-1 and TEM-1 r i r r r r sb sb s SXT, TE
2332 O24:H26 CTX-M-1 and TEM-1 r i r r r r sb sb s SXT, TE
2018 O32:H19 CTX-M-1 r s r r r r sb sb s SXT, TE
2291 O53:H18 CTX-M-1 and TEM-1 r i r r r r ib sb s SXT, TE
2290 O68:H21 CTX-M-1 r s r r r ib sb sb s SXT, TE
1559 O107:H27 CTX-M-1 and TEM-1 r s r r r r sb sb s SXT, TE
2333 Or:H26 CTX-M-1 and TEM-1 r i r r r ib sb sb s SXT, TE
1348 O20:H33 CTX-M-2 and TEM-1 r i r r r r sb sb s SXT, TE
2294 Ont:H7 CTX-M-2 and TEM-1 r r r r r r sb ib s K, SXT, TE
1877 O2:H48 CTX-M-14 r s r r r ib sb sb s
2241 O15:H18 CTX-M-14 r i r r r r sb sb s TE
2242 O15:H18 CTX-M-14 r i r r r r sb sb s TE
1999 O33:H4 CTX-M-14 r r r r r r sb r s TE, CIP
1018 O73/77:H18 CTX-M-14 r s r r r r sb sb s GM
1545 O153:H30 CTX-M-14 and TEM-1 r i r r r r sb ib s K, SXT, TE
1495 Or:H51 CTX-M-14 r i r r r r sb sb s SXT, TE
2310 O1:H6 CTX-M-15 r r r r r r ib ib s SXT, TE, CIP
1887 O15:H1 CTX-M-15 r i r r r r sb sb s GM, SXT, TE
2225 O86:H4 CTX-M-15 r s r r r r ib ib s SXT, CIP
150 O88:H8 CTX-M-15 and TEM-1 r s r r r r ib ib s
1866 O102:H6 CTX-M-15 r r r r r r ib r s K, SXT, TE, CIP
503 O102:H6 CTX-M-15 and TEM-1 r s r r r r r ib s K, SXT
506 O123:H12 CTX-M-15 r s r r r r sb ib s SXT, TE
1330 O153:H6 CTX-M-15 r r r r r r ib ib s K, GM, CIP
171 O153:H6 CTX-M-15 and TEM-1 r i r r r r r r s GM, SXT, TE, CIP
1024 O153:H6 CTX-M-15 and TEM-1 r i r r r r ib ib s SXT, TE, CIP
2017 O184:H2 CTX-M-15 r s r r r r sb sb s SXT, TE
2200 Or:H5 CTX-M-15 r s r r r r r i s SXT, TE, CIP
1507 Ont:H21 CTX-M-15 and TEM-1 r r r r r ib sb sb s K, SXT, TE, CIP
1027 Ont:H30 CTX-M-15 and TEM-1c r r r r r r sb sb s SXT, TE, CIP
490 O138:H48 SHV-12 r s r r r ib ib sb s TE
a

Abbreviations: AM, ampicillin; AMC, amoxicillin-clavulanic acid; CF, cephalothin; CXM, cefuroxime; CPD, cefpodoxime; CTX, cefotaxime; CAZ, ceftazidime; FEP, cefepime; FOX, cefoxitin; K, kanamycin; GM, gentamicin; SXT, trimethoprim-sulfamethoxazole; TE, tetracycline; CIP, ciprofloxacin; PB, polymyxin; s, sensitive; i, intermediate; r, resistant.

b

It is known that many ESBL producers may appear susceptible or intermediate to oxyimino cephalosporins in vitro if CLSI criteria are applied strictly but do not respond to the respective therapies. Consequently, for clinical reporting these results have to be corrected to “resistant.”

c

Query coverage, 100%; maximal identity, 99% (http://www.ncbi.nlm.nih.gov/blast/).

d

All isolates listed were identified as E. coli.

Bacterial strains confirmed as producing ESBLs were further analyzed by PCR and by sequencing the whole open reading frames (ORF) of bla genes. DNA was extracted by a standard heat lysis protocol. Thereafter, five specific published primer sets (custom synthesized by Microsynth, Balgach, Switzerland) and PCR protocols (13, 30, 33, 38) were used to search for β-lactamase-encoding genes belonging to blaTEM, blaSHV, and three blaCTX-M subfamilies. In order to ensure coverage of all entire bla ORFs, the primer sets were supplemented with the following newly designed primers from up- and downstream blaCTX-M flanking regions: 5′AAACACACGTGGAATTTAGGG3′, 5′CCGTCGGTGACGATTTTAGCC3′, 5′CCGATGACTATGCGCACTGGG3′, 5′TTTTGCCGTACCTGCGTACCC3′, 5′CCGTGGGTTACGATTTTCGCC3′, 5′TTGGTCCAGAAAAAAGAGCGG3′, 5′TGATGTAACACGGATTGACCG3′ 5′AAACCAGTTACAGCCCTTCGG3′, and 5′TGGAGCCACGGTTGATGAGGG3′ (this study). The resulting amplicons were purified using the PCR purification kit (Qiagen, Courtaboeuf, France) according to the manufacturer's recommendations. Custom sequencing was performed by Microsynth (Balgach, Switzerland), and the nucleotide and protein sequences were analyzed with Codon Code Aligner v. 3.7.1.1. For database searches the BLASTN program of NCBI (http://www.ncbi.nlm.nih.gov/blast/) was used.

ESBL-producing strains were isolated from 34 healthy human carriers (5.8%). This is an average carriage rate compared to an estimated <3%, 5.5%, an estimated >10%, and 13.2% in Sweden, Spain, India, and Saudi Arabia, respectively (34). All 34 ESBL producers showed a synergy effect with at least one of the three Etest-ESBL strips, and they yielded factors >8 when ratios of MIC (cephalosporin)/MIC (cephalosporin + clavulanic acid) were calculated. Identification of all 34 isolates yielded Escherichia coli (Table 1). The β-lactamase genes of all ESBL-producing isolates were further characterized by PCR and sequencing (Table 1). One bla gene coded for a SHV ESBL (SHV-12), and 33 genes coded for CTX-M ESBLs. Of the blaCTX-M genes, 24 (70.6%) coded for CTX-M group 1 ESBLs (CTX-M-1, 10 strains; CTX-M-15, 14 strains), 7 (20.5%) for CTX-M group 9 (all CTX-M-14), and 2 (6%) for CTX-M group 2 (both CTX-M-2). All of the CTX-M group 2-positive isolates, 50% of the CTX-M group 1-positive E. coli isolates, and only 14.3% of the members of CTX-M group 9 harbored additional blaTEM-1.

Besides β-lactam resistance, susceptibility to other classes of antibiotics was also tested; 26 strains were found resistant to tetracycline (76.5%), 23 strains were resistant to trimethoprim-sulfamethoxazole (67.6%), 10 strains were resistant to ciprofloxacin (29.4%), and 9 were resistant to aminoglycosides (26.4%). Four strains (11.8%) showed resistance to β-lactam antibiotics only (Table 1).

To identify relationships between the ESBL-producing strains, serotyping was carried out. All 34 strains were serotyped, resulting in as many as 29 different serotypes (Table 1). Only three serotypes, O2:48, O15:H18, and O102:H6, were found twice, and one, O153:H6, was found three times. This is in contrast to results for northwestern Spain, for example, where a strong predominance of O25b:H4 expressing CTX-M-15 was observed (28).

Currently, no studies describing the prevalence and characteristics of ESBL-producing Enterobacteriaceae in healthy human carriers are available in Switzerland, but there are two studies from Switzerland presenting data about infection-associated human ESBL producers (22, 31). The prevalence (0.7%) in hospitalized patients determined in 2007 was lower than in our study, but the CTX-M type distribution was the same (22). Despite the strict policy of antibiotic prescription in Switzerland (12), the determined prevalence rate of ESBL producers is almost identical to rates in other countries (25, 26, 34, 36). The increasing predominance of CTX-M group 1 enzymes, as has recently been described in strains from healthy food-producing animals in Denmark, France, the Netherlands, Portugal, and Switzerland (1, 13, 14, 16, 24) and in humans in the Netherlands, Norway, and Sweden (11, 24, 37), is also confirmed by our study. However, SHV-12—first described in Switzerland in 1997 (31)—has persisted in this country to the present day. The type mostly found in Switzerland, CTX-M-15, is distributed worldwide (4, 34). In contrast, CTX-M-9 together with CTX-M-14 (18, 28, 29), CTX-M-1 (4) and CTX-M-2 are the predominant types in Spain, Italy, and South America/Japan/Israel (2, 3, 4, 18, 29).

The fact that ESBL-producing strains are often also resistant to other classes of antimicrobial agents has been described in the past, and it is known that plasmids with blaCTX-M genes often carry genes conferring resistance to, e.g., quinolones, aminoglycosides, and co-trimoxazole, etc. (14, 15). This location of different resistance genes on single plasmid replicons could explain the successful dissemination of blaCTX-M genes by coselection (5, 15).

By serotyping, a high diversity within our ESBL producers was found (Table 1). The relatively high rates of intestinal carriage of ESBL producers in the general healthy human public and the high diversity among these strains, which is an indicator for high transmissibility of resistance factors, are worrisome. Further studies are necessary to assess future trends.

ACKNOWLEDGMENT

We thank the Swiss Federal Office of Public Health for partly funding the project.

Footnotes

Published ahead of print 12 December 2011

REFERENCES

  • 1. Aarestrup FM, et al. 2006. First description of blaCTX-M-1-carrying Escherichia coli isolates in Danish primary food production. J. Antimicrob. Chemother. 57:1258–1259 [DOI] [PubMed] [Google Scholar]
  • 2. Ben-Ami R, et al. 2006. Influx of extended-spectrum β-lactamase-producing Enterobacteriaceae into the hospital. Clin. Infect. Dis. 42:925–934 [DOI] [PubMed] [Google Scholar]
  • 3. Bonnet R. 2004. Growing group of extended-spectrum β-lactamases: the CTX-M enzymes. Antimicrob. Agents Chemother. 48:1–14 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4. Brigante G, et al. 2005. Evolution of CTX-M-type β-lactamases in isolates of Escherichia coli infecting hospital and community patients. Int. J. Antimicrob. Agents 25:157–162 [DOI] [PubMed] [Google Scholar]
  • 5. Cantòn R, Coque TM. 2006. The CTX-M β-lactamase pandemic. Curr. Opin. Microbiol. 9:466–475 [DOI] [PubMed] [Google Scholar]
  • 6. Clinical Laboratory Standards Institute 2008. Performance standards for antimicrobial susceptibility testing; eighteenth informational supplement. CLSI document M100–S18. CLSI, Wayne, PA [Google Scholar]
  • 7. Cortés P, et al. 2010. Isolation and characterization of potentially pathogenic antimicrobial-resistant Escherichia coli strains from chicken and pig farms in Spain. Appl. Environ. Microbiol. 76:2799–2805 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8. Duan RS, et al. 2006. Escherichia coli producing CTX-M β-lactamases in food animals in Hong Kong. Microb. Drug Resist. 12:145–148 [DOI] [PubMed] [Google Scholar]
  • 9. Eckert C, et al. 2004. Dissemination of CTX-M-type β-lactamases among clinical isolates of Enterobacteriaceae in Paris, France. Antimicrob. Agents Chemother. 48:1249–1255 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10. Eisner A, et al. 2006. Emergence of Enterobacteriaceae isolates producing CTX-M extended-spectrum β-lactamase in Austria. Antimicrob. Agents Chemother. 50:785–787 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11. Fang H, Ataker F, Hedin G, Dornbusch K. 2008. Molecular epidemiology of extended-spectrum β-lactamases among Escherichia coli isolates collected in a Swedish hospital and its associated health care facilities from 2001 to 2006. J. Clin. Microbiol. 46:707–712 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12. Filippini M, Masiero G, Moschetti K. 2006. Socioeconomic determinants of regional differences in outpatient antibiotic consumption: evidence from Switzerland. Health Policy 78:77–92 [DOI] [PubMed] [Google Scholar]
  • 13. Geser N, et al. 2011. Fecal carriage of extended-spectrum β-lactamase-producing Enterobacteriaceae in swine and cattle at slaughter in Switzerland. J. Food Prot. 74:446–449 [DOI] [PubMed] [Google Scholar]
  • 14. Girlich D, et al. 2007. Extended-spectrum β-lactamase CTX-M-1 in Escherichia coli in healthy poultry in France. Appl. Environ. Microbiol. 73:4681–4685 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15. Gniadkowski M. 2001. Evolution and epidemiology of extended-spectrum β-lactamases (ESBLs) and ESBL-producing microorganisms. Clin. Microbiol. Infect. 7:597–608 [DOI] [PubMed] [Google Scholar]
  • 16. Gonçalves A, et al. 2010. Genetic characterization of extended-spectrum β-lactamases in Escherichia coli isolates of pigs from a Portuguese intensive swine farm. Foodborne Pathog. Dis. 7:1569–1573 [DOI] [PubMed] [Google Scholar]
  • 17. Hammad AM, Ahmed AM, Ishida Y, Shimamoto T. 2008. First characterization and emergence of SHV-60 in raw milk of a healthy cow in Japan. J. Vet. Med. Sci. 70:1269–1272 [DOI] [PubMed] [Google Scholar]
  • 18. Hernandez JR, Martinez-Martinez L, Cantón R, Coque TM, Pascual A. 2005. Spanish group for nosocomial infections (GEIH): nationwide study of Escherichia coli and Klebsiella pneumoniae producing extended-spectrum β-lactamases in Spain. Antimicrob. Agents Chemother. 49:2122–2125 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19. Jensen LB, Hasman H, Agersø Y, Emborg HD, Aarestrup FM. 2006. First description of an oxyimino-cephalosporin-resistant, ESBL-carrying Escherichia coli isolated from meat sold in Denmark. J. Antimicrob. Chemother. 57:793–794 [DOI] [PubMed] [Google Scholar]
  • 20. Jouini A, et al. 2007. Characterization of CTX-M and SHV extended-spectrum β-lactamases and associated resistance genes in Escherichia coli strains of food samples in Tunisia. J. Antimicrob. Chemother. 60:1137–1141 [DOI] [PubMed] [Google Scholar]
  • 21. Kolár M, et al. 2010. Prevalence of ESBL-positive Enterobacteriaceae in large Moravian hospitals (Czech Republic). Klin. Mikrobiol. Infekc. Lek. 16:152–157 (In Czech.) [PubMed] [Google Scholar]
  • 22. Lartigue MF, et al. 2007. Extended-spectrum β-lactamases of the CTX-M type now in Switzerland. Antimicrob. Agents Chemother. 51:2855–2860 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23. Lartigue MF, Fortineau N, Nordmann P. 2005. Spread of novel expanded-spectrum β-lactamases in Enterobacteriaceae in a university hospital in the Paris area, France. Clin. Microbiol. Infect. 11:588–591 [DOI] [PubMed] [Google Scholar]
  • 24. Leverstein-van Hall MA, et al. 2011. Dutch patients, retail chicken meat and poultry share the same ESBL genes, plasmids and strains. Clin. Microbiol. Infect. doi:10.1111/j.1469-0691.2011.03497.x [DOI] [PubMed] [Google Scholar]
  • 25. Luvsansharav UO, et al. 2011. Prevalence of fecal carriage of extended-spectrum β-lactamase-producing Enterobacteriaceae among healthy adult people in Japan. J. Infect. Chemother. doi:10.1007/s10156-011-0225-2 [DOI] [PubMed] [Google Scholar]
  • 26. Mesa RJ, et al. 2006. Extended-spectrum β-lactamase-producing Enterobacteriaceae in different environments (humans, food, animal farms and sewage). Antimicrob. Chemother. 58:211–215 [DOI] [PubMed] [Google Scholar]
  • 27. Meunier D, Jouy E, Lazizzera C, Kobisc M, Madec JY. 2006. CTX-M-1- and CTX-M-15-type β-lactamases in clinical Escherichia coli isolates recovered from food-producing animals in France. Int. J. Antimicrob. Agents 28:402–407 [DOI] [PubMed] [Google Scholar]
  • 28. Mora A, et al. 2011. Emergence of clonal groups O1:HNM-D-ST59, O15:H1-D-ST393, O20:H34/HNM-D-ST354, O25b:H4-B2-ST131 and ONT:H21,42-B1-ST101 among CTX-M-14-producing Escherichia coli clinical isolates in Galicia, northwest Spain. Int. J. Antimicrob. Agents. 37:16–21 [DOI] [PubMed] [Google Scholar]
  • 29. Novais A, et al. 2006. Dissemination and persistence of blaCTX-M-9 are linked to class 1 integrons containing CR1 associated with defective transposon derivatives from Tn402 located in early antibiotic resistance plasmids of IncHI2, IncP1-α, and IncFI groups. Antimicrob. Agents Chemother. 50:2741–2750 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30. Nüesch-Inderbinen MT, Hächler H, Kayser FH. 1996. Detection of genes coding for extended-spectrum SHV β-lactamases in clinical isolates by a molecular genetic method, and comparison with the E test. Eur. J. Clin. Microbiol. Infect. Dis. 15:398–402 [DOI] [PubMed] [Google Scholar]
  • 31. Nüesch-Inderbinen MT, Kayser FH, Hächler H. 1997. Survey and molecular genetics of SHV β-lactamases in Enterobacteriaceae in Switzerland: two novel enzymes, SHV-11 and SHV-12. Antimicrob. Agents Chemother. 41:943–949 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32. Ørskov K, Ørskov I. 1984. Serotyping of Escherichia coli. Methods Microbiol. 14:43–122 [Google Scholar]
  • 33. Pitout JD, et al. 1998. β-Lactamases responsible for resistance to expanded-spectrum cephalosporins in Klebsiella pneumoniae, Escherichia coli, and Proteus mirabilis isolates recovered in South Africa. Antimicrob. Agents Chemother. 42:1350–1354 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34. Tängdén T, Cars O, Melhus A, Löwdin E. 2010. Foreign travel is a major risk factor for colonization with Escherichia coli producing CTX-M-type extended-spectrum β-lactamases: a prospective study with Swedish volunteers. Antimicrob. Agents Chemother. 54:3564–3568 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35. Tian GB, et al. 2009. Detection of CTX-M-15, CTX-M-22, and SHV-2 extended-spectrum β-lactamases (ESBLs) in Escherichia coli fecal-sample isolates from pig farms in China. Foodborne Pathog. Dis. 6:297–304 [DOI] [PubMed] [Google Scholar]
  • 36. Tian SF, Chen BY, Chu YZ, Wang S. 2008. Prevalence of rectal carriage of extended-spectrum β-lactamase-producing Escherichia coli among elderly people in community settings in China. Can. J. Microbiol. 54:781–785 [DOI] [PubMed] [Google Scholar]
  • 37. Tofteland S, et al. 2007. Effects of phenotype and genotype on methods for detection of extended-spectrum β-lactamase-producing clinical isolates of Escherichia coli and Klebsiella pneumoniae in Norway. J. Clin. Microbiol. 45:199–205 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38. Woodford N, Fagan EJ, Ellington MJ. 2006. Multiplex PCR for rapid detection of genes encoding CTX-M extended-spectrum β-lactamases. J. Antimicrob. Chemother. 57:154–155 [DOI] [PubMed] [Google Scholar]

Articles from Antimicrobial Agents and Chemotherapy are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES