Skip to main content
Journal of Clinical Microbiology logoLink to Journal of Clinical Microbiology
. 2012 Mar;50(3):1034–1038. doi: 10.1128/JCM.06589-11

Effect of Pneumococcal Vaccination on Nasopharyngeal Carriage of Streptococcus pneumoniae, Haemophilus influenzae, Moraxella catarrhalis, and Staphylococcus aureus in Fijian Children

Eileen M Dunne a,✉, Jayne Manning a, Fiona M Russell a, Roy M Robins-Browne b,c, E Kim Mulholland a,d,e, Catherine Satzke a,b,c
PMCID: PMC3295152  PMID: 22170924

Abstract

The 7-valent pneumococcal conjugate vaccine (PCV7) reduces carriage of vaccine type Streptococcus pneumoniae but leads to replacement by nonvaccine serotypes and may affect carriage of other respiratory pathogens. We investigated nasopharyngeal carriage of S. pneumoniae, Haemophilus influenzae, Moraxella catarrhalis, and Staphylococcus aureus in Fijian infants participating in a pneumococcal vaccine trial using quantitative PCR. Vaccination did not affect pathogen carriage rates or densities, whereas significant differences between the two major ethnic groups were observed.

TEXT

Nasopharyngeal (NP) carriage of pathogenic bacteria is the primary reservoir for maintaining bacterial species within a population (7) and is considered a prerequisite for development of major childhood diseases, including bacterial pneumonia, meningitis, and otitis media. Streptococcus pneumoniae is the most common bacterial cause of childhood pneumonia and is responsible for at least 800,000 child deaths annually, primarily in developing countries (18, 33). While rarely fatal, otitis media is the most frequently reported childhood bacterial infection: approximately 80% of children experience otitis media by age three (17). S. pneumoniae, Haemophilus influenzae, and Moraxella catarrhalis are the predominant causes of otitis media (36).

PCV7 (Prevnar; Pfizer Inc.) effectively reduces carriage and subsequent disease caused by the serotypes of S. pneumoniae included in the vaccine. However, pneumococcal vaccination has minimal impact on the overall rate of pneumococcal carriage due to replacement by nonvaccine serotypes (3, 8, 11). Reports demonstrating an inverse relationship between nasopharyngeal carriage of vaccine type S. pneumoniae and Staphylococcus aureus (2, 21, 22) and increases in the proportion of otitis media caused by nontypeable H. influenzae following PCV7 vaccination (1, 4, 41) generated concern that removal of vaccine type pneumococci from the nasopharynx could facilitate colonization by other respiratory pathogens. This study aimed to evaluate the effects of pneumococcal immunization on carriage of respiratory pathogens in a high-risk population.

A quantitative real-time PCR (qPCR) method was developed to measure S. pneumoniae, H. influenzae, M. catarrhalis, and S. aureus and applied to nasopharyngeal swabs collected from 17-month-old participants in a phase II pneumococcal vaccine trial in Suva, Fiji. The trial investigated appropriate infant dosing strategy of PCV7 and effects of a 23-valent polysaccharide (23vPPS; Pneumovax; Merck & Co., Inc.) booster given at 12 months. Enrollment, ethical approval, and swab collection and storage have been detailed previously (25, 27, 29). Swabs (collected in 2006 and 2007) in STGG media (19) were transported to Melbourne, Australia, on dry ice and stored at −80°C until use. The following sample groups were examined: group A (n = 54), who received three doses of PCV7 at 6, 10, and 14 weeks of age; group B (n = 48), who received three PCV7 doses plus a booster of 23vPPS at 12 months of age; and group H (n = 59), who were unvaccinated. Previous examination of pneumococcal serotypes showed that three doses of PCV7 led to a reduction in carriage of vaccine type S. pneumoniae that was sustained to the age of 17 months, whereas carriage rates of non-PCV serotypes were similar, and that 23vPPS had no impact on carriage (27).

Cells from a 100-μl aliquot of sample were lysed in 200 μl of 50 mM phosphate buffer, pH 6.7, containing 1 mg/ml lysozyme, 0.075 mg/ml mutanolysin, and 2 mg/ml proteinase K and incubated at 56°C for 45 min. An additional 2 mg/ml proteinase K and 1% SDS were added, and then cells were incubated at 56°C for 10 min. DNA was extracted and purified into 100 μl elution buffer using the QIAmp DNA minikit (Qiagen). DNA for standard curves was extracted from S. pneumoniae ATCC 6305, H. influenzae F412 (kindly provided by Cynthia Whitchurch, University of Technology, Sydney, Australia), S. aureus ATCC 29213, and M. catarrhalis ATCC 8176. We developed two quantitative duplex PCR assays, one to detect S. pneumoniae and S. aureus and another to detect H. influenzae and M. catarrhalis. S. pneumoniae was detected using previously published primers and probes (30). Primers for S. aureus detection were modified for use with a previously published probe (6) for enhanced sensitivity. Sequence alignment of M. catarrhalis copB from 14 available GenBank entries revealed that published probes (9, 30) hybridize to a variable region of the gene, so a new primer/probe set was designed to target a conserved region of this gene. This qPCR was coupled with an assay for H. influenzae that was developed to detect both typeable and nontypeable H. influenzae but not the closely related Haemophilus haemolyticus (38). Two microliters of DNA was used in each of two duplex qPCRs performed with Brilliant III Ultra-Fast QPCR master mix (Agilent Technologies) on a Stratagene Mx3005 real-time PCR instrument with an initial activation of 95°C for 3 min followed by 40 cycles of 95°C for 20 s and 60°C for 20 s. Table 1 details PCR primers (Sigma-Aldrich) and dually labeled probes (Eurogentec).

Table 1.

Sequences and concentrations of primers and probes for duplex quantitative PCRs to detect S. pneumoniae and S. aureus (reaction 1) and M. catarrhalis and H. influenzae (reaction 2)

Reaction Species and target gene Primer and probe sequencesa (5′–3′) [concn (nM)] Reference and/or source
1 S. pneumoniae lytA F, TCTTACGCAATCTAGCAGATGAAGC [96]; R, GTTGTTTGGTTGGTTATTCGTGC [96]; probe, FAM-TTTGCCGAAAACGCTTGATACAGGG-BHQ1 [96] 30
S. aureus nuc F, GTTGCTTAGTGTTAACTTTAGTTGTA [288]; R, GCACTATATACTGTTGGATCTTCAGAA [288]; probe, TxR-TGCATCACAAACAGATAACGGCGTAAATAGAAG-BHQ2 [192] 6, this study
2 M. catarrhalis copB F, CGTGTTGACCGTTTTGACTTT [96]; R, TAGATTAGGTTACCGCTGACG [96]; probe, Cy5-ACCGACATCAACCCAAGCTTTGG-BHQ3 [96] This study
H. influenzae hpd F, GGTTAAATATGCCGATGGTGTTG [96]; R, TGCATCTTTACGCACGGTGTA [288]; probe, HEX-TTGTGTACACTCCGT“T”GGTAAAAGAACTTGCAC-SpacerC3b [96] 38
a

F, forward; R, reverse; FAM, 6-carboxyfluorescein; BHQ1, black hole quencher 1; TxR, Texas red; HEX, hexachloro-6-carboxyfluorescein.

b

“T”, BHQ-1 (dT).

qPCR data were used to determine the carriage rate (% positive) and carriage density (CFU/ml) for each bacterial species. Fisher's exact test and the Mann-Whitney test were used to evaluate differences in rate and density, respectively. P values <0.05 were considered statistically significant. Associations were measured by calculating odds ratios (OR) and 95% confidence intervals (CI 95%).

Of the 161 NP swabs examined, at least one pathogen was identified in 141 (87.5%). M. catarrhalis was identified most frequently, found in 122 (75.8%) swabs, followed by S. pneumoniae (n = 92; 57.1%) and H. influenzae (n = 72; 44.7%). The overall carriage rate of S. aureus, 3.3%, was consistent with reports from the Gambia (12) and Western Australia, Australia (39). S. aureus carriage is typically highest in neonates and older children (2, 22, 23), and the nose, rather than the nasopharynx, is the primary ecological niche (40). Due to its low frequency, S. aureus was not included in subsequent analyses. The higher colonization rates of S. pneumoniae, H. influenzae, and M. catarrhalis were similar to those observed in high-risk populations (12, 16, 30, 39). Cocolonization was common, with 97 of 161 (60.2%) children colonized by multiple species compared with 44 (27.3%) colonized by one of the species tested. Positive associations between colonization by S. pneumoniae and M. catarrhalis (OR, 3.16; CI 95%, 1.49 to 6.71), S. pneumoniae and H. influenzae (OR, 3.85; CI 95%, 1.95 to 7.58), and M. catarrhalis and H. influenzae (OR, 6.70; CI 95%, 2.70 to 17.60) were found.

Regardless of 23vPPS booster status, vaccination with PCV7 did not affect carriage rates (Table 2) or densities (data not shown) of the four pathogens examined. The population of Fiji consists of 57% indigenous Fijians and 38% Indo-Fijians of Indian descent. The original vaccine trial was designed to approximate this breakdown in each vaccine group. As indigenous Fijian children are known to have higher rates of S. pneumoniae carriage (26), data were stratified by ethnicity and reanalyzed. Swabs from groups A, B, and H were collected from 99 Fijians and 54 Indo-Fijians (ethnicity self-reported upon enrollment). Indigenous Fijians (i) were more likely to carry two or more organisms (OR, 9.66; CI 95%, 4.49 to 20.77), (ii) had significantly higher carriage rates of S. pneumoniae, H. influenzae, and M. catarrhalis (Table 2), and (iii) had higher carriage densities of S. pneumoniae and M. catarrhalis (Fig. 1) than Indo-Fijians.

Table 2.

Nasopharyngeal carriage rates of S. pneumoniae, H. influenzae, and M. catarrhalis in Fijian children stratified by vaccine group and ethnicity

Species No. of positive samples/total no. of samplesa (%) for:
Vaccine group
Fijian group Indo-Fijian group
3 doses PCV7 3 doses PCV7 + 23vPPV No vaccine
S. pneumoniae 30/54 (56) 29/48 (60) 33/59 (56) 68/99 (69) 20/54 (37)*
H. influenzae 24/54 (44) 24/48 (50) 24/59 (41) 66/99 (67) 6/54 (11)*
M. catarrhalis 42/54 (78) 39/48 (81) 41/59 (70) 91/99 (92) 24/54 (44)*
a

*, P < 0.001. For all other comparisons, P was >0.05.

Fig 1.

Fig 1

Nasopharyngeal carriage densities of S. pneumoniae (S. pneu), H. influenzae (H. inf), and M. catarrhalis (M. cat) in indigenous Fijian (Fijian) and Indo-Fijian infants. The median and interquartile ranges are shown in gray. *, P < 0.05. For all other comparisons, P was >0.05.

Next, we examined the effects of pneumococcal vaccination separately for each ethnic group. No differences in carriage rates were observed (data not shown). Vaccination did not affect carriage densities of S. pneumoniae or H. influenzae in either indigenous Fijians or Indo-Fijians (Fig. 2A and B). Carriage densities of M. catarrhalis were significantly higher in indigenous Fijian children who received three doses of PCV7 plus a 23vPPV booster than in those who were unvaccinated or received PCV7 alone (Fig. 2C). This increase in M. catarrhalis density was not observed in Indo-Fijian children.

Fig 2.

Fig 2

Nasopharyngeal carriage densities of S. pneumoniae (A), H. influenzae (B), and M. catarrhalis (C) separated by vaccine group and ethnicity. The median and interquartile ranges are shown in gray. *, P < 0.01. For all other comparisons, P was >0.05.

In summary, vaccination of Fijian infants with PCV7 alone or with the 23vPPS booster did not affect nasopharyngeal carriage rates or densities of S. pneumoniae, H. influenzae, M. catarrhalis, and S. aureus. However, significant differences between the two major ethnic groups were found, with indigenous Fijians more likely to carry higher densities of multiple respiratory pathogens than Fijians of Indian descent.

Several studies investigated effects of pneumococcal vaccination on S. aureus, and most did not find any increases in S. aureus colonization associated with PCV7 (4, 5, 13) or PCV9 (14) vaccination. In contrast, van Gils et al. reported a temporary increase in S. aureus colonization at 12 months of age in infants who received three doses of PCV7 (34). The low carriage rate of S. aureus in our study hindered our ability to assess the impact of pneumococcal vaccination on its carriage in Fijian infants. Reported increases in the proportion of otitis media caused by H. influenzae and M. catarrhalis associated with PCV7 vaccination (1, 4, 41) may reflect the reduction in cases caused by vaccine type S. pneumoniae rather than true increases in disease caused by other pathogens. For example, Stamboulidis et al. noted that, following PCV7 immunization, the overall rate of acute otitis media with otorrhea and the incidence of S. pneumoniae- and H. influenzae-caused otorrhea declined, yet H. influenzae replaced S. pneumoniae as the predominant organism (31).

Revai et al. examined nasopharyngeal colonization during acute otitis media and found an increase in M. catarrhalis in PCV7-vaccinated children compared with unvaccinated historical controls (24). Consistent with our findings, studies on the effects of pneumococcal vaccination in healthy children found no increases in carriage of H. influenzae (14, 35) or M. catarrhalis (35). We used the final swabs collected during the study, taken at 17 months, 14 months after the last dose of PCV7 and 5 months after the 23vPPS booster. Therefore, any transient effects of pneumococcal vaccination would not have been observed in this study.

We found strong positive associations between carriage of S. pneumoniae, H. influenzae, and M. catarrhalis. Other researchers have reported similar associations between S. pneumoniae and H. influenzae (10, 12, 14), S. pneumoniae and M. catarrhalis (10, 12), and M. catarrhalis and H. influenzae (10, 37) in children of a comparable age. Pettigrew et al. (20) found negative associations between S. pneumoniae and H. influenzae and between M. catarrhalis and H. influenzae in children with upper respiratory infections, suggesting that the presence of an active infection may influence colonization dynamics. In our study, attributes of the host rather than the presence of a particular bacterial species seemed to be the dominant factor relating to the cocarriage of multiple pathogens. Host immunity likely plays a role in the negative association between S. aureus and S. pneumoniae, as this inverse relationship was not observed in HIV-positive children (14).

Indigenous Fijians have been shown to have higher incidence of pneumonia (15), invasive pneumococcal disease (28), and group A streptococcal disease (32) than Indo-Fijians. Reasons for this are unclear but may include genetic susceptibility, cultural practices, and/or environmental factors such as crowded living conditions. In our study, antibiotic use and monthly annual income levels were similar between the ethnicities but Fijian families had more children under 5 in the household, a risk factor for S. pneumoniae colonization (26). Differences in carriage between ethnic groups raise the possibility that vaccines targeting colonizing bacteria may have differential effects in different populations. Indeed, the 23vPPS booster was associated with increased carriage densities of M. catarrhalis in indigenous Fijians but not Indo-Fijians. Differences in susceptibilities to bacterial colonization warrant further investigation, and the high levels of carriage of multiple pathogens common in developing countries should be taken into consideration when designing and monitoring new pneumococcal vaccine introduction.

ACKNOWLEDGMENTS

This work was supported by funding from the Murdoch Childrens Research Institute and the Victorian Government's Operational Infrastructure Support Program.

We thank Heidi Smith-Vaughan and Michael Binks from the Menzies School of Health Research and Xin Wang from the Centers for Disease Control and Prevention for advice on assay development. We acknowledge the PneuCarriage Project team for expert technical assistance, the MCRI Clinical Epidemiology and Biostatistics Unit for helpful advice, and Eleanor Neal for manuscript editing. We sincerely thank all the families and staff on the Fiji Pneumococcal project.

Footnotes

Published ahead of print 14 December 2011

REFERENCES

  • 1. Block SL, et al. 2004. Community-wide vaccination with the heptavalent pneumococcal conjugate significantly alters the microbiology of acute otitis media. Pediatr. Infect. Dis. J. 23:829–833 [DOI] [PubMed] [Google Scholar]
  • 2. Bogaert D, et al. 2004. Colonisation by Streptococcus pneumoniae and Staphylococcus aureus in healthy children. Lancet 363:1871–1872 [DOI] [PubMed] [Google Scholar]
  • 3. Brugger SD, Frey P, Aebi S, Hinds J, Mühlemann K. 2010. Multiple colonization with S. pneumoniae before and after introduction of the seven-valent conjugated pneumococcal polysaccharide vaccine. PLoS One 5:e11638. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4. Casey JR, Adlowitz DG, Pichichero ME. 2010. New patterns in the otopathogens causing acute otitis media six to eight years after introduction of pneumococcal conjugate vaccine. Pediatr. Infect. Dis. J. 29:304–309 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5. Cohen R, et al. 2007. Pneumococcal conjugate vaccine does not influence Staphylococcus aureus carriage in young children with acute otitis media. Clin. Infect. Dis. 45:1583–1587 [DOI] [PubMed] [Google Scholar]
  • 6. Elizaquível P, Aznar R. 2008. A multiplex RTi-PCR reaction for simultaneous detection of Escherichia coli O157:H7, Salmonella spp. and Staphylococcus aureus on fresh, minimally processed vegetables. Food Microbiol. 25:705–713 [DOI] [PubMed] [Google Scholar]
  • 7. García-Rodríguez JÁ, Fresnadillo Martínez MJ. 2002. Dynamics of nasopharyngeal colonization by potential respiratory pathogens. J. Antimicrob. Chemother. 50:59–74 [DOI] [PubMed] [Google Scholar]
  • 8. Ghaffar F, et al. 2004. Effect of the 7-valent pneumococcal conjugate vaccine on nasopharyngeal colonization by Streptococcus pneumoniae in the first 2 years of life. Clin. Infect. Dis. 39:930–938 [DOI] [PubMed] [Google Scholar]
  • 9. Greiner O, Day PJ, Altwegg M, Nadal D. 2003. Quantitative detection of Moraxella catarrhalis in nasopharyngeal secretions by real-time PCR. J. Clin. Microbiol. 41:1386–1390 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10. Jacoby P, et al. 2007. Modelling the co-occurrence of Streptococcus pneumoniae with other bacterial and viral pathogens in the upper respiratory tract. Vaccine 25:2458–2464 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11. Kellner JD, et al. 2008. Effects of routine infant vaccination with the 7-valent pneumococcal conjugate vaccine on nasopharyngeal colonization with Streptococcus pneumoniae in children in Calgary, Canada. Pediatr. Infect. Dis. J. 27:526–532 [DOI] [PubMed] [Google Scholar]
  • 12. Kwambana B, Barer MR, Bottomley C, Adegbola RA, Antonio M. 2011. Early acquisition and high nasopharyngeal co-colonisation by Streptococcus pneumoniae and three respiratory pathogens amongst Gambian new-borns and infants. BMC Infect. Dis. 11:175. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13. Lee GM, et al. 2009. Epidemiology and risk factors for Staphylococcus aureus colonization in children in the post-PCV7 era. BMC Infect. Dis. 9:110. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14. Madhi SA, et al. 2007. Long-term effect of pneumococcal conjugate vaccine on nasopharyngeal colonization by Streptococcus pneumoniae—and associated interactions with Staphylococcus aureus and Haemophilus influenzae colonization—in HIV-infected and HIV-uninfected children. J. Infect. Dis. 196:1662–1666 [DOI] [PubMed] [Google Scholar]
  • 15. Magree HC, et al. 2005. Chest X-ray-confirmed pneumonia in children in Fiji. Bull. World Health Organ. 83:427–433 [PMC free article] [PubMed] [Google Scholar]
  • 16. Montgomery JM, et al. 1990. Bacterial colonization of the upper respiratory tract and its association with acute lower respiratory tract infections in highland children of Papua New Guinea. Rev. Infect. Dis. 12:S1006–S1016 [DOI] [PubMed] [Google Scholar]
  • 17. Murphy TF, Parameswaran GI. 2009. Moraxella catarrhalis, a human respiratory tract pathogen. Clin. Infect. Dis. 49:124–131 [DOI] [PubMed] [Google Scholar]
  • 18. O'Brien KL, et al. 2009. Burden of disease caused by Streptococcus pneumoniae in children younger than 5 years: global estimates. Lancet 374:893–902 [DOI] [PubMed] [Google Scholar]
  • 19. O'Brien KL, et al. 2001. Evaluation of a medium (STGG) for transport and optimal recovery of Streptococcus pneumoniae from nasopharyngeal secretions collected during field studies. J. Clin. Microbiol. 39:1021–1024 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20. Pettigrew MM, Gent JF, Revai K, Patel JA, Chonmaitree T. 2008. Microbial interactions during upper respiratory tract infections. Emerg. Infect. Dis. 14:1584–1591 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21. Quintero B, et al. 2011. Epidemiology of Streptococcus pneumoniae and Staphylococcus aureus colonization in healthy Venezuelan children. Eur. J. Clin. Microbiol. Infect. Dis. 30:7–19 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22. Regev-Yochay G, et al. 2004. Association between carriage of Streptococcus pneumoniae and Staphylococcus aureus in children. JAMA 292:716–720 [DOI] [PubMed] [Google Scholar]
  • 23. Regev-Yochay G, et al. 2009. Parental Staphylococcus aureus carriage is associated with staphylococcal carriage in young children. Pediatr. Infect. Dis. J. 28:960–965 [DOI] [PubMed] [Google Scholar]
  • 24. Revai K, et al. 2006. Effect of pneumococcal conjugate vaccine on nasopharyngeal bacterial colonization during acute otitis media. Pediatrics 117:1823–1829 [DOI] [PubMed] [Google Scholar]
  • 25. Russell FM, et al. 2009. Immunogenicity following one, two, or three doses of the 7-valent pneumococcal conjugate vaccine. Vaccine 27:5685–5691 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26. Russell FM, et al. 2006. Pneumococcal nasopharyngeal carriage and patterns of penicillin resistance in young children in Fiji. Ann. Trop. Paediatr. 26:187–197 [DOI] [PubMed] [Google Scholar]
  • 27. Russell FM, et al. 2010. Pneumococcal nasopharyngeal carriage following reduced doses of a 7-valent pneumococcal conjugate vaccine and a 23-valent pneumococcal polysaccharide vaccine booster. Clin. Vaccine Immunol. 17:1970–1976 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28. Russell FM, et al. 2010. Invasive pneumococcal disease in Fiji: clinical syndromes, epidemiology, and the potential impact of pneumococcal conjugate vaccine. Pediatr. Infect. Dis. J. 29:870–872 [DOI] [PubMed] [Google Scholar]
  • 29. Russell FM, et al. 2010. Safety and immunogenicity of the 23-valent pneumococcal polysaccharide vaccine at 12 months of age, following one, two, or three doses of the 7-valent pneumococcal conjugate vaccine in infancy. Vaccine 28:3086–3094 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30. Smith-Vaughan H, et al. 2006. Measuring nasal bacterial load and its association with otitis media. BMC Ear Nose Throat Disord. 6:10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31. Stamboulidis K, et al. 2011. The impact of the heptavalent pneumococcal conjugate vaccine on the epidemiology of acute otitis media complicated by otorrhea. Pediatr. Infect. Dis. J. 30:551–555 [DOI] [PubMed] [Google Scholar]
  • 32. Steer AC, et al. 2008. High burden of invasive beta-haemolytic streptococcal infections in Fiji. Epidemiol. Infect. 136:621–627 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33. van der Poll T, Opal SM. 2009. Pathogenesis, treatment, and prevention of pneumococcal pneumonia. Lancet 374:1543–1556 [DOI] [PubMed] [Google Scholar]
  • 34. van Gils EJM, et al. 2011. Effect of seven-valent pneumococcal conjugate vaccine on Staphylococcus aureus colonisation in a randomised controlled trial. PLoS One 6:e20229. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35. van Gils EJM, Veenhoven RH, Rodenburg GD, Hak E, Sanders EAM. 2011. Effect of 7-valent pneumococcal conjugate vaccine on nasopharyngeal carriage with Haemophilus influenzae and Moraxella catarrhalis in a randomized controlled trial. Vaccine 29:7595–7598 [DOI] [PubMed] [Google Scholar]
  • 36. Vergison A. 2008. Microbiology of otitis media: a moving target. Vaccine 26:G5–G10 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37. Verhaegh SJC, et al. 2011. Colonization of healthy children by Moraxella catarrhalis is characterized by genotype heterogeneity, virulence gene diversity and co-colonization with Haemophilus influenzae. Microbiology 157:169–178 [DOI] [PubMed] [Google Scholar]
  • 38. Wang X, et al. 2011. Detection of bacterial pathogens in Mongolia meningitis surveillance with a new real-time PCR assay to detect Haemophilus influenzae. Int. J. Med. Microbiol. 301:303–309 [DOI] [PubMed] [Google Scholar]
  • 39. Watson K, et al. 2006. Upper respiratory tract bacterial carriage in Aboriginal and non-Aboriginal children in a semi-arid area of Western Australia. Pediatr. Infect. Dis. J. 25:782–790 [DOI] [PubMed] [Google Scholar]
  • 40. Wertheim HFL, et al. 2005. The role of nasal carriage in Staphylococcus aureus infections. Lancet Infect. Dis. 5:751–762 [DOI] [PubMed] [Google Scholar]
  • 41. Wiertsema SP, et al. 2011. Predominance of nontypeable Haemophilus influenzae in children with otitis media following introduction of a 3 + 0 pneumococcal conjugate vaccine schedule. Vaccine 29:5163–5170 [DOI] [PubMed] [Google Scholar]

Articles from Journal of Clinical Microbiology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES