Skip to main content
Emerging Infectious Diseases logoLink to Emerging Infectious Diseases
. 2012 Feb;18(2):290–293. doi: 10.3201/eid1802.111305

Phylogeography of Francisella tularensis subsp. holarctica, Europe

Miklós Gyuranecz 1,2,3,4,5,6,7, Dawn N Birdsell 1,2,3,4,5,6,7, Wolf Splettstoesser 1,2,3,4,5,6,7, Erik Seibold 1,2,3,4,5,6,7, Stephen M Beckstrom-Sternberg 1,2,3,4,5,6,7, László Makrai 1,2,3,4,5,6,7, László Fodor 1,2,3,4,5,6,7, Massimo Fabbi 1,2,3,4,5,6,7, Nadia Vicari 1,2,3,4,5,6,7, Anders Johansson 1,2,3,4,5,6,7, Joseph D Busch 1,2,3,4,5,6,7, Amy J Vogler 1,2,3,4,5,6,7, Paul Keim 1,2,3,4,5,6,7, David M Wagner 1,2,3,4,5,6,7,✉
PMCID: PMC3310461  PMID: 22305204

Abstract

Francisella tularensis subsp. holarctica isolates from Austria, Germany, Hungary, Italy, and Romania were placed into an existing phylogeographic framework. Isolates from Italy were assigned to phylogenetic group B.FTNF002–00; the other isolates, to group B.13. Most F. tularensis subsp. holarctica isolates from Europe belong to these 2 geographically segregated groups.

Keywords: Francisella tularensis subsp. holarctica, bioterrorism, phylogeography, SNP, canSNP, zoonoses, Europe


Francisella tularensis is the etiologic agent of tularemia and a highly virulent category A biothreat agent (1,2). The most widely distributed subspecies is F. tularensis subsp. holarctica, which is found throughout much of the Northern Hemisphere and is the only subspecies found in Europe (3). Despite its wide geographic distribution, F. tularensis subsp. holarctica contains low genetic diversity, which indicates recent emergence (4). A recent global phylogeographic analysis (5), and several subsequent analyses (6–9), assigned most isolates from Europe to 2 phylogenetic groups: B.FTNF002–00 and B.13 (includes multiple subclades descended from branch B.13 [5,6,8]; branch and subclade nomenclature from [5] has been shortened by removing Br and extra 0s from individual branch and subclade names). These groups appear to be geographically segregated: only isolates from B.FTNF002–00 have been reported from the western European countries of Spain, France, and Switzerland, whereas B.13 is the only or dominant type reported from the Czech Republic, Finland, Georgia, Russia, Slovakia, and Ukraine (5–9). We provide additional information about the geographic distribution of these 2 groups using existing phylogenetic signatures (5,8) to place 45 isolates from Austria, Germany, Hungary, Italy, and Romania (Table A1) into the existing global phylogeographic framework.

The Study

All of the isolates were assigned to group B.FTNF002–00 or to group B.13. All 3 isolates from Italy were assigned to group B.FTNF002–00 (Figure 1, panel A). Although the sample size was small, these isolates were obtained in 3 different years (Table A1), which suggests that this group is ecologically established in Italy. These results increase the known geographic distribution of this group, which appears to be the dominant clone in western Europe (Figure 2, panel A, purple shading). All 42 isolates from Austria, Germany, Hungary, and Romania were assigned to group B.13 (Figure 1, panel A), further demonstrating that B.13 is the most prevalent group of F. tularensis subsp. holarctica in central and eastern Europe (Figure 2, panel A, red shading). Within group B.13, one isolate from Hungary was assigned to subclade B.23/14/25 (Figure 1, panel A); isolates from Finland, Russia, and Sweden were previously assigned to this subclade (6,8) (Figure 2, panel B). However, the other 41 isolates were assigned to subclade B.20/21 (Figure 1, panel A).

Figure 1.

Figure 1

Existing phylogeny of Francisella tularensis subsp. holarctica. A) Single nucleotide polymorphism (SNP)–based phylogeny of F. tularensis subsp. holarctica derived from previous studies (5,6,8). Terminal subgroups representing sequenced strains are shown as stars, and intervening nodes representing collapsed branches are indicated by circles. Subclades within group B.13 are depicted in red. Isolates from Austria, Germany, Hungary, Italy, and Romania (n = 45) were assigned to existing subclades (black arrows) by using existing canonical SNP assays (5,8). B) Maximum parsimony phylogeny constructed by using SNPs discovered from 6 F. tularensis whole-genome sequences, including 5 strains from group B.13 and an outgroup strain, OSU18 (not shown). This phylogeny was rooted by using OSU18, and bootstrap values were based on 1,000 simulations by using a heuristic search. The newly sequenced Hungarian strain (Tul07/2007) is highlighted in gray.

Figure 2.

Figure 2

Detailed geographic distribution and phylogeny of Francisella tularensis subsp. holarctica subclades within group B.13. A) Countries from which groups B.13 and B.FTNF002–00 have been reported. Countries of origin for isolates assigned to select subclades within group B.13 are indicated by the letters A–H. Red and purple shading indicates the known geographic distributions of groups B.13 and B.FTNF002–00, respectively, in this and previous studies (5–9). The country of Georgia, which also contains isolates from group B.13 but is not depicted in the map, is indicated by red text and a red arrow pointing toward its location. Isolates assigned to other phylogenetic groups within F. tularensis subsp. holarctica have been reported from some of these countries (5,8), but most isolates from these countries are from groups B.13 and B.FTNF002–00. B) Single nucleotide polymorphism–based phylogeny of previously (5,6,8) and newly identified subclades within the B.13 group of F. tularensis subsp. holarctica. Terminal subgroups representing sequenced strains are shown as stars, and intervening nodes representing collapsed branches are indicated by circles. The countries of origin for isolates assigned to each subclade are indicated: AUT, Austria; CE, central Europe, unknown country; CZE, Czech Republic; DEU, Germany; FIN, Finland; GEO, Georgia; HUN, Hungary; ITA, Italy; ROU, Romania; RUS, Russia; SWE, Sweden; UKR, Ukraine). For mapping purposes, letters are assigned to a previously identified subclade that contains a new isolate from Hungary now assigned to that subclade (A) and newly identified subclades (B–H). The number of isolates listed for each subclade refers only to isolates examined directly in this study (Table A1).

We identified new genomic signatures to provide increased genetic resolution within subclade B.20/21. Next-generation sequencing technology (Illumina Inc., San Diego, CA, USA) was used to sequence the genome of an isolate from Hungary (Tul07/2007, GenBank accession no. SRX025133) assigned to subclade B.20/21. Putative single nucleotide polymorphisms (SNPs) were identified in the resulting sequence and the genomes of 4 other strains previously assigned to group B.13 (LVS, AM233362.1; FSC 200, AASP00000000; RC503, SRX000104; Georgia F0673, SRX025885) by using an existing bioinformatics pipeline (5). The more distantly related strain OSU18 (CP000437.1) genome was also included as an outgroup. A maximum-parsimony tree was constructed by using the resulting ≈700 putative SNPs and PAUP 4.0b10 software (Sinauer Associates, Inc., Sunderland, MA, USA) (Figure 1, panel B). Most of the putative SNPs separated OSU18 from the B.13 strains (data not shown), but the remaining putative SNPs provided resolution among the B.13 strains, including 20 putative SNPs specific to the branch leading to the strain from Hungary (Figure 1, panel B). Consistent with previous analyses (Figure 1, panel A), the strain from Hungary clustered as a sister taxon to strain FSC 200 (Figure 1, panel B).

To show additional phylogenetic structure within subclade B.20/21, we designed genotyping assays targeting the 20 putative SNPs along the branch leading to the strain from Hungary (Figure 1, panel B) and screened them across 64 isolates assigned to subclade B.20/21. This analysis included the 41 isolates from Austria, Germany, Hungary, and Romania, as well as 23 additional isolates from central Europe, the Czech Republic, Finland, Russia, and Sweden that were previously assigned to this subclade (6,8) (Table A1). The assays were constructed and performed as described (5) by using an annealing temperature of 60°C. All 20 SNPs were laboratory confirmed, and 52 of the isolates were assigned to 6 new subclades (B.33/34, B.34/35, B.35/36, B.36/37, B.37/38, and B.Tul07/2007); the 12 other isolates remained in the basal subclade, now identified as B.20/21/33 (Figure 2, panel B; Table A1). Information about assays targeting canonical SNPs for the branches leading to the 6 new subclades are presented in the Table.

Conclusions

Our results are consistent with complex dispersal patterns within the B.13 group of F. tularensis subsp. holarctica. Several of the B.13 subclades identified in this study are broadly distributed throughout central and eastern Europe (Figure 2, panel A), including subclades B.20/21/33, B.33/34, and B.34/35. All of the new subclades containing >1 isolate have representatives from multiple countries (Figure 2, panel B). Other previously identified B.13 subclades, including B.27/28, B.LVS, B.23/14/25, and B.21/22 are also broadly distributed (Figure 2, panel A).

This study and previous studies have increased understanding of F. tularensis subsp. holarctica in Europe by placing isolates from multiple countries into the existing global phylogeographic framework. As a result, the genetic background is becoming defined for each country (i.e., the specific subtypes reported from each country). This information can be useful for identifying intentional (e.g., bioterrorism) or unintentional movement of F. tularensis subsp. holarctica between countries. For example, the isolate from Romania examined in this study was actually isolated in Italy from an infected hare that was shipped from Romania for hunting. Genotyping results are consistent with a Romanian origin for this isolate because it was assigned to the B.13 group that is widespread in central and eastern Europe (Figure 2, panel A) and not to the B.FTNF002–00 group, to which the isolates from Italy were assigned (Figure 1, panel A).

Understanding global phylogeographic patterns is possible only if isolates from multiple geographic locations are placed within the same framework (i.e., examined with the same genomic signatures). Because F. tularensis is genetically monomorphic and highly clonal, SNPs are preferred signatures for determining phylogenetic structure within this species (3). Vogler et al. (5) conducted the first SNP-based global phylogeographic analysis of F. tularensis. Subsequent studies (6–8) have used the SNP signatures described by Vogler et al. (5) and new SNPs discovered from new whole-genome sequences or multiple sequence typing data to further refine phylogeographic patterns within F. tularensis, particularly F. tularensis subsp. holarctica. These new signatures, when screened across diverse isolate collections, have identified new subclades within preexisting subclades. This pattern will continue as whole-genome sequencing becomes less expensive and more widely available. As a result, the nomenclature of phylogenetic groups within F. tularensis and the particular subclade to which a given isolate is assigned are constantly changing and will continue to change, which makes comparison of results and findings across different studies difficult. To address this problem, we have included all known F. tularensis subsp. holarctica SNP-based phylogenetic groups within our phylogenetic trees (Figure 1, panel A; Figure 2, panel B), including those discovered by other researchers. In addition, for the isolates analyzed in this study (Table A1), where applicable, we have listed the phylogenetic groups to which they were assigned in previous studies.

Acknowledgments

We thank Talima Pearson for helpful discussions and Megan Shuey for technical assistance with whole-genome sequencing.

This work was supported in part by the US Department of Homeland Security Science and Technology Directorate through awards HSHQDC-10-C-00139 and 2010-ST-108-000015.

Biography

Dr Gyuranecz is a postdoctoral fellow at the Veterinary Medical Research Institute, Hungarian Academy of Sciences, Budapest, Hungary. His primary research interest is zoonotic wildlife diseases.

Table A1. Isolates in study of the phylogeography of Francisella tularensis subsp. holarctica, Europe*.

ID no.† Original ID no.‡ Originating laboratory Country of origin Source§ Year Subclade from (5)¶# Subclade from (8)¶ ** Subclade from this study¶
F0586 AF19 BIM Austria Lepus europaeus 1997 13/14 20/21 33/34
F0587 AF9 BIM Austria L. europaeus 1996 13/14 20/21 33/34
F0589 AF6 BIM Austria L. europaeus 1994 13/14 20/21 33/34
F0590 AF5 BIM Austria L. europaeus 1997 13/14 20/21 33/34
F0591 AF3 BIM Austria L. europaeus 1997 13/14 20/21 33/34
F0599 AF22 BIM Austria L. europaeus 1997 13/14 20/21 33/34
F0595 AF54 BIM Austria L. europaeus 1994 13/14 20/21 34/35
F0597 AF36 BIM Austria Human 1997 13/14 20/21 34/35
F0588 AF8 BIM Austria L. europaeus 1995 13/14 20/21 36/37
F0614 DF161 BIM Germany Human 2007 13/14 20/21 33/34
F0616 DF159 BIM Germany L. europaeus 2007 13/14 20/21 33/34
F0620 DF155 BIM Germany Human 2007 13/14 20/21 33/34
F0626 DF163 BIM Germany Human 2007 13/14 20/21 33/34
F0627 DF162 BIM Germany Human 2007 13/14 20/21 33/34
F0634 DF170 BIM Germany L. europaeus 2007 13/14 20/21 33/34
F0639 DF193 BIM Germany L. europaeus 2008 13/14 20/21 33/34
F0640 DF194 BIM Germany L. europaeus 2008 13/14 20/21 33/34
F0641 DF195 BIM Germany L. europaeus 2008 13/14 20/21 33/34
F0642 DF196 BIM Germany L. europaeus 2008 13/14 20/21 33/34
F0643 DF197 BIM Germany L. europaeus 2008 13/14 20/21 33/34
F0601 DF101 BIM Germany Macaca fascicularis 2002 13/14 20/21 34/35
F0603 DF99 BIM Germany M. mulatta 2005 13/14 20/21 34/35
F0611 DF107 BIM Germany M. fascicularis 2005 13/14 20/21 34/35
F0617 DF158 BIM Germany L. europaeus 2007 13/14 20/21 34/35
F0621 DF169 BIM Germany L. europaeus 2007 13/14 20/21 34/35
F0625 DF164 BIM Germany L. europaeus 2007 13/14 20/21 34/35
F0704 T1 SZIU Hungary L. europaeus 2007 13/14 23/14/25 23/14/25
F0713 T17 SZIU Hungary L. europaeus 2008 13/14 20/21 20/21/33
F0714 T19 SZIU Hungary L. europaeus 2008 13/14 20/21 20/21/33
F0702 TM1 SZIU Hungary Chlorocebus aethiops 2003 13/14 20/21 33/34
F0703 TM2 SZIU Hungary Erythrocebus patas 2003 13/14 20/21 33/34
F0705 T3 SZIU Hungary L. europaeus 2007 13/14 20/21 33/34
F0706 T4 SZIU Hungary L. europaeus 2007 13/14 20/21 33/34
F0707 T6 SZIU Hungary L. europaeus 2007 13/14 20/21 33/34
F0709 T11 SZIU Hungary L. europaeus 2007 13/14 20/21 33/34
F0710 T12 SZIU Hungary L. europaeus 2007 13/14 20/21 33/34
F0711 T13 SZIU Hungary L. europaeus 2007 13/14 20/21 33/34
F0712 T14 SZIU Hungary L. europaeus 2008 13/14 20/21 33/34
F0716 T22 SZIU Hungary L. europaeus 2008 13/14 20/21 33/34
F0715 T21 SZIU Hungary L. europaeus 2008 13/14 20/21 34/35
F0708 T7 SZIU Hungary L. europaeus 2007 13/14 20/21 TUL07/2007
F0732 42055/2008 IZSLER Italy Natural spring water 2008 FTNF002–00 FTNF002–00 FTNF002–00
F0733 21851/2006 IZSLER Italy L. europaeus 2006 FTNF002–00 FTNF002–00 FTNF002–00
F0734 5768/2001 IZSLER Italy Human 2001 FTNF002–00 FTNF002–00 FTNF002–00
F0731 8660/1995 IZSLER Romania/ Italy L. europaeus 1995 13/14 20/21 33/34
F0433 Fr014 AFSSA Central Europe†† L. europaeus UNK 13/14 20/21 33/34
F0459 Fr040 AFSSA Central Europe L. europaeus UNK 13/14 20/21 37/38
F0188 FSC 181 SDRA Czech Republic Dermacentor reticulatus 1995 13/14 20/21 33/34
F0190 FSC 183 SDRA Czech Republic D. reticulatus 1995 13/14 20/21 33/34
F0191 FSC 184 SDRA Czech Republic D. reticulatus 1995 13/14 20/21 33/34
F0193 FSC 186 SDRA Czech Republic D. reticulatus 1995 13/14 20/21 33/34
F0194 FSC 187 SDRA Czech Republic Ixodes ricinus 1995 13/14 20/21 33/34
F0187 FSC 180 SDRA Czech Republic D. reticulatus 1995 13/14 20/21 34/35
F0189 FSC 182 SDRA Czech Republic D. reticulatus 1995 13/14 20/21 34/35
F0192 FSC 185 SDRA Czech Republic D. reticulatus 1995 13/14 20/21 34/35
F0035 FSC 080 SDRA Finland L. europaeus 1984 13/14 20/21 20/21/33
F0163 FSC 249 SDRA Finland Human 1995 13/14 20/21 20/21/33
F0025 FSC 121 SDRA Russia Water 1985 13/14 20/21 20/21/33
F0026 FSC 123 SDRA Russia Water 1983 13/14 20/21 20/21/33
F0030 FSC 151 SDRA Russia Water 1988 13/14 20/21 20/21/33
F0034 FSC 077 SDRA Sweden L. europaeus 1981 13/14 20/21 20/21/33
F0040 FSC 188 SDRA Sweden Human 1996 13/14 20/21 20/21/33
F0093 FSC 102 SDRA Sweden Human 1981 13/14 20/21 20/21/33
F0227 FSC 273 SDRA Sweden Human 2000 13/14 20/21 20/21/33
F0302 FSC 175 SDRA Sweden Human 1995 13/14 20/21 20/21/33
F0036 FSC 081 SDRA Sweden L. europaeus 1985 13/14 20/21 33/34
F0226 FSC 272 SDRA Sweden Human 2000 13/14 20/21 33/34
F0209 FSC 248 SDRA Sweden Human 2000 13/14 20/21 35/36

*ID, identification; BIM, Institut für Mikrobiologie der Bundeswehr; SZIU, Szent István University; IZSLER, Istituto Zooprofilattico Sperimentale della Lombardia e dell’Emilia Romagna; AFSSA, Agence Française de Sécurité Sanitaire des Aliments and Laboratoire d'Etudes et de Recherches en Pathologie Animale et Zoonoses; UNK, unknown; SDRA, Swedish Defense Research Agency.
†Isolate ID in the Northern Arizona University DNA collection.
‡Isolate ID from the originating laboratory.
§Lepus europaeus, European brown hare; Macaca fascicularis, long-tailed macaque; M. mulatta, rhesus monkey; Chlorocebus aethiops, vervet monkey; Erythrocebus patas, patas monkey; Ixodes ricinus, castor bean tick (sheep tick); Dermacentor reticulatus, marsh tick.
¶In the interest of space, subclade names have been truncated to remove the preceding B.Br. nomenclature because all of these subclades belong in the B clade of F. tularensis.
#Canonical single nucleotide polymorphism (canSNP) subclade originally defined in (5) and modified as described in the text.
**CanSNP subclade defined in (8). These names have been modified to conform to the nomenclature standard originally established by (5) and modified as described in the text.
††Country unknown.

Table. Melt-MAMA primers targeting canonical SNPs for 6 new phylogenetic branches in a study of Francisella tularensis subsp. holarctica, Europe*.

SNP SCHU† S4 position SNP state, D/A‡ Primers, 5′ → 3′§ Con, µM¶ Tm, °C
B.33 78,382 T/C A: ATTGCTACTTCTATTTACGCCAACAG 0.20 74.3
D: GGGGCGGGGCGGGGCATTGCTACTTCTATTTACGCCAAGAA 0.20 79.0
C: TGTGAACAACCAAGTTGGCTT 0.20
B.34 766,614 A/G A: GTAGCGAGCATTATTTGCTGGTTC 0.40 69.2
D: GGGGCGGGGCGGGGCTAGCGAGCATTATTTGCTGGGTT 0.20 78.6
C: ATAAAACTATAAATTTACATAAAATGAAAACTTCTC 0.20
B.35 239,479 A/C A: GCCTTAATCTAGTATTTTCGCTTATCTCC 0.40 70.3
D: GGGGCGGGGCGGGGCGCCTTAATCTAGTATTTTCGCTTATCACA 0.20 75.5
C: CGGGCTCTAAAATAAGATTTAAGTTAGTAAGT 0.20
B.36 1,599,292 A/C A: TATTATAGTTTCTAAAAACAGTCTAATTAATTTTG 0.60 69.0
D: GGGGCGGGGCGGGGCTATTATAGTTTCTAAAAACAGTCTAATTAATTGTT 0.20 73.9
C: GTTCGACCATGACTACAGTGTTG 0.20
B.37 318,602 T/C A: AACATTTTAGGAACTCTACGATGATAAACTTAAC 0.20 69.7
D: GGGGCGGGGCGGGGCCATTTTAGGAACTCTACGATGATAAACTTGAT 0.20 75.9
C: GAAATATCTCAATGAAATCTAATTTAACTAAAATCAC 0.20
B.38 166,885 C/T A: ATGCCATCAGCCATTTACTACTCACA 0.20 73.7
D: GGGGCGGGGCGGGGCCCATCAGCCATTTACTACTCCCG 0.20 80.1
C: CTTCCCTGATTTTCTAAGTTCTGCTTG 0.20

*Melt-MAMA, melt-mismatch amplification mutation assay; SNP, single nucleotide polymorphism; con, concentration; Tm, melting temperature for ancestral and derived Melt-MAMA amplification products.
†SCHU strain GenBank accession no. NC_006570.
‡SNP states are presented according to their orientation in the SCHU S4 reference genome (AJ749949.2): D, derived SNP state; A, ancestral SNP state.
§D, derived allele primer; A, ancestral allele primer; C, common primer; primer tails and antepenultimate mismatch bases are in lower case.
¶Final concentration of each primer in Melt-MAMA genotyping assays.

Footnotes

Suggested citation for this article: Gyuranecz M, Birdsell DN, Splettstoesser W, Seibold E, Beckstrom-Sternberg SM, Makrai L, et al. Phylogeography of Francisella tularensis subsp. holarctica, Europe. Emerg Infect Dis [serial on the Internet]. 2012 Feb [date cited]. Epub 2012 Jan 4. http://dx.doi.org/10.3201/eid1802.111305

1

These authors contributed equally to this article.

References

  • 1.Dennis DT, Inglesby TV, Henderson DA, Bartlett JG, Ascher MS, Eitzen E, et al. Tularemia as a biological weapon: medical and public health management. JAMA. 2001;285:2763–73. 10.1001/jama.285.21.2763 [DOI] [PubMed] [Google Scholar]
  • 2.Rotz LD, Khan AS, Lillibridge SR, Ostroff SM, Hughes JM. Public health assessment of potential biological terrorism agents. Emerg Infect Dis. 2002;8:225–30. 10.3201/eid0802.010164 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Keim P, Johansson A, Wagner DM. Molecular epidemiology, evolution, and ecology of Francisella. Ann N Y Acad Sci. 2007;1105:30–66. 10.1196/annals.1409.011 [DOI] [PubMed] [Google Scholar]
  • 4.Keim PS, Wagner DM. Humans and evolutionary and ecological forces shaped the phylogeography of recently emerged diseases. Nat Rev Microbiol. 2009;7:813–21. 10.1038/nrmicro2219 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Vogler AJ, Birdsell D, Price LB, Bowers JR, Beckstrom-Sternberg SM, Auerbach RK, et al. Phylogeography of Francisella tularensis: global expansion of a highly fit clone. J Bacteriol. 2009;191:2474–84. 10.1128/JB.01786-08 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Chanturia G, Birdsell DN, Kekelidze M, Zhgenti E, Babuadze G, Tsertsvadze N, et al. Phylogeography of Francisella tularensis subspecies holarctica from the country of Georgia. BMC Microbiol. 2011;11:139. 10.1186/1471-2180-11-139 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Pilo P, Johansson A, Frey J. Identification of Francisella tularensis cluster in central and western Europe. Emerg Infect Dis. 2009;15:2049–51. 10.3201/eid1512.080805 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Svensson K, Granberg M, Karlsson L, Neubauerova V, Forsman M, Johansson A. A real-time PCR array for hierarchical identification of Francisella isolates. PLoS ONE. 2009;4:e8360. 10.1371/journal.pone.0008360 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Vogler AJ, Birdsell DN, Lee J, Vaissaire J, Doujet CL, Lapalus M, et al. Phylogeography of Francisella tularensis ssp. holarctica in France. Lett Appl Microbiol. 2011;52:177–80. 10.1111/j.1472-765X.2010.02977.x [DOI] [PubMed] [Google Scholar]

Articles from Emerging Infectious Diseases are provided here courtesy of Centers for Disease Control and Prevention

RESOURCES