Skip to main content
Molecular Plant Pathology logoLink to Molecular Plant Pathology
. 2010 Oct 1;12(3):239–246. doi: 10.1111/j.1364-3703.2010.00665.x

CYP1, a hypovirus‐regulated cyclophilin, is required for virulence in the chestnut blight fungus

MIN‐MEI CHEN 1,†, MINGGUO JIANG 1,†, JINJIE SHANG 1, XIUWAN LAN 1, FENG YANG 1, JINGKUAN HUANG 1, DONALD L NUSS 2, BAOSHAN CHEN 1,✉
PMCID: PMC3313458  NIHMSID: NIHMS363303  PMID: 21355996

SUMMARY

Cyclophilins are peptidyl‐prolyl cis–trans isomerases that are highly conserved throughout eukaryotes and are the cellular target of the immunosuppressive drug cyclosporin A (CsA). We cloned cyp1, a cyclophilin A‐encoding gene in the phytopathogenic fungus Cryphonectria parasitica, and showed that this gene was downregulated following infection by a virulence‐attenuating hypovirus. The function of cyp1 was further investigated by construction of a cyp1 deletion mutant. Although the wild‐type C. parasitica strain EP155 was sensitive to CsA, the Δcyp1 strain was highly tolerant to CsA, indicating that CYP1 was the target of CsA. Deletion of cyp1 resulted in reduced virulence when inoculated to chestnut stems. Transcriptional analysis revealed that deletion of cyp1 also reduced transcript levels for genes encoding key components of the heterotrimeric guanosine triphosphate‐binding protein signalling pathway that are essential for sensing environmental cues and are involved in C. parasitica development and virulence.

INTRODUCTION

Cyclophilins are a family of proteins with peptidyl‐prolyl isomerase activity that are widely distributed among prokaryotes and eukaryotes, and associated with nuclear membranes, the cytoplasm, vesicles and Golgi bodies (Azhderian et al., 1993; Fischer et al., 1984; Gothel and Marahiel, 1999). In addition to possessing peptidyl‐prolyl cis–trans isomerase (PPIase) activity that catalyses the isoform transition of Xaa‐prolyl acid, cyclophilins promote protein folding by catalysing the isomerization of peptide bonds that precede proline residues (Lang et al., 1987; Schonbrunner et al., 1991). Cyclophilins have been reported to participate in diverse cellular functions, including cell signalling, macromolecule transport, cell cycle control and stress responses (see review by Wang and Heitman, 2005).

Human cyclophilin A is the target of the immunosuppressant cyclosporin A (CsA) (Handschumacher et al., 1984). The CsA–cyclophilin A complex compromises the immune response by inhibiting the calmodulin‐dependent phosphoprotein phosphatase calcineurin (Liu et al., 1991). Cyclophilins have also been reported to be essential for the ability of two very different fungal pathogens to cause disease in animals and plants. Genes for two cyclophilin A‐like proteins, CPA1 and CPA2, were cloned and disrupted in the human pathogenic fungus Cryptococcus neoformans. Deletion of cpa1 resulted in a reduction in virulence and an inability to grow at 39°C, whereas cpa2 was dispensable for both virulence and growth at 39°C (Wang et al., 2001). CYP1 (MgCYP1) of the rice blast fungus Magnaporthe grisea is required for the fungus to penetrate the leaf cuticle and to produce normal asexual spores (Viaud et al., 2002). In a second phytopathogenic fungus, Botrytis cinerea, which causes grey‐mould rot or Botrytis blight on bean and tomato leaves, disruption of the cyclophilin A‐encoding gene bcp1 altered symptom development (Viaud et al., 2003).

In our proteomic investigation of hypovirus infection of the chestnut blight fungus, Cryphonectria parasitica, the accumulation of a cyclophilin A homologue, CpCYP1, was found to be reduced two‐fold in the hypovirus‐infected strain EP713 compared with the wild‐type strain (J. Wang, M. Jiang, Y. Shi, J. Shang, B. Chen, unpublished data). In this article, we report the cloning and characterization of a cyclophilin‐encoding gene, cyp1, from C. parasitica. We found that cyp1 transcript accumulation was reduced following infection by a virulence‐attenuating hypovirus and that cyp1 disruption caused a profound reduction in fungal virulence. We also showed that the expression of key components of the heterotrimeric guanosine triphosphate (GTP)‐binding protein signalling pathway is reduced in cyp1 null mutants, providing the first evidence linking hypovirus‐mediated alterations in cyclophilin accumulation and G‐protein signal transduction.

RESULTS

Molecular cloning and characterization of cyp1

A 719‐bp gene transcript (GenBank Accession No. CLS2961) from a C. parasitica expressed sequence tag (EST) collection (Shang et al., 2008) was found to encode a partial peptide homologous to a PPIase. We named the corresponding gene cyp1. Using 5′‐ and 3′‐rapid amplification of cDNA ends (RACE), we obtained a full‐length cDNA consisting of 1323 bp, excluding the poly(A) tail, with a 543‐bp coding region, encoding a 181‐amino‐acid protein (named CYP1) of 20 kDa, a 99‐bp 5′‐untranslated region (UTR) and a 639‐bp 3′‐UTR. A blastx search of the putative protein revealed a high level of homology with cyclophilin A proteins of many organisms: Neurospora crassa (75.1%), M. grisea (63.4%), Homo sapiens (62.1%) and Cs. neoformans (57.5%) (Fig. 1). Functional domain analysis confirmed that MgCYP1 belongs to the PPIase family. The genomic sequence of cyp1 was obtained by screening an EP155 genomic library and sequencing the positive clones. Comparison of the full‐length cDNA and the corresponding genomic DNA revealed four introns and five exons for the cyp1 gene (Fig. 2B).

Figure 1.

Figure 1

Alignment of the deduced amino acid sequence of Cryphonectria parasitica CYP1 with cylophilins from fungi and humans. Amino acid sequences of cylophilins from Neurospora crassa (CAA35682), Magnaporthe grisea (AAG13968) and Homo sapiens (AAH05982) were downloaded from GenBank. Highly conserved sequences are found within the central portion, whereas sequence conservation is reduced in both N‐ and C‐terminal domains. Identical and conservative amino acids are shaded in yellow and blue, and blocks of similarity are shown in green.

Figure 2.

Figure 2

Phenotypes and Southern analysis of cyp1 knockout mutants. (A) Mutant colony morphologies on potato dextrose agar (PDA) plates. The fungal strains were cultured on the laboratory bench top at 24°C and the photograph was taken at day 14 post‐inoculation. (B) Southern analysis of the cyp1 null mutants. Fungal total DNAs were digested with HindIII and separated on a 1.0% agarose gel by electrophoresis. The hybridization probe was a 0.45‐kb fragment starting from the stop codon TAA of the cyp1 sequence (left). The sizes of the hybridizing bands for the wild‐type cyp1 and cyp1 disrupted mutants were 1.6 kb and 3.0 kb, respectively (right).

Semiquantitative reverse transcriptase‐polymerase chain reaction (RT‐PCR) analysis of mRNA extracted from 5‐day‐old cultures of C. parasitica wild‐type strain EP155 and hypovirus‐infected strain EP713 revealed that the cyp1 transcript level in EP713 was about 40% of that in the virus‐free isogenic strain EP155. These results matched well with the relative protein levels for the two strains (data not shown), suggesting that cyp1 is downregulated by hypovirus infection at the transcription level.

Phenotypes of CYP1 knockout mutant Δcyp1

Hygromycin‐resistant transformants resulting from transformation using a cyp1‐targeting replacement fragment were initially screened by PCR. Three PCR‐verified CYP1 knockout transformants were reduced to genetic homogeneity by isolation of hygromycin‐resistant colonies formed by corresponding germinating uninuclear asexual spores. Single, spore‐derived isolates, designated Δcyp1‐a, Δcyp1‐b and Δcyp1‐c, each from an independent original CYP1 knockout transformant, were further confirmed by Southern analysis (Fig. 2). When cultured on potato dextrose agar (PDA), all Δcyp1 isolates were indistinguishable in colony and hyphae morphology, conidial production level, asexual spore shape and spore germination rate from their parental strain Δku80 and the wild‐type strain EP155.

CsA can bind to fungal cyclophilin A homologues, resulting in reduced hyphal apical growth and morphological changes (Prokisch et al., 1997; 2002, 2003). To test whether CYP1 is the C. parasitica CsA receptor, sensitivity assays were performed by inoculating the tester strains onto PDA plates supplemented with increasing concentrations of CsA. The growth of strains EP155, EP713 and Δku80 was inhibited at a CsA level of 5 µg/mL, whereas the CYP1 deletion mutant Δcyp1 grew normally on PDA medium with CsA levels as high as 500 µg/mL, indicating that CYP1 is indeed the binding protein for CsA. We did not observe any intermediate growth at other tested CsA concentrations (5, 25, 50, 100 µg/mL) for the CYP1 null mutants, suggesting that tolerance to CsA is a qualitative, rather than a quantitative, trait in C. parasitica.

Deletion of CYP1 reduces C. parasitica virulence

The wild‐type strain EP155 is highly virulent and aggressively produces cankers on dormant chestnut stems, whereas hypovirus‐infected strain EP713 produces small cankers under similar conditions. The deletion of CYP1 resulted in a dramatic reduction in virulence. The canker sizes caused by Δcyp1 strains were significantly smaller (P≤ 0.01) than those caused by EP155 or Δku80, although still larger than those caused by hypovirus CHV1‐EP713‐infected strain EP713, suggesting that CYP1 is required for full virulence in C. parasitica. The virulence level of the Δcyp1 strain could be restored to the wild‐type level by re‐introducing a copy of the wild‐type cyp1 gene into the mutant (Fig. 3, Δcyp1‐com). Although significantly reduced in virulence, hypovirulence caused by deletion of cyp1 was not as severe as that caused by hypovirus infection. One possible explanation was that the virus may regulate multiple targets, other than CYP1, that collectively contribute to virulence.

Figure 3.

Figure 3

Virulence assay on chestnut stems. (A) Cankers induced by the tested strains. The wild‐type (EP155), starting (Δku80) and hypovirus‐infected (EP713) strains and cyp1‐deleted (Δcyp1) and cyp1‐complemented (Δcyp1‐com) mutants were inoculated onto Chinese chestnut (Castanea mollissima Blume) stems. The inoculated stems were kept at 24°C. The resulting cankers were photographed and measured at day 21 post‐inoculation. (B) Statistical analysis of virulence of the cyp1 null mutants. The assays were with four duplicates for each strain.

Deletion of cyp1 results in reduced accumulation of transcripts for components of the heterotrimeric GTP‐binding protein signalling pathway

Shang et al. (2008) performed a virtual reconstruction of the C. parasitica G‐protein signal transduction pathway that connected pheromone peptides with the transcription factor Ste12 (Deng et al., 2007) and contained heterologous trimeric G‐proteins (Gα, Gβ and Gγ) (Choi et al., 1995; Gao and Nuss, 1996) and mitogen‐activated protein (MAP) kinase CpMK2 (Choi et al., 2005). Real‐time RT‐PCR analysis of mRNA isolated from the parental Δku80 and mutant Δcyp1 strains revealed that transcript levels for genes encoding Gα, Gβ, Gγ, CpMK2 and Ste12 were all downregulated by different magnitudes, with Gγ and Ste12 being most severely suppressed, in the Δcyp1 strain (Fig. 4). In contrast, transcript levels for the gene cpmk1 encoding CpMK1 (Park et al., 2004), a kinase involved in the osmotic stress response, were upregulated by more than four‐fold. However, the mutants did not show a higher level of tolerance to osmotic stress than the parental Δku80 or wild‐type strain EP155 in PDA medium supplemented with various levels of sorbitol or KCl (data not shown).

Figure 4.

Figure 4

Quantification of transcript accumulation levels of component genes of the G‐protein signalling pathway. Transcript accumulations of cpg1, cpgb1, cpgc1, ste12, cpmk2 and cpmk1 (coding for Gα, Gβ, Gγ, Ste12, Cpmk2 and Cpmk1, respectively) in the cyp1 null mutant strain and the starting parental strain Δku80 were measured in parallel. After reverse transcription into cDNA with an oligo(dT) primer, cDNA was quantified by quantitative reverse transcriptase‐polymerase chain reaction (RT‐PCR) using primer sets specific to the target genes. The transcript accumulation level for each of the target genes in Δku80 was set at 1.0, and the corresponding levels in the cyp1 null mutant Δcyp1 (Δcyp1‐a) were expressed as a percentage of that of Δku80. Values were calculated from three independent experiments. Bars indicate mean deviations.

Deletion of CYP1 does not influence the accumulation of the hypovirus RNA

Paired inoculation of hypovirus‐infected strain EP713 with mutant Δcyp1 strains resulted in anastomosis and conversion of the Δcyp1 strains to the hypovirus infection phenotype, e.g. a loss of orange pigmentation and reduced conidiation. Agarose gel analysis of replicative viral double‐stranded RNA (dsRNA) isolated from the hypovirus‐converted Δcyp1 strains revealed that the accumulation level of CHV1‐EP713 viral dsRNA was comparable with that observed for strain EP713 (data not shown).

DISCUSSION

The reduction in virulence and associated phenotypic changes resulting from hypovirus infection of C. parasitica have been correlated with virus‐mediated alterations in several cellular signalling pathways, including G‐protein signal transduction (Chen et al., 1996; Choi et al., 1995; Kim et al., 2002; Larson et al., 1992). Transcriptional profiling studies have identified specific and common changes between hypovirus infection and Gαβγ pathway suppression of host gene transcript accumulation (Dawe et al., 2004). The observations reported here that (i) the gene for a highly conserved cyclophilin, cyp1, is downregulated by hypovirus infection, (ii) CYP1 is required for full fungal virulence, and (iii) CYP1 contributes to the regulated expression of multiple G‐protein signalling components, suggest a potential role for CYP1 in hypovirus‐mediated modulation of cellular G‐protein signalling and virulence.

Cryphonectria parasitica CYP1 (CpCYP1) shares extensive homology with cyclophilins from plant and human pathogenic fungi M. grisea CYP1 (MgCYP1) (63.4% identity) and Cs. neoformans CPA1 and CPA2 (both 57.5% identity). We also note that CpCYP1 shares a higher identity with saprophyte N. crassa cyclophilin A (75.1% identity) than with phytopathogenic M. grisea cyclophilin A (MgCYP1) (63.4% identity), an observation in accordance with the conclusion that C. parasitica is closer in phylogeny to N. crassa than to M. grisea, based on large‐scale EST comparisons (Shang et al., 2008)

The antifungal activity of CsA involves impairment of calcineurin activity mediated through a cyclophilin A–CsA complex (Odom et al., 1997). As reported for other fungi, deletion of C. parasitica cyp1 reduces significantly the sensitivity to CsA (>100‐fold). In Cs. neoformans, both cpa1 and cpa2 confer CsA sensitivity in an independent manner. The growth of wild‐type Cs. neoformans is inhibited completely at a CsA concentration of 100 µg/mL, whereas the cpa1 cpa2 double mutant grows well at this drug level (Wang et al., 2001). In the case of M. grisea, deletion of cyp1 raised the tolerance of the fungus to a CsA concentration from 100 µg/mL to 3000 µg/mL (Viaud et al., 2002). It would be interesting to test whether cyclophilin A genes from one fungal species function in other fungal species to gain insights into the functional evolutionary relationship between the fungal cyclophilins and calcineurins. In this regard, it has been reported recently that the cyclophilin 2 from rice could complement the yeast mutant lacking native Cyp2 (Kumari et al., 2009).

The conservation in fungal cyclophilin sequences and CsA binding function extends to a conserved role in fungal pathogenesis in fungi with very different infection mechanisms. Both M. grisea and B. cinerea employ specialized infectious structures, called appressoria, to facilitate penetration through leaf and stem surfaces into the underlying tissue of the plant host. The reduced virulence exhibited by the M. grisea CYP1 null mutant was accompanied by impaired penetration peg formation and appressorium turgor generation (Viaud et al., 2002). Infection structure formation was not altered for the B. cinerea null mutant, suggesting that the BCP1 cyclophilin is required for a later stage of infection, such as appressorium function, e.g. penetration, or in planta growth (Viaud et al., 2003). Cyclophilin CpCYP1 must play a very different role in the C. parasitica infection process, as this fungus does not form a specialized infection structure. Instead, C. parasitica infection requires a wound site for colonization by conidia, ascospores or hyphal fragments (Anagnostakis, 1982). The apparent conserved role of cyclophilin A for the virulence of fungal pathogens with very different infection strategies warrants further comparative studies.

Cyclophilins have been shown to be involved in the infection or replication of several human viruses. Although cyclophilins promote the infection and replication of hepatitis C virus (Gaither et al., 2010; Liu et al., 2009a) and papillomavirus type 16 (Bienkowska‐Haba et al., 2009), cyclophilin A impairs the replication of influenza A virus (Liu et al., 2009b). However, deletion of cyp1 did not alter the dsRNA accumulation of the hypovirus in C. parasitica. Whether there are other cyclophilins that are Cs insensitive and are involved in hypovirus replication remains to be investigated.

Several lines of evidence suggest that cyclophilin may regulate calcineurin independent of CsA. These include phenotypic similarities between the Cs. neoformans cpa1 cpa2 cyclophilin A double mutant and calcineurin mutants, including loss of virulence (Wang et al., 2001), and studies that indicate cyclophilin‐mediated regulation of calcineurin in Saccharomyces cerevisiae (Cardenas et al., 1994). However, there are sufficient differences between cyclophilin and calcineurin mutant strains for Cs. neoformans (Wang et al., 2001), M. grisea (Viaud et al., 2002) and B. cinerea (Viaud et al., 2003) to suggest that cyclophilin interacts with multiple targets in addition to calcineurin. Differences in transcriptional profiles for B. cinerea BCP1 null mutant and calcineurin null mutant strains support this view (Viaud et al., 2003). Targets that interact with CpCYP1 are currently under investigation.

EXPERIMENTAL PROCEDURES

Fungal strains and growth conditions

Cryphonectria parasitica wild‐type strain EP155 (ATCC38755), its isogenic strain EP713 (ATCC52571) harbouring hypovirus CHV1‐EP713, strain Δku80 (Lan et al., 2008) and cyp1 deletion strains Δcyp1 were all maintained on PDA (Difco, Detroit, MI, USA) at 22–24°C with a 12‐h light (1300–1600 lx) and 12‐h dark cycle, as described previously(Hillman et al., 1990). Cultures used for DNA and dsRNA isolation were grown in EP complete medium (Puhalla and Anagnostakis, 1971) for 4 days at room temperature with shaking at 200 r.p.m./min. The preparation and transformation of C. parasitica were carried out essentially as described previously (Churchill et al., 1990). Hygromycin (40 µg/mL) was included in the growth medium to provide for the selection of transformants.

Primers

All primers used in this study were synthesized by Sangon Biotech (Shanghai) Co., Ltd. (Shanghai, China). The names and sequences of the primers are listed in Table 1.

Table 1.

Primers used in this study.

Primer Sequence (5′–3′)
Cyp‐LF GCTTCTCGAATGCCTTGTCTGCA
Cyp‐LR ATATCATCTTCTGTCGACCTGCAGGCACGGAAGCAGGTTGAAGTAAAGG
Cyp‐RF TCTTTCTAGAGGATCCCCGGGTACCGGTGACATATGTTCCATTATCGCATG
Cyp‐RR TGGAAATTGTCCAGTCTTCGACC
Hyg‐F CTGAAATAAAGGGAGGAAGGG
Hyg‐R AGGACACACATTCATCGTAGG
Cyp‐raceR1 GGTGAAGTCACCACCCTGGAGCATGAAC
Cyp‐raceR2 CCAGTGCAGAGAGCACGGAAGTTCTCAG
18S‐R1 CATTGATTTCGGCCCCATC
18S‐F TCTCGAATCGCATGGCCT
18S‐R TTACCCGTTGTAACCACGGC
Cyp‐Fq GCTGTCCTTGACGTTACCGC
Cyp‐Rq AAGACTGAGTGGCTCGACGG
Cpga1‐F GCAACGAGGAGATCGAGAAC
Cpga1‐R GTGGACTTTCCGGATTCACC
Cpgb1‐F TGAAGCAGAGGGTCTCAAGG
Cpgb1‐R GGGAATCGCCTCGTGTGATC
Cpgc‐F ATCCTCCTGCTCCTCTGG
Cpgc‐R GAAGTCTTTGCTGCCTTGC
Ste12‐F AGCAGGCGCTACCACATGATGC
Ste12‐R ACTGGTCTGGCTGCCAATCGAC
Cpmk2‐F CAGTTTCCAAGCTTTCGTGTGTG
Cpmk2‐R CTTGGTGAGGTATGCGCAGATG
Cpmk1‐F CGCGAATATTGCTTTCTGGAG
Cpmk1‐R AAGGCACAAAGTAAGGTGGAC

Construction of cyp1 null mutants

A hygromycin B resistance (hph) cassette was used to replace the cyp1 gene in C. parasitica. Primer pairs Cyp‐LF/Cyp‐LR were used to amplify the 737‐bp left‐side flanking region and Cyp‐RF/Cyp‐RR were used to amply the 813‐bp right‐side flanking region of the cyp1 open reading frame (ORF) using total DNA from EP155 as template. Primer Cyp‐LR contained 26 nucleotides identical to the 5′‐end and primer Cyp‐RF contained 26 nucleotides identical to the 3′‐end of the hph cassette. The hph cassette was amplified with Pfu (Promega, Madison, WI, USA) using plasmid pCPXHy2 as template and Hyg‐F/Hyg‐R as primers. The 737‐bp left arm, the 2146‐bp hph cassette and the 813‐bp right arm were joined to form a 3.7‐kb cassette by fusion PCR. After verification by agarose gel electrophoresis and precipitation in ethanol, the PCR product was resuspended in TE buffer to a final concentration of 1 µg/µL and used to transform Δku80 protoplasts. Putative cyp1 disruptants were identified by PCR, selected for nuclear homogeneity by single‐spore isolation and further verified by Southern analyses. Confirmed transformants were designated as Δcyp1 strains. Gene cloning, PCR and Southern analyses were performed according to Sambrook and Russell (2001).

Complementation of cyp1 null mutant

A 4‐kb EcoRI and NotI genomic fragment containing the complete cyp1 transcript region (1.2 kb), promoter region (1.6 kb) and terminator region (1.2 kb) was released from an EP155 cosmid clone and inserted into the transformation vector pCPXG418 with G418 as selection marker to generate construct pCPX‐cyp1‐G418. CYP1 complemented strains were obtained by transforming Δcyp1 spheroplasts with construct pCPX‐cyp1‐G418. Selected transformants were subjected to single‐spore purification following a similar protocol to that described in the previous section, except that antibiotic G418 (20 µg/mL) was used as selection marker. CYP1 complement transformants were verified by both cyp1‐specific PCR and Southern blotting.

Determination of the 5′‐end sequence of cyp1 mRNA

The SMART™ RACE cDNA Amplification Kit (Clontech, Mountain View, CA, USA) was used to determine the exact 5′‐terminal sequence of the cyp1 transcript. Primers Cyp‐raceR1 and Cyp‐raceR2 were used to generate the cDNA for 5′‐terminus sequence analysis.

Quantification of gene transcript accumulation level

The relative accumulation levels of cyp1 transcripts in the wild‐type strain EP155 and hypovirus‐infected strain EP713 were examined by semiquantitative real‐time PCR, as described by Lin et al. (2007). Total cDNA was generated with oligo(dT) as primer and the cDNA of the 18S rRNA was generated with 18S‐R1 as primer, using a RevertAid™ First Strand cDNA Synthesis Kit (Fermentas, Glen Burnie, MD, USA). The primer sets used for the real‐time PCR were Cyp‐Fq and Cyp‐Rq for cyp1, and 18S‐F and 18S‐R. The PCRs were performed in a DNA Engine OPTICON 2 (MJ Research Incorporated, Waltham, MA, USA). Gene transcription levels of cpga1, cpgb1, cpgc1, ste12, cpmk2 and cpmk1 in the cyp1 null mutant Δcyp1 were determined by quantitative RT‐PCR with the following primers: Cpga1‐F and Cpga1‐R for cpga1; Cpgb1‐F and Cpgb1‐R for cpgb1; Cpgc‐F and Cpgc‐R for cpgc1; Ste12‐F and Ste12‐R for ste12; Cpmk2‐F and Cpmk2‐R for cpmk2; Cpmk1‐F and Cpmk1‐R for cpmk1.

Virulence assays

Virulence assays were performed on stems of Chinese chestnut (Castanea mollissima) with four replicates per fungal strain. Inoculated stems were kept at room temperature in a plastic bag to maintain moisture. Canker statistical analysis was performed using the ProcGLM procedure SAS (version 8.0), and the type I error rate was set at 0.05.

Sequence information

Sequences of the full‐length cDNA and genomic fragments containing the complete cyp1 coding region and portions of the flanking regions have been deposited in GenBank under Accession Numbers EU770253 and EU746409.

ACKNOWLEDGEMENTS

This work was supported in part by grants from the National Key Basic Research Program (2006CB101906), National Natural Science Foundation of China (30130020 and 39925003), International Collaboration Key Project (2001CB711104) and the Research Fund for Doctoral Program of Higher Education (20070593001) to BC, and by Public Health Service grant GM55981 to DLN.

REFERENCES

  1. Anagnostakis, S.L. (1982) Biological control of chestnut blight. Science, 29, 466–471. [DOI] [PubMed] [Google Scholar]
  2. Azhderian, E.M. , Kolipaka, J. , Lentz, S. and Lorber, M.I. (1993) Nuclear membrane‐associated cyclophilins of potential importance in cyclosporine immunosuppression. Transplant. Proc. 25, 524–526. [PubMed] [Google Scholar]
  3. Bienkowska‐Haba, M. , Patel, H.D. and Sapp, M. (2009) Target cell cyclophilins facilitate human papillomavirus type 16 infection. PLoS Pathog. 5, e1000524. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Cardenas, M.E. , Hemenway, C. , Muir, R.S. , Ye, R. , Fiorentino, D. and Heitman, J. (1994) Immunophilins interact with calcineurin in the absence of exogenous immunosuppressive ligands. EMBO J. 13, 5944–5957. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Chen, B. , Gao, S. , Choi, G.H. and Nuss, D.L. (1996) Extensive alteration of fungal gene transcript accumulation and elevation of G‐protein‐regulated cAMP levels by a virulence‐attenuating hypovirus. Proc. Natl. Acad. Sci. USA, 93, 7996–8000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Choi, E.S. , Chung, H.J. , Kim, M.J. , Park, S.M. , Cha, B.J. , Yang, M.S. and Kim, D.H. (2005) Characterization of the ERK homologue CpMK2 from the chestnut blight fungus Cryphonectria parasitica . Microbiology, 151, 1349–1358. [DOI] [PubMed] [Google Scholar]
  7. Choi, G.H. , Chen, B. and Nuss, D.L. (1995) Virus‐mediated or transgenic suppression of a G‐protein alpha subunit and attenuation of fungal virulence. Proc. Natl. Acad. Sci. USA, 92, 305–309. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Churchill, A.C.L. , Ciuffetti, L.M. , Hansen, D.R. , Etten, H.D. and Alfen, N.K. (1990) Transformation of the fungal pathogen Cryphonectria parasitica with a variety of heterologous plasmids. Curr. Genet. 17, 25–31. [Google Scholar]
  9. Dawe, A.L. , Segers, G.C. , Allen, T.D. , McMains, V.C. and Nuss, D.L. (2004) Microarray analysis of Cryphonectria parasitica Galpha‐ and Gbetagamma‐signalling pathways reveals extensive modulation by hypovirus infection. Microbiology, 150, 4033–4043. [DOI] [PubMed] [Google Scholar]
  10. Deng, F. , Allen, T.D. and Nuss, D.L. (2007) Ste12 transcription factor homologue CpST12 is down‐regulated by hypovirus infection and required for virulence and female fertility of the chestnut blight fungus Cryphonectria parasitica . Eukaryot. Cell, 6, 235–244. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Fischer, G. , Bang, H. and Mech, C. (1984) Determination of enzymatic catalysis for the cis–trans‐isomerization of peptide binding in proline‐containing peptides. Biomed. Biochim. Acta, 43, 1101–1111. [PubMed] [Google Scholar]
  12. Gaither, L.A. , Borawski, J. , Anderson, L.J. , Balabanis, K.A. , Devay, P. , Joberty, G. , Rau, C. , Schirle, M. , Bouwmeester, T. , Mickanin, C. , Zhao, S. , Vickers, C. , Lee, L. , Deng, G. , Baryza, J. , Fujimoto, R.A. , Lin, K. , Compton, T. and Wiedmann, B. (2010) Multiple cyclophilins involved in different cellular pathways mediate HCV replication. Virology, 397, 43–55. [DOI] [PubMed] [Google Scholar]
  13. Gao, S. and Nuss, D.L. (1996) Distinct roles for two G protein alpha subunits in fungal virulence, morphology, and reproduction revealed by targeted gene disruption. Proc. Natl. Acad. Sci. USA, 93, 14 122–14 127. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Gothel, S.F. and Marahiel, M.A. (1999) Peptidyl‐prolyl cis–trans isomerases, a superfamily of ubiquitous folding catalysts. Cell. Mol. Life Sci. 55, 423–436. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Handschumacher, R.E. , Harding, M.W. , Rice, J. , Drugge, R.J. and Speicher, D.W. (1984) Cyclophilin: a specific cytosolic binding protein for cyclosporin A. Science, 226, 544–547. [DOI] [PubMed] [Google Scholar]
  16. Hillman, B.I. , Shapira, R. and Nuss, D.L. (1990) Hypovirulence‐associated suppression of host functions in Cryphonectria parasitica can be partially relieved by high light intensity. Phytopathology, 80, 950–956. 934 ref. [Google Scholar]
  17. Kim, M.J. , Choi, J.W. , Park, S.M. , Cha, B.J. , Yang, M.S. and Kim, D.H. (2002) Characterization of a fungal protein kinase from Cryphonectria parasitica and its transcriptional upregulation by hypovirus. Mol. Microbiol. 45, 933–941. [DOI] [PubMed] [Google Scholar]
  18. Kumari, S. , Singh, P. , Singla‐Pareek, S.L. and Pareek, A. (2009) Heterologous expression of a salinity and developmentally regulated rice cyclophilin gene (OsCyp2) in E. coli and S. cerevisiae confers tolerance towards multiple abiotic stresses. Mol. Biotechnol. 42, 195–204. [DOI] [PubMed] [Google Scholar]
  19. Lan, X. , Yao, Z. , Zhou, Y. , Shang, J. , Lin, H. , Nuss, D.L. and Chen, B. (2008) Deletion of the cpku80 gene in the chestnut blight fungus, Cryphonectria parasitica, enhances gene disruption efficiency. Curr. Genet. 53, 59–66. [DOI] [PubMed] [Google Scholar]
  20. Lang, K. , Schmid, F.X. and Fischer, G. (1987) Catalysis of protein folding by prolyl isomerase. Nature, 329, 268–270. [DOI] [PubMed] [Google Scholar]
  21. Larson, T.G. , Choi, G.H. and Nuss, D.L. (1992) Regulatory pathways governing modulation of fungal gene expression by a virulence‐attenuating mycovirus. EMBO J. 11, 4539–4548. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Lin, H. , Lan, X. , Liao, H. , Parsley, T.B. , Nuss, D.L. and Chen, B. (2007) Genome sequence, full‐length infectious cDNA clone, and mapping of viral double‐stranded RNA accumulation determinant of hypovirus CHV1‐EP721. J. Virol. 81, 1813–1820. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Liu, J. , Farmer, J.D. Jr , Lane, W.S. , Friedman, J. , Weissman, I. and Schreiber, S.L. (1991) Calcineurin is a common target of cyclophilin–cyclosporin A and FKBP–FK506 complexes. Cell, 66, 807–815. [DOI] [PubMed] [Google Scholar]
  24. Liu, X. , Sun, L. , Yu, M. , Wang, Z. , Xu, C. , Xue, Q. , Zhang, K. , Ye, X. , Kitamura, Y. and Liu, W. (2009b) Cyclophilin A interacts with influenza A virus M1 protein and impairs the early stage of the viral replication. Cell. Microbiol. 11, 730–741. [DOI] [PubMed] [Google Scholar]
  25. Liu, Z. , Yang, F. , Robotham, J.M. and Tang, H. (2009a) Critical role of cyclophilin A and its prolyl‐peptidyl isomerase activity in the structure and function of the hepatitis C virus replication complex. J. Virol. 83, 6554–6565. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Odom, A. , Muir, S. , Lim, E. , Toffaletti, D.L. , Perfect, J. and Heitman, J. (1997) Calcineurin is required for virulence of Cryptococcus neoformans . EMBO J. 16, 2576–2589. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Park, S. , Choi, E.S. , Kim, M.J. , Cha, B.J. , Yang, M.S. and Kim, D.H. (2004) Characterization of HOG1 homologue, CpMK1, from Cryphonectria parasitica and evidence for hypovirus‐mediated perturbation of its phosphorylation in response to hypertonic stress. Mol. Microbiol. 51, 1267–1277. [DOI] [PubMed] [Google Scholar]
  28. Prokisch, H. , Yarden, O. , Dieminger, M. , Tropschug, M. and Barthelmess, I.B. (1997) Impairment of calcineurin function in Neurospora crassa reveals its essential role in hyphal growth, morphology and maintenance of the apical Ca2+ gradient. Mol. Gen. Genet. 256, 104–114. [DOI] [PubMed] [Google Scholar]
  29. Puhalla, J.E. and Anagnostakis, S.L. (1971) Genetics and nutritional requirements of Endothia parasitica . Phytopathology, 61, 169–173. [Google Scholar]
  30. Sambrook, J. and Russell, D.W. (2001) Molecular Cloning: A Laboratory Manual. New York: Cold Spring Harbor Laboratory Press. [Google Scholar]
  31. Schonbrunner, E.R. , Mayer, S. , Tropschug, M. , Fischer, G. , Takahashi, N. and Schmid, F.X. (1991) Catalysis of protein folding by cyclophilins from different species. J. Biol. Chem. 266, 3630–3635. [PubMed] [Google Scholar]
  32. Shang, J. , Wu, X. , Lan, X. , Fan, Y. , Dong, H. , Deng, Y. , Nuss, D.L. and Chen, B. (2008) Large‐scale expressed sequence tag analysis for the chestnut blight fungus Cryphonectria parasitica . Fungal Genet. Biol. 45, 319–327. [DOI] [PubMed] [Google Scholar]
  33. Viaud, M.C. , Balhadere, P.V. and Talbot, N.J. (2002) A Magnaporthe grisea cyclophilin acts as a virulence determinant during plant infection. Plant Cell, 14, 917–930. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Viaud, M. , Brunet‐Simon, A. , Brygoo, Y. , Pradier, J.M. and Levis, C. (2003) Cyclophilin A and calcineurin functions investigated by gene inactivation, cyclosporin A inhibition and cDNA arrays approaches in the phytopathogenic fungus Botrytis cinerea . Mol. Microbiol. 50, 1451–1465. [DOI] [PubMed] [Google Scholar]
  35. Wang, P. and Heitman, J. (2005) The cyclophilins. Genome Biol. 6, 226. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Wang, P. , Cardenas, M.E. , Cox, G.M. , Perfect, J.R. and Heitman, J. (2001) Two cyclophilin A homologs with shared and distinct functions important for growth and virulence of Cryptococcus neoformans . EMBO Rep. 2, 511–518. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Molecular Plant Pathology are provided here courtesy of Wiley

RESOURCES