Abstract
Homologous recombination (HR) is the major pathway for repairing double strand breaks (DSBs) in eukaryotes and XRCC2 is an essential component of the HR repair machinery. To evaluate the potential role of mutations in gene repair by HR in individuals susceptible to differentiated thyroid carcinoma (DTC) we used high resolution melting (HRM) analysis, a recently introduced method for detecting mutations, to examine the entire XRCC2 coding region in an Iranian population. HRM analysis was used to screen for mutations in three XRCC2 coding regions in 50 patients and 50 controls. There was no variation in the HRM curves obtained from the analysis of exons 1 and 2 in the case and control groups. In exon 3, an Arg188His polymorphism (rs3218536) was detected as a new melting curve group (OR: 1.46; 95%CI: 0.432–4.969; p = 0.38) compared with the normal melting curve. We also found a new Ser150Arg polymorphism in exon 3 of the control group. These findings suggest that genetic variations in the XRCC2 coding region have no potential effects on susceptibility to DTC. However, further studies with larger populations are required to confirm this conclusion.
Keywords: DNA repair, gene polymorphism, mutation analysis
Introduction
Thyroid cancer is the most common endocrine malignancy and its incidence has increased in recent years (Leenhardt et al., 2004; Davies and Welch, 2006; Jemal et al., 2008). Differentiated thyroid carcinoma (DTC) is the most common type of all thyroid carcinomas (accounting for ~90% of all cases) and consists of papillary, follicular and Hürthle cell carcinomas, the latter being a subtype of follicular thyroid carcinoma (Hundahl et al., 1998). Risk factors associated with DTC include exposure to various carcinogenic agents, ethnicity and dietary habits, although exposure to ionizing radiation is still the only recognized risk factor (Ron et al., 1995; Xiong et al., 2005; Preston et al., 2007).
Recent studies have proposed that genetic variation in conserved DNA repair systems may influence susceptibility to cancer (Gatzidou et al., 2010). These systems normally ensure the genetic intactness of cell populations such that any alteration in the genes related to these systems could lead to a defect in DNA repair pathways and ultimately affect the cellular genetic stability and susceptibility to cancer. In severe DNA damage, such as double-strand breaks (DSBs), there are two important recombination systems for cell survival, namely, homologous recombination (HR) and non-homologous end joining (NHEJ) (Paques and Haber, 1999; Peterson and Cote, 2004).
In eukaryotes, HR is the major pathway for DSB repair and has an important role in preventing mutations, chromosomal instability and cancer; these functions make HR essential for cell viability and genomic stability (Jackson, 2002; Thompson and Schild, 2002). The HR repair system functions primarily during the S and G2 phases of the cell cycle. Since HR is an error-free pathway of damage tolerance that allows the replication bypass of lesions during a template switch it has a distinct advantage over NHEJ (Jackson, 2002; Thompson and Schild, 2002).
The RAD51 gene family is the key component of HR and its impairment can lead to extreme sensitivity to certain DNA damaging agents, intense genomic instability and a risk of cancer (Sonoda et al., 1998; Cui et al., 1999; Deans et al., 2000, 2003; Takata et al., 2001; Gruver et al., 2005; Siraj et al., 2008). The RAD51-like gene family in somatic mammalian cells is composed of XRCC2, XRCC3, RAD51L1, RAD51L2 and RAD51L3 (Thacker, 1999). There are indications that XRCC2 has an important role in enhancing the action of RAD51, with a loss of XRCC2 delaying the early steps of HR, including the integration of RAD51 at the site of DNA damage, nucleoprotein filament formation and strand invasion (Sugawara et al., 2003; Wolner et al., 2003). In XRCC2-deficient cells, RAD51 responses are reduced by approximately five-fold, and this has led to XRCC2 being recognized as a repair response-enhancing factor (Tambini et al., 2010).
XRCC2 is a 29,668 kb gene located on human chromosome 7q36.1 and consists of three exons (1 to 3) that contain 38, 82 and 722 bp, respectively. XRCC2 protein is highly conserved among mammalian species (Tambini et al., 2010). Several studies have examined the association between genetic polymorphisms in XRCC2 and different cancers (Han et al., 2004; Jiao et al., 2008; Curtin et al., 2009). In the present report, we describe the first case-control study of an Iranian population to examine the association between mutations in the entire coding region of the XRCC2 gene and individual susceptibility to DTC based on high resolution melting (HRM) analysis, a recently introduced method for detecting mutations (Montgomery et al., 2010).
Materials and Methods
Study subjects
A sample size calculation (Kasiulevicious et al., 2006) indicated that the minimum sample size for this case-control study was ~45 for each group (controls and cases). In addition, the minimum odds ratio (OR) for significance was 2.5 (p < 0.05). The probability of having a mutant allele in the XRCC2 coding region in control individuals was estimated as 0.35. Based on these preliminary calculations, our study population consisted of 50 patients with histopathologically confirmed DTC and 50 controls. Informed consent was obtained from all participants before commencement of the study and the study was approved by the ethics committee of Tehran University of Medical Science. The DTC patients were recruited from the Research Institute for Nuclear Medicine of Shariati Hospital, Tehran, Iran. The control population was matched for age (≤ 50 and > 50 year) and sex, with no previous or concurrent malignant disease. The controls were recruited from volunteers at two academic centers in Tehran. Individuals with a history of other cancers, radiation exposure, alcohol consumption or smoking were excluded from the study.
DNA extraction
5 mL of peripheral blood was collected from each subject into tubes containing 1 mL of EDTA (1 g/dL) and stored at −20 °C until used. Whole blood DNA was extracted by a salting out procedure (Miller et al., 1988).
Primer design and assay conditions for PCR-HRM
One primer pair for exon 1 (Ex1), three primer pairs for exon 2 (Ex2) and three primer pairs for exon 3 (Ex3) were used in this work (Table 1). PCR-HRM was done in a Rotor-Gene 6000 real-time rotary analyzer (Corbett Life Sciences). The reactions were prepared in 10 μL volumes in 0.1 mL strip tubes of a 72-well rotor. For symmetric PCR-HRM, the amount of DNA in each reaction was adjusted to 50 ng. Each reaction contained 5 μL of 2 x HRM PCR Master Mix (Type-it HRM PCR kit, QIAGEN), 0.7 μL (10 μM) of primer mix, 1.5 μL (50 ng) of DNA and DNA RNase-free water to a final volume of 10 μL.
Table 1.
Exon number | Primer (5′ to 3′) | Amplicon size (bp) | PCR conditions |
---|---|---|---|
A | |||
Exon1 (Ex1) | F: TATTGCGCATGCTCCCGCC R: CCAATCCCCCGGGTTCCC |
277 | 95 °C, 5 min; 45 cycles (95 °C, 10 s; 64 °C, 30 s; 72 °C, 16 s); 72 °C, 5 min |
Exon2a (Ex2a) | F: GGTATAAATATAGATGTCTAGG R: GGTTCTATTTCTTTCAG |
118 | 95 °C, 5 min; 45 cycles (95 °C, 10 s; 52 °C, 30 s; 72 °C, 16 s); 72 °C, 5 min |
Exon2b (Ex2b) | F: CCTTCTCTCTTCTTTTATAAGC R: ACAGGTGAATCTTCATCAGC |
99 | 95 °C, 5 min; 45 cycles (95 °C, 10 s; 57 °C, 30 s; 72 °C, 16 s); 72 °C, 5 min |
Exon2c (Ex2c) | F: GACTTGAAGGTAGAAGTTCC R: CTTGTGAGGAGTATGTGTATAC |
164 | 95 °C, 5 min; 45 cycles (95 °C, 10 s; 56 °C, 30 s; 72 °C, 16 s); 72 °C, 5 min |
Exon3a (Ex3a) | F: CTTTCACATTCCAGTAAGTGTC R: GTAAAGTGTAAGAAGTAAGTGGG |
379 | 95 °C, 5 min; 45 cycles (95 °C, 10 s; 57 °C, 30 s; 72 °C, 16 s); 72 °C, 5 min |
Exon3b (Ex3b) | F: TCAAATACTGCCTGGGAAG R: CTGCCATGCCTTACAGAG |
373 | 95 °C, 5 min; 45 cycles (95 °C, 10 s; 57 °C, 30 s; 72 °C, 16 s); 72 °C, 5 min |
Exon3c (Ex3c) | F: CAAACTATAATGCAGAAAGCC R: GAGCCATGATTGTGCCAC |
376 | 95 °C, 5 min; 45 cycles (95 °C, 10 s; 64 °C, 30 s; 72 °C, 16 s); 72 °C, 5 min |
B | |||
Exon3b (Ex3b)-F | TCAAATACTGCCTGGGAAG | ||
Exon3b (Ex3b)-R | CTGCCATGCCTTACAGAG | 273, 265 | |
ARMs C (wild) | CCTTTTGATTTTGGATAGC | 95 °C, 2 min; 30 cycles (95 °C, 10 s; 58 °C, 30 s; 72 °C, 16 s); 72 °C, 4 min | |
Exon3b (Ex3b)-F | TCAAATACTGCCTGGGAAG | ||
Exon3b (Ex3b)-R | CTGCCATGCCTTACAGAG | 273, 147 | |
ARMs G (mutant) | TCCAGTAAAAAGCTGACAGC |
F- forward, R- reverse.
The PCR cycling profile is summarized in Table 1. After amplification, HRM analysis data were collected from 65 °C to 85 °C, with each step raised by 0.05 °C, followed by a waiting time of 10 s. Samples from the top, middle and bottom of each melting curve group and suspicious melting curves were sequenced. Any new mutation detected by PCR-HRM was screened for in the other samples by using the Allele Refractory Mutation System (ARMS). The ARMS primers and fragment lengths are listed in Table 1.
Statistical analysis
Hardy-Weinberg equilibrium of the XRCC2 alleles in the control population was assessed using the Chi square test (χ2). The homogeneity of age distribution between the controls and cases was assessed with an independent sample t-test and Levene’s test. Allelic and genotypic frequencies were compared across groups using the Chi square test. The odds ratio (OR) and the corresponding 95% confidence intervals (CIs) between DTC and a detected polymorphism were calculated using logistic regression. All analyses were done with SPSS v13 software.
Results
This study included 50 DTC patients and 50 cancer-free controls. The two groups were matched for sex and age (≤ 50 and > 50 years). The mean age (± SEM) in the cases and controls was 38.4 ± 2.1 and 36.2 ± 1.2 years, respectively. Age and sex were not significantly different between the two groups. The general characteristics of both groups are shown in Table 2.
Table 2.
Variable | Case n (%) | Control n (%) | p | OR (95% CI) |
---|---|---|---|---|
Age (years) | ||||
≤ 50 | 44 (88%) | 44 (88%) | 0.383 | |
> 50 | 6 (12%) | 6 (12%) | ||
Sex | ||||
Male | 12 (24%) | 12 (24%) | 1.000 | |
Female | 38 (76%) | 38 (76%) | ||
Genotype (Arg188His) | ||||
GG | 43 (86%) | 45 (90%) | 0.38a | 1.46 (0.432–4.969)b |
GA | 7 (14%) | 5 (10%) | ||
Allele frequency | ||||
G | 93 (0.93%) | 95 (0.95%) | 0.39 a | 1.43 (0.438–4.666)c |
A | 7 (0.07%) | 5 (0.05%) |
One tailed chi-squared analysis comparing genotype distributions and allelic frequencies between cases and controls.
OR (95%CI) GA to GG genotype (Arg188His) of XRCC2 for case vs. control groups.
OR (95%CI) A to G allele (Arg188His) of XRCC2 for case vs. control groups.
HRM analysis results
HRM analysis showed no variations in the melt phase analysis curves for the Ex1, Ex2a, Ex2b, Ex2c, Ex3a and Ex3c fragments in the case and control groups. A new melting curve group was detected in the Ex3b fragment compared to the normal melting curves retrieved from the wild type genotype group (Figure 1). To confirm the existence of a single nucleotide polymorphism (SNP) in the Ex3b fragment, the samples in this group were subjected to DNA sequencing and a previously reported polymorphism (Arg188His, rs3218536) was detected in all of them. No His/His alleles were found in the population. Table 2 summarizes the distributions of the allelic and genotypic frequencies in the case and control groups.
Another suspicious melting curve was identified in the Ex3b fragment and DNA sequencing confirmed a novel missense mutation (AGC → AGG, Ser150Arg) in one sample of the control group. No mutation was detected in the other samples screened for this mutation using ARMS.
The difference between the Arg188His and Arg188 genotypic frequencies was not significant and there was no significant association between DTC and the G and A allelic frequencies (Table 2).
Discussion
In this study, we used HRM analysis to screen for genetic mutations in the entire coding region of the XRCC2 gene and examined the association between these mutations and DTC in a subpopulation from Tehran, Iran. HRM analysis is an innovative technique for genotyping that is based on DNA melting analysis such that any alteration in genotype leads to variation in the HRM curves when compared to the wild type (Montgomery et al., 2010). To our knowledge, this is the first time that the entire coding region of the XRCC2 gene has been analyzed. Two polymorphisms, CGC → CAC (Arg188His, rs3218536) and AGC → AGG (Ser150Arg), were identified in Ex3b of the XRCC2 gene. To detect the Arg188His polymorphism we distinguished between wild homozygote (G::C) and heterozygote (A::T, G::C) samples based on a discernible melting transition (Figure 1A).
There was no significant association between DTC and the Arg188His polymorphism and its genotypic frequency in the individuals studied (Table 2). Bastos et al. (2009) and Garcia-Quispes et al. (2011) also found no significant involvement of the XRCC2 Arg188His polymorphism in thyroid cancer in 109 (OR: 0.8, 95%CI: 0.4–1.6) and 402 (OR: 1.12, 95%CI: 0.80–1.59) patients, respectively. There are currently no additional data on the relationship between the XRCC2 Arg188His polymorphism and thyroid cancer.
A recent meta-analysis by Yu et al. (2010) reported that there was no evidence of a significant association between XRCC2 Arg188His and the risk of breast cancer in any genetic model. A meta-analysis of three case-control studies in the United Kingdom and a family-based study in the United States found no association between a putatively functional Arg188His SNP and colorectal cancer (Curtin et al., 2009). Similarly, a meta-analysis of 16 studies compiled by the International Ovarian Cancer Association Consortium showed there was also no association between Arg188His and the risk of ovarian cancer (Pearce et al., 2009). However, the XRCC2 Arg188His polymorphism may be a genetic modifier for smoking-related pancreatic cancer (Jiao et al., 2008).
Alignment of the protein sequence of human XRCC2 with that of other species revealed an Arg188His substitution in Gallus gallus and Pongo abelii (Figure 2). Furthermore, Arg188 is not present at the active site of three XRCC2 proteins. This finding suggests that the Arg188His polymorphism generated in homologous recombination repair pathway may not have severe effects on XRCC2 function and may not influence the susceptibility to cancer in humans.
We detected a novel missense mutation (AGC → AGG, Ser150Arg) in the XRCC2 gene in one sample of the control group. In this G::C conversion, bases switched strands but the GC content was conserved and the melting transitions of heterozygote, wild and variant homozygotes were not clearly distinguishable (Cai et al., 2010). We therefore used PCR-ARMS to detect this SNP in other samples. Ser150, which is involved in the formation of the ATP binding site in XRCC2, is highly conserved among species (Figure 2). Consequently, an Arg substitution at this position (replacing a neutral amino acid by a positively charged one) would most probably affect the formation of the ATP binding site. However, protein expression studies are needed to confirm this hypothesis.
The major limitation of this study is the sample size, which may be due to lesser probability of detecting any rare mutations in smaller sample size. On the other hand, for detected SNP, the larger sample size would make the results more significant. In this regard, the coexistence of other members of the Rad51 gene family with an impaired function alongside Arg188His should be considered since these proteins are also involved in the HR repair system. For example, Bastos et al. (2009) showed that the coexistence of three or more variant alleles in the RAD51 and XRCC3 genes was associated with a significantly higher risk of DTC (OR = 2.9, p = 0.036; four variant alleles: adjusted OR = 8.0, p = 0.006), while no associations were observed for polymorphisms in XRCC3 alone (Bastos et al., 2009; Garcia-Quispes et al., 2011).
In conclusion, our findings indicate that there is no association between polymorphisms in the XRCC2 coding region and the risk of DTC. However, further studies with a larger population are needed to confirm this conclusion. In addition, it would be prudent for other members of the Rad51 gene family also to be screened for SNPs in their coding region. Finally, HRM analysis was found to be very useful for genotyping, although it was unable to distinguish between G::C and A::T conversions because of the low melting curve transition. Other complementary methods are needed to overcome this limitation.
Acknowledgments
This research was supported by Tehran University of Medical Sciences & Health Services (grant no. 89-01-30-10489). We thank the Department of Biochemistry, Pasteur Institute of Iran for contribution in study design and HRM experiments. We also thank Dr. Anis Jafari and Mr. Naser Nejadi for editing the manuscript.
References
- Bastos HN, Antao MR, Silva SN, Azevedo AP, Manita I, Teixeira V, Pina JE, Gil OM, Ferreira TC, Limbert E, et al. Association of polymorphisms in genes of the homologous recombination DNA repair pathway and thyroid cancer risk. Thyroid. 2009;19:1067–1075. doi: 10.1089/thy.2009.0099. [DOI] [PubMed] [Google Scholar]
- Cai Y, Yuan Y, Lin Q, Chan P. Allele-specific extension allows base-pair neutral homozygotes to be discriminated by high-resolution melting of small amplicons. Anal Biochem. 2010;406:29–33. doi: 10.1016/j.ab.2010.06.043. [DOI] [PubMed] [Google Scholar]
- Cui X, Brenneman M, Meyne J, Oshimura M, Goodwin EH, Chen DJ. The XRCC2 and XRCC3 repair genes are required for chromosome stability in mammalian cells. Mutat Res. 1999;434:75–88. doi: 10.1016/s0921-8777(99)00010-5. [DOI] [PubMed] [Google Scholar]
- Curtin K, Lin WY, George R, Katory M, Shorto J, Cannon-Albright LA, Smith G, Bishop DT, Cox A, Camp NJ. Genetic variants in XRCC2: New insights into colorectal cancer tumorigenesis. Cancer Epidemiol Biomarkers Prev. 2009;18:2476–2484. doi: 10.1158/1055-9965.EPI-09-0187. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Davies L, Welch HG. Increasing incidence of thyroid cancer in the United States, 1973–2002. JAMA. 2006;295:2164–2167. doi: 10.1001/jama.295.18.2164. [DOI] [PubMed] [Google Scholar]
- Deans B, Griffin CS, Maconochie M, Thacker J. Xrcc2 is required for genetic stability, embryonic neurogenesis and viability in mice. EMBO J. 2000;19:6675–6685. doi: 10.1093/emboj/19.24.6675. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Deans B, Griffin CS, O’Regan P, Jasin M, Thacker J. Homologous recombination deficiency leads to profound genetic instability in cells derived from Xrcc2-knockout mice. Cancer Res. 2003;63:8181–8187. [PubMed] [Google Scholar]
- Garcia-Quispes WA, Perez-Machado G, Akdi A, Pastor S, Galofre P, Biarnes F, Castell J, Velazquez A, Marcos R. Association studies of OGG1, XRCC1, XRCC2 and XRCC3 polymorphisms with differentiated thyroid cancer. Mutat Res. 2011;709–710:67–72. doi: 10.1016/j.mrfmmm.2011.03.003. [DOI] [PubMed] [Google Scholar]
- Gatzidou E, Michailidi C, Tseleni-Balafouta S, Theocharis S. An epitome of DNA repair related genes and mechanisms in thyroid carcinoma. Cancer Lett. 2010;290:139–147. doi: 10.1016/j.canlet.2009.08.007. [DOI] [PubMed] [Google Scholar]
- Gruver AM, Miller KA, Rajesh C, Smiraldo PG, Kaliyaperumal S, Balder R, Stiles KM, Albala JS, Pittman DL. The ATPase motif in RAD51D is required for resistance to DNA interstrand crosslinking agents and interaction with RAD51C. Mutagenesis. 2005;20:433–440. doi: 10.1093/mutage/gei059. [DOI] [PubMed] [Google Scholar]
- Han J, Hankinson SE, Hunter DJ, De Vivo I. Genetic variations in XRCC2 and XRCC3 are not associated with endometrial cancer risk. Cancer Epidemiol Biomarkers Prev. 2004;13:330–331. doi: 10.1158/1055-9965.epi-03-0332. [DOI] [PubMed] [Google Scholar]
- Hundahl SA, Fleming ID, Fremgen AM, Menck HR. A National Cancer Data Base report on 53,856 cases of thyroid carcinoma treated in the U.S., 1985–1995. Cancer. 1998;83:2638–2648. doi: 10.1002/(sici)1097-0142(19981215)83:12<2638::aid-cncr31>3.0.co;2-1. [DOI] [PubMed] [Google Scholar]
- Jackson SP. Sensing and repairing DNA double-strand breaks. Carcinogenesis. 2002;23:687–696. doi: 10.1093/carcin/23.5.687. [DOI] [PubMed] [Google Scholar]
- Jemal A, Siegel R, Ward E, Hao Y, Xu J, Murray T, Thun MJ. Cancer statistics, 2008. CA Cancer J Clin. 2008;58:71–96. doi: 10.3322/CA.2007.0010. [DOI] [PubMed] [Google Scholar]
- Jiao L, Hassan MM, Bondy ML, Wolff RA, Evans DB, Abbruzzese JL, Li D. XRCC2 and XRCC3 gene polymorphism and risk of pancreatic cancer. Am J Gastroenterol. 2008;103:360–367. doi: 10.1111/j.1572-0241.2007.01615.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kasiulevicious V, Sapoka V, Filipaviciute R. Sample size calculation in epidemiological studies. Gerontologija. 2006;7:225–231. [Google Scholar]
- Leenhardt L, Grosclaude P, Cherie-Challine L. Increased incidence of thyroid carcinoma in France: A true epidemic or thyroid nodule management effects? Report from the French Thyroid Cancer Committee. Thyroid. 2004;14:1056–1060. doi: 10.1089/thy.2004.14.1056. [DOI] [PubMed] [Google Scholar]
- Miller SA, Dykes DD, Polesky HF. A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic Acids Res. 1988;16:1215. doi: 10.1093/nar/16.3.1215. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Montgomery JL, Sanford LN, Wittwer CT. High-resolution DNA melting analysis in clinical research and diagnostics. Expert Rev Mol Diagn. 2010;10:219–240. doi: 10.1586/erm.09.84. [DOI] [PubMed] [Google Scholar]
- Paques F, Haber JE. Multiple pathways of recombination induced by double-strand breaks in Saccharomyces cerevisiae. Microbiol Mol Biol Rev. 1999;63:349–404. doi: 10.1128/mmbr.63.2.349-404.1999. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Pearce CL, Near AM, Van Den Berg DJ, Ramus SJ, Gentry-Maharaj A, Menon U, Gayther SA, Anderson AR, Edlund CK, Wu AH, et al. Validating genetic risk associations for ovarian cancer through the International Ovarian Cancer Association Consortium. Br J Cancer. 2009;100:412–420. doi: 10.1038/sj.bjc.6604820. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Peterson CL, Cote J. Cellular machineries for chromosomal DNA repair. Genes Dev. 2004;18:602–616. doi: 10.1101/gad.1182704. [DOI] [PubMed] [Google Scholar]
- Preston DL, Ron E, Tokuoka S, Funamoto S, Nishi N, Soda M, Mabuchi K, Kodama K. Solid cancer incidence in atomic bomb survivors: 1958–1998. Radiat Res. 2007;168:1–64. doi: 10.1667/RR0763.1. [DOI] [PubMed] [Google Scholar]
- Ron E, Lubin JH, Shore RE, Mabuchi K, Modan B, Pottern LM, Schneider AB, Tucker MA, Boice JD., Jr Thyroid cancer after exposure to external radiation: A pooled analysis of seven studies. Radiat Res. 1995;141:259–277. [PubMed] [Google Scholar]
- Siraj AK, Al-Rasheed M, Ibrahim M, Siddiqui K, Al-Dayel F, Al-Sanea O, Uddin S, Al-Kuraya K. RAD52 polymorphisms contribute to the development of papillary thyroid cancer susceptibility in Middle Eastern population. J Endocrinol Invest. 2008;31:893–899. doi: 10.1007/BF03346438. [DOI] [PubMed] [Google Scholar]
- Sonoda E, Sasaki MS, Buerstedde JM, Bezzubova O, Shinohara A, Ogawa H, Takata M, Yamaguchi-Iwai Y, Takeda S. Rad51-deficient vertebrate cells accumulate chromosomal breaks prior to cell death. EMBO J. 1998;17:598–608. doi: 10.1093/emboj/17.2.598. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Sugawara N, Wang X, Haber JE. In vivo roles of Rad52, Rad54, and Rad55 proteins in Rad51-mediated recombination. Mol Cell. 2003;12:209–219. doi: 10.1016/s1097-2765(03)00269-7. [DOI] [PubMed] [Google Scholar]
- Takata M, Sasaki MS, Tachiiri S, Fukushima T, Sonoda E, Schild D, Thompson LH, Takeda S. Chromosome instability and defective recombinational repair in knockout mutants of the five Rad51 paralogs. Mol Cell Biol. 2001;21:2858–2866. doi: 10.1128/MCB.21.8.2858-2866.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Tambini CE, Spink KG, Ross CJ, Hill MA, Thacker J. The importance of XRCC2 in RAD51-related DNA damage repair. DNA Repair (Amst) 2010;9:517–525. doi: 10.1016/j.dnarep.2010.01.016. [DOI] [PubMed] [Google Scholar]
- Thacker J. A surfeit of RAD51-like genes? Trends Genet. 1999;15:166–168. doi: 10.1016/s0168-9525(99)01733-3. [DOI] [PubMed] [Google Scholar]
- Thompson LH, Schild D. Recombinational DNA repair and human disease. Mutat Res. 2002;509:49–78. doi: 10.1016/s0027-5107(02)00224-5. [DOI] [PubMed] [Google Scholar]
- Wolner B, van Komen S, Sung P, Peterson CL. Recruitment of the recombinational repair machinery to a DNA double-strand break in yeast. Mol Cell. 2003;12:221–232. doi: 10.1016/s1097-2765(03)00242-9. [DOI] [PubMed] [Google Scholar]
- Xiong P, Zheng R, Wang LE, Bondy ML, Shen H, Borer MM, Wei Q, Sturgis EM. A pilot case-control study of gamma-radiation sensitivity and risk of papillary thyroid cancer. Thyroid. 2005;15:94–99. doi: 10.1089/thy.2005.15.94. [DOI] [PubMed] [Google Scholar]
- Yu KD, Chen AX, Qiu LX, Fan L, Yang C, Shao ZM. XRCC2 Arg188His polymorphism is not directly associated with breast cancer risk: Evidence from 37,369 subjects. Breast Cancer Res Treat. 2010;123:219–225. doi: 10.1007/s10549-010-0753-y. [DOI] [PubMed] [Google Scholar]