Region specific changes in TRPV channel expression in the vasopressin magnocellular system in hepatic cirrhosis induced hyponatremia

Abstract

The purpose of this study was to measure the expression of transient receptor potential (TRP) channels in the magnocellular neurons of the paraventricular (PVN) and supraoptic nucleus (SON) in an animal model of hepatic cirrhosis associated with inappropriate vasopressin (AVP) release. In these studies we used chronic bile duct ligation (BDL) in the rat, a commonly used model of hepatic cirrhosis, associated with elevated plasma AVP. This study tested the hypothesis that changes in TRPV channel expression may be related to inappropriate AVP release in BDL rats. To test our hypothesis, we utilized laser capture microdissection of AVP neurons in the PVN and SON and Western blot analysis from brain punches. Laser capture microdissection and qRT-PCR demonstrated elevated TRPV2 mRNA in the PVN and SON of BDL as compared to sham ligated controls. AVP transcription was also increased as determined using intron specific primers to measure heteronuclear RNA. Immunohistochemistry demonstrated increased AVP and TRPV2 positive cells in both the PVN and SON after BDL. Also, there was an increased co-expression of TRPV2 and AVP cells after BDL. However, there was no change in the colocalization counts of TRPV2 and OXY in both the magnocellular regions evaluated. In the SON but not the PVN, transcription levels of TRPV4 was also significantly increased in BDL rats Western Blot analysis of punches containing the PVN and SON revealed that TRPV2 protein content was significantly increased in these brain regions in BDL rats compared to sham. Our data suggests that regionally specific changes in TRPV expression in the MNC AVP neurons could alter their osmosensing ability.

Introduction

The peptide hormone vasopressin is synthesised in the magnocellular neurosecretory cells (MNC) of the supraoptic nucleus (SON) as well as the paraventricular nucleus (PVN) in the hypothalamus. It is then transported via axons to the posterior pituitary where it is released into peripheral circulation in response to changes in plasma osmolality and blood pressure/volume. The physiological role of vasopressin involves regulation of fluid balance, blood pressure and serum osmolality. Pathophysiological conditions that are associated with elevated plasma vasopressin concentrations include hepatic cirrhosis, congestive heart failure and syndrome of inappropriate antidiuretic hormone secretion (SIADH). Increased release of vasopressin leads to dilutional hyponatremia and the accumulation of fluid in the abdominal cavity or ascites associated with cirrhosis (1–5). Dilutional hyponatremia, produced by elevated plasma vasopressin, has been identified as an indicator of poor prognosis in patients with congestive heart failure (6–9). Mortality and morbidity associated with dilutional hyponatremia is chiefly attributed to disturbances in the central nervous system (10). Vasopressin receptor antagonists have been shown to improve serum sodium concentration by increasing renal solute-free water excretion (11–17). The use of vasopressin antagonists in animal models of hepatic cirrhosis to improve sodium levels and eliminate water has also been reported (18–23). Increased levels of circulating vasopressin that occur during cirrhosis are reported to be the result of a functional decrease in effective plasma volume and systemic hypotension related to portal hypertension (1–5, 24). Although nonosmotic mechanisms likely contribute to inappropriate vasopressin release related to cirrhosis, changes in the intrinsic osmosensitivity of MNCs may be necessary for sustained vasopressin release to occur in the face of progressive hypoosmolality.

In vitro electrophysiological studies have shown that hyperosmotic stimulation directly affects SON neurones by causing membrane depolarization which has subsequently been shown to be mediated by a mechano-sensitive cation conductance, whilst hypoosmotic stimulation produces hyperpolarization (25–27). This intrinsic osmosensitivity of MNCs have been shown to contribute to a complex osmotic response that also involves synaptic modulation (25, 27, 28). Transient receptor potential (TRP) channels contribute to the intrinsic osmo- and thermo-sensitivity of the CNS. Specifically, two different members of the vanilloid subfamily, TRPV4 and a splice variant of TRPV1 have been shown to contribute to central osmoreception (29–33). The TRPV1 variant has been shown to contribute to osmosensitivity in SON and OVLT (27, 29, 32, 34). In addition, TRPV2 has been identified in primate MNCs (35), and, we have recently confirmed that TRPV2 is expressed in vasopressin neurones in rat SON and PVN (Unpublished Observations). Water deprivation increases the expression of TRPV2 in the SON in the rat (36).

Chronic bile duct ligation (BDL), a commonly used animal model of obstructive cirrhosis, is associated with elevated circulating vasopressin, cytokines, and activation of the renin-angiotensin system (33, 37–40). In this model, TRPV4 protein content is increased in the SON as is its expression in lipid rafts within the hypothalamus (41). These observations were made using punch samples containing the SON and, therefore, are not specific to vasopressin MNCs. One goal of the present study was to extend these observations by determining whether changes in TRPV4 protein in the SON of BDL rats are associated with changes in gene expression using laser capture microdissection (LCM) to more specifically localize these changes to vasopressin MNCs. In addition, LCM was used to examine the expression of other TRPV channels in vasopressin MNCs in normal and BDL rats to determine whether or not these channels are similarly affected by BDL.

Materials and Methods

Animals

Experiments were conducted on adult male Sprague-Dawley rats (250–350g, Charles River Laboratories, Inc., Wilmington, MA, USA). Rats were individually housed and maintained in a temperature-controlled (23°C) environment under a 12: 12h light/dark cycle with light onset at 0700h. Rats had ad libitum access to food and water except during the surgical procedures. All experimental procedures were conducted in accordance with the guidelines of the Public Health Service and were approved by the University of North Texas Health Science Centre Institutional Animal Care and Use Committee.

Bile Duct ligation model of hepatic cirrhosis

Each animal was anesthetized with 2% isoflurane. After anaesthetisation, the abdomen was shaved and the area was cleaned with povidone iodine antiseptic. A midline incision was performed on the abdomen and the common bile duct was isolated by blunt dissection and cut between the two ligatures. Each animal was then returned to the cage and monitored daily until used for the experiment. Visual inspection of ascitic fluid in the peritoneal cavity was performed daily after surgery. Any rat showing morbidity or ascites of greater than 10% of the body weight was euthanized (Inactin 150 mg/kg ip). Sham ligated controls were subjected to the same surgical procedure with the exception that the bile duct was not ligated or cut. All rats were used for experiments 4 weeks after surgery. Liver fibrosis was observed in successful bile duct ligated animals. Liver/body weight ratio was used to verify the development of hepatic cirrhosis.

Micropunch and dissection of forebrain tissues

Tissue sites containing the SON or PVN were micropunched from forebrain for Western blot analysis. Each rat was anesthetized with thiobutabarbital (Inactin, Sigma, St. Louis, MO; 100 mg/kg ip) and quickly decapitated. Isolated brain was placed in a commercially available brain matrix (Stoelting, Wood Dale, IL). The matrix was used to cut the brain into 1-mm coronal slabs with razor blades. Then, the desired regions from this 1-mm-thick slice were micropunched with 1-ml syringes equipped with blunt 23-gauge needles. Tissue samples were collected from the SON and PVN. The punch samples were placed in microcentrifuge tubes and frozen on dry ice. Punches were sonicated in 35 μl of modified radioimmunoprecipitation buffer (RIPA) supplemented with protease and phosphatase inhibitors followed by 30 min incubation on ice. The total homogenates were then centrifuged at 10,000 rpm, 20 min at 4°C and the supernatant (total lysate) transferred to new clear tubes. Total protein concentration was determined by the Bradford method. Five or ten micrograms of total lysate were resolved by SDS-PAGE, and followed by Western blot analysis. Trunk blood was collected from each rat into a 1.5ml microcentrifuge tube for analysis of plasma osmolality and plasma hematocrit. Two heparin-containing capillary tubes were filled with blood from this sample for measuring hematocrit in duplicates. The rest of the sample was centrifuged and a 200-μl sample of serum was removed for measuring osmolality using a vapour pressure osmometer (Wescor, Logan, UT).

Western Blot

Micropunch total lysates were loaded onto 10% acrylamide SDS gel, eletrophoresed in Tris-glycine buffer under denaturing conditions and transferred to nitrocellulose membrane (Bio-Rad, Hercules, CA) in Tris-glycine buffer with 10–20% methanol. Membranes were blocked for 1 h at room temperature with 5% (wt/vol) non-fat milk in Tris-buffered saline 0.05% (vol/vol) Tween 20 (TBS-Tween; 50 mM Tris base, 200 mM NaCl, 0.05% Tween 20). Membranes were then incubated overnight at 4°C with primary antibody raised against a synthetic peptide corresponding to amino acids 744–761 of rat vanilloid receptor like protein 2 (rabbit anti-TRPV2, Calbiochem, EMD Chemicals Inc. Gibbstown, NJ). Blots were rinsed 3 times 10 min each with TBS 0.05% Tween 20 and then incubated at room temperature for 1 h in a horseradish peroxidase conjugated secondary antibody against the primary antibody host species (1:5,000; Sigma). The immunoreactive bands were detected by enhanced chemiluminescence (ECL reagents; Amersham, Piscataway, NJ) by acquiring digital gel images from Syngene G-box (Frederick, MD) Densitometry of immunoreactive bands of interest was analysed using Image J software.

Double Immunofluorescence for TRPV2 and AVP

Rats were perfused transcardially with 0.1M Phosphate buffered saline (PBS) followed by 4% paraformaldehyde (PFA) after deep anesthetization with an intraperitoneal injection of thiobutabarbital (Inactin, Sigma, 100 mg/kg). Brains were removed, post-fixed in 4% PFA for 2h, and then transferred to 30% sucrose-PBS for 2–3 days. Forebrains were sectioned coronally at 40 μm on a Leica cryostat. Four serial sets of coronal sections from each rat brain were placed in cryoprotectant and stored at −20°C in multiwall tissue culture plates until they were processed for immunohistochemistry (IHC). Forebrain sections were washed 5 times in PBS for 10 min each and then incubated in 0.3% hydrogen peroxide for 30min at room temperature. This was followed by incubation in PBS containing 3% horse serum and 0.25% Triton-X for 2h. The sections were then incubated overnight at 4°C in a cocktail of primary antibodies directed against TRPV2 and AVP. The primary antibody for TRPV2 was raised against a synthetic peptide corresponding to amino acids 744–761 of rat vanilloid receptor like protein 2 (rabbit anti-TRPV2, Calbiochem, EMD Chemicals Inc. Gibbstown, NJ) at a concentration of 1μg/ml. A second set of forebrain sections were utilized to validate the specificity of the TRPV2 antibody by using unconjugated control peptide (10ug/ml) as internal control that was provided by the supplier. The primary antibody for vasopressin (AVP) was a commercially available polyclonal guinea pig anti-(Arg⁸)-Vasopressin (Peninsula Laboratories, San Carlos, CA) used at a concentration of 1:1000. After overnight incubation, the sections were rinsed for 4–5 times followed by sequential incubation in Cy3-conjugated Affinipure Donkey Anti-Guinea Pig IgG (Jackson ImmunoResearch, West Grove, PA) secondary antibody for 4 h followed by Dylight 488-conjugated Affinipure Donkey Anti-Rabbit IgG (Jackson ImmunoResearch, West Grove, PA) for another 4 h, followed by PBS rinsing. The sections were then mounted on gelatin coated slides, air dried overnight and then cover slipped with Vectashield (Vector Laboratories).

Double Immunofluorescence for TRPV2 and OXY

Another set of forebrain sections was incubated overnight at 4°C in a cocktail of primary antibodies directed against TRPV2 and OXY. The primary antibody for oxytocin was a mouse monoclonal (Millipore, Billerica, MA) used at a concentration of 1:10000. After overnight incubation, the sections were incubated in a cocktail of secondary having both Cy3-conjugated Affinipure Anti-Mouse IgG and Dylight 488-conjugated Affinipure Donkey Anit-Rabbit IgG (Jackson ImmunoResearch, West Grove, PA) for 4hrs.

Confocal Imaging

Olympus IX-2 DSU confocal microscope equipped for epifluorescence and appropriate excitation/emission filter sets was used for imaging TRPV2/AVP positive cells and TRPV2/OXY positive cells in the PVN and the SON. Images were captured using a Q-imaging Retiga-SRV camera. Brain areas were identified using Paxinos and Watson (42). For double immunostaining with AVP, sections containing SON located −0.80 mm to −1.80 mm posterior to bregma were analysed. For PVN, sections located at −1.40 mm to −2.12 mm posterior to bregma were analysed. Image J software was used to adjust for uniform brightness and contrast, pseudocoloring, for merging and for counting cells.

Laser Capture Microdissection of the magnocellular vasopressinergic neurones

Separate group of animals were used for the laser capture microdissection protocol. 4 weeks after BDL each rat was anesthetized with Inactin (100 mg/kg ip) and quickly decapitated. The brains were taken out immediately and snap frozen in cooled isopentane and 10μm thick serial sections were cut through the hypothalamus at the level of the SON and PVN. These sections were mounted onto PEN membrane coated slides (Catalogue# LCM0522- Arcturus Bioscience) with 2–3 forebrain sections representing the SON and PVN mounted on the membrane part of a slide. These slides were then stored in −80°C until further processing. Quick Immunostaining of vasopressin neurones was carried out as reported earlier from our lab (43). Briefly, after fixing the brain tissues in ice cold 100% methanol and subsequent washings in DEPC-PBS, the sections were blocked in DEPC-PBS diluent for 5 min followed by incubation in 1:50 guinea pig anti-AVP diluted in DEPC-PBS diluent for 3 min followed by incubation in 1:50 cy3 donkey anti-guinea pig secondary antibody for another 3 min. All the reactions contained RNAse inhibitor added to them.

Laser Capture and RNA extraction

An Arcturus Veritas Microdissection instrument, which utilizes the IR capture laser with a UV cutting laser, was used to laser capture the AVP labelled neurones (43). Neurones that were selected for removal exhibited visible and complete staining of the cytoplasmic compartment. The infrared laser beam was positioned above the brain tissue which is placed between the PEN membrane slide and the capture cap coated with a thermal plastic. The focused laser beam pulse melted the plastic onto the region of interest, allowing removal of the selected AVP labelled cells from the tissue.

RNA extraction and amplification

All steps are carried out in an RNAse free environment. The capture cap containing 7–10 neurones from one rat was immediately transferred to a 0.5ml tube containing 30 μl of ArrayPure Nano-Scale Lysis Solution with 5.0 μg of proteinase K (prod. no. MPS04050; Epicentre Biotechnol Inc. Madison, WI, USA Total RNA was isolated from the collected vasopressin cells using ArrayPure Nano-Scale RNA Purification Kit reagents (Epicentre Biotechnology) as previously described (43). All RNA samples were stored at −80°C. Single-cell RNA samples were evaluated using a Nanodrop Spectrophotometer(Nanodrop 2000c Spectrophotometer, Thermoscientific) to measure the RNA content and identify contamination in the sample. Any sample that yielded less than 20 ng/μl RNA and/or had lower than 1.8 for the 260/280 ratio was not used for amplification. An aliquot of 1–2 μl per cellular RNA sample was amplified with TargetAmp 2-Round Aminoallyl-aRNA Amplification Kit materials (Epicentre Biotechnol Inc.), in accordance with the manufacturer’s instructions. A total of 10 rats (5 BDL and 5 Shams) were used for laser capture and subsequent RNA studies.

qRT- PCR

Less than 50 ng of the synthesised aminoallyl-aRNA from laser-micro dissected vasopressin cells was reverse-transcribed to cDNA with Sensiscript RT Kit reagents (prod. no.205213; Qiagen Inc., Valencia, CA, USA), in accordance with the manufacturer’s instructions. A single RT reaction mixture consisted of 2μl of 10X RT buffer, 2μl of dNTP mix (final concentration: 5 mM), 2μl of oligo-dT primer solution (final concentration: 10 μm), 1 μl of RNase inhibitor (final concentration: 10 U/μl), 1μl of Sensiscript reverse transcriptase solution, and aRNA dissolved in sufficient RNase-free water to yield a total volume of 20 μl. Forward and reverse primers for target genes (Table 1) were obtained from Integrated DNA technologies. For polymerase chain reaction, samples consisted of 2μl of cDNA, 8.3μl of RNase/DNase-free water, 2μl of each primer, and 12.5μl of iQ SYBR Green Supermix (prod. no. 170-8880; Bio-Rad). PCR reactions were performed in a Bio-Rad iQTM5 iCycler system, with the following cyclic parameters: initial denaturation at 95 °C for 3 min, followed by 50 cycles of 1.1 min each (40 s at 94°C; followed by 30 s at 60 °C for TRPV and AVPs and 30s at 95 °C followed by 1mt at 65 °C for GAPDH). The housekeeping gene, GAPDH, was used for normalisation of mRNA expression. In each real-time RT-PCR analysis, no-template and -RT controls were performed. For AVP hnRNA, an additional reaction was also performed in the absence of reverse transcriptase to account for DNA contamination in the sample (44). Melt curves generated were analysed to identify nonspecific products and primer-dimers. The data were analysed by the 2^−ΔΔCT method (45, 46). For calculation of individual 2^−ΔΔCt value, the individual CT value of housekeeping gene (GAPDH) is subtracted from the corresponding CT value of genes of interest. Then this value is subtracted from the difference between the average of the housekeeping and the gene of interest of the control to give the ΔΔCT value.

Table 1.

Real Time q-RT PCR primer sequences

TRPV1 forward:	5′- GCAAAATGGGCAGAATGACACCAT-3′
TRPV1 reverse:	5′- GGCATTGACAAACTGCTTCAGGCT-3′
TRPV2 forward:	5′- GAGTCACCATTCCAGAGGGA-3′
TRPV2 reverse:	5′- GTTCAGCACAGCCTTCATCA-3′
TRPV3 forward:	5′- ACATCAGTGTAGACGCATGGCTGA-3′
TRPV3 reverse:	5′- AACCCAAGGAGCCTTCCTTTCAGA-3′
TRPV4 forward:	5′- ACAGCAACCTGGAGACTGTGCTTA-3′
TRPV4 reverse:	5′- AGTCCTTGA ACTTGCGAGACAGGT-3′
AVP forward:	5′-TGCCTGCTACTTCCAGAACTGC-3′
AVP reverse:	5′- AGGGGAGACACTGTCTCAGCTC-3′
AVP hnRNA forward:	5′- GCCCTCACCTCTGCCTGCTA 3′
AVP hnRNA reverse:	5′- CCTGAACGGACCACAGTGGT 3′
GAPDH forward:	5′- CTCATGACCACAGTCCATGC -3′
GAPDH reverse:	5′- TACATTGGGGGTAGGAACAC -3′

Statistical Analysis

All results are presented as means ± SEM. For statistical analysis of data, we used unpaired t test using GraphPad Prism (GraphPad Software, Inc., La Jolla, CA). P = 0.05 or P < 0.05 was considered to be statistically significant.

Results

Plasma Measurements

Plasma samples from sham controls and BDL rats were used to measure plasma osmolality and hematocrit (Table 2). Plasma osmolality was significantly lower in bile duct ligated rats compared to the shams (p <0.05). Likewise, plasma hematocrit was significantly decreased in BDL compared to sham ligated rats (p =0.01). All the BDL rats were jaundiced and hepatic fibrosis as evaluated by visual examination. Liver to body weight ratio at time of sacrifice was significantly higher in BDL rats compared to sham (p<0.0001).

Table 2.

Plasma osmolality, hematocrit and liver weight to body weight ratio in Sham ligation and BDL rats.

Plasma Measurements	Sham	BDL
Osmolality(mOsm/kg)	310.3 ± 1.05 (n=15)	304.4 ± 1.1* (n=17)
Hematocrit %	47.3 ±0.3 (n=13)	43.1 ± 0.6** (n=19)
Liver wt./bw (g)	0.05±0.003 (n=14)	0.08±0.002*** (n=20)

^*p<0.05 compared to sham ligation;

^**p=0.01 compared to sham ligation;

^***p<0.0001 compared to sham ligation.

qRT-PCR from laser capture microdissected magnocellular vasopressinergic neurones

A representative example of LCM of AVP magnocellular neurons is illustrated in Figure 1. The image shows a section of the PVN containing AVP neurons identified by quick immunolabelling (Figure 1A) and subsequent laser capture (Figure 1B). These cells were collected on an LCM cap (Figure 5C) for later real time RT-PCR quantification.

Figure 1.

Digital images of vasopressin neurones in the PVN identified by quick immunostaining (A), dissected by laser capture (B), and captured for later quantitative reverse transcriptase-polymerase chain reaction analysis (C).

Figure 5.

Confocal images of AVP and TRPV2 colocalisation in the SON of sham ligated (A–C) and bile duct ligated rats (D–F). AVP immunofluorescence is shown in A & D (pseudocoloured red) and TRPV2 immunofluorescence is in B and E (pseudocoloured green). Panels C and F show merged imaged where colocalisation of AVP and TRPV2 appears yellow and are marked by arrows.. Scale bar = 10 μm for all images.

Using this approach, we tested the effects of bile duct ligation on the expression of different TRPV channels in the SON and PVN. GAPDH was used as the housekeeping gene for all the genes of interest evaluated. In vasopressin cells collected from the SON, there was a significant increase of 2.5 fold in the mRNA level of TRPV2 (Figure 2A; p < 0.05) and a 2 fold significant increase in the mRNA level of TRPV4 in the BDL rats (Figure 2B; p<0.05). TRPV1 mRNA expression in SON vasopressin cells was not significantly different between the sham ligated and BDL groups (Figure 2C; p > 0.05). Although there was 2.2 fold increase in TRPV3 mRNA after BDL, this increase was not significant (Figure 2D; p > 0.05). AVP mRNA (Figure 2E) did not differ between the two groups. However, heteronuclear AVP expression was significantly increased in the SON of BDL rats, showing a 4 fold elevation, compared to sham controls (Figure 2F; p<0.04

Figure 2.

Effect of bile duct ligation (BDL, n = 5) versus sham ligation (Sham, n = 5) on TRPV2 (A), TRPV4 (B), TRPV1 (C), TRPV3 (D) AVP (E), and AVP hnRNA (F) gene expression from 7–10 laser microdissected vasopressin cells from the SON. The data depict mean ± SEM mRNA levels as calculated by the 2^−ΔΔCT method. *p< 0.05 compared to sham ligation.

In vasopressin cells collected from magnocellular PVN, a significant increase was seen only in TRPV2 mRNA expression after BDL (Figure 3A; p < 0.04). Expression of TRPV4 (Figure 3B; p>0.05), TRPV1 (Figure 3C; p>0.05) and TRPV3 (Figure 3D; p>0.05) channels examined in PVN was not significantly affected by BDL. Unlike the SON, there were no changes in the AVP mRNA or AVP hnRNA expression in the PVN after BDL (Figures 3E & 3F; p > 0.05

Figure 3.

Effect of bile duct ligation (BDL, n=5) versus sham ligation (Sham, n=5) on TRPV2 (A), TRPV4 (B), TRPV1 (C), TRPV3 (D), AVP (E), and AVP hnRNA (F) gene transcription from 7–10 laser microdissected vasopressin cells from magnocellular PVN. *p< 0.05 compared to sham ligation.

Effect of bile duct ligation on TRPV2 protein in the SON and PVN

Immunoreactive bands for TRPV2 were seen at 98kDA in both the SON and PVN. Bile Duct ligation significantly increased TRPV2 protein expression in SON punches (Figure 6A; p<0.05). Similarly, BDL rats showed a significant increase in the TRPV2 protein levels in the PVN (Figure 6C; p<0.05).

Figure 6.

Confocal psuedocolour images of AVP and TRPV2 colocalization in magnocellular PVN of sham ligated (A–C) and bile duct ligated rats (D–F). AVP immunofluorescence is shown in A & D (pseudocoloured red) and TRPV2 immunofluorescence is in B and E (pseudocoloured green). Panels C and F show merged images where colocalisation of AVP and TRPV2 appears yellow and is marked by arrows. Scale bar = 10 μm for all images.

Double Immunofluorescence

Double labelling immunoflourescence studies showed that TRPV2 proteins are expressed in the AVP neurones in both the SON and the magnocellular PVN of sham ligated and bile duct ligated animals. Confocal images of the AVP/TRPV2 colocalization in the SON and magnocellular PVN are represented in Figure 5 and Figure 6. In both these hypothalamic regions, BDL was associated with a significant increase the numbers of AVP and TRPV2 positive cells as well as AVP and TRPV2 colocalisation (Figure 7). OXY was also colocalised with TRPV2 in both SON (Figure 8) and magnocellular PVN (Figure 9) of sham and BDL rats. In these sections, TRPV2 labelling increased after BDL, but there were no effects on either OXY staining or OXY/TRPV2 colocalisation (Figure 10).

Figure 7.

Quantitative analysis of AVP, TRPV2, and AVP/TRPV2 colocalisation in the SON (A) PVN (B) from sham ligated (n= 5) and BDL rats (n = 6). *p<0.05 compared to sham ligation.

Figure 8.

Confocal images of OXY and TRPV2 colocalisation in the SON of sham ligated (A–C) and bile duct ligated rats (D–F). OXY immunofluorescence is shown in A & D (pseudocoloured red) and TRPV2 immunofluorescence is in B and E (pseudocoloured green). Panels C and F show merged imaged where colocalisation of OXY and TRPV2 appears yellow and is marked by arrows. Scale bar = 10 μm for all images.

Figure 9.

Confocal images of OXY and TRPV2 colocalisation in the magnocellular PVN in sham ligated (A–C) and bile duct ligated rats (D–F). Scale bar = 10 μm for Sham image and 20 μm for BDL images.

Figure 10.

Quantitative analysis of OXY, TRPV2, and colocalisation in the SON (A) PVN (B) from sham ligated (n = 5) and BDL rats (n = 6). *p<0.05 compared to sham ligation.

Discussion

Laser capture microdissection combined with quantitative RT-PCR was used to measure mRNAs encoding TRPV1- and AVP in vasopressin MNCs harvested from SON and magnocellular PVN in an animal model of obstructive liver disease that is associated with dilutional hyponatremia. Our data provide unique evidence that TRPV 1–4 are each expressed in vasopressin MNCs in the PVN and SON. However, these genes are differentially regulated following chronic BDL in a region dependent manner. Our immunohistochemistry studies also corroborate our findings of TRPV2 expression in vasopressin cells in both the magnocellular PVN and SON, and that TRPV2 expression increases following BDL.

In both the SON and magnocellular PVN, we observed an increase in the numbers of AVP positive profiles in BDL rats. These results are consistent with our previous study of AVP and TRVP4 expression in the SON of BDL rats (41). In the present study, we measured AVP mRNA and AVP hnRNA in order to determine whether the increase in AVP immuoreactive profiles was related to changes in transcription. AVP gene transcription is reported to be linked to vasopressin release during changes in plasma osmolality (47). However, we did not find significant changes in AVP mRNA expression following BDL in contrast to reports showing that hypoosmolality inhibits AVP transcription (45) or elevated AVP mRNA in response to water deprivation (48) and salt loading (49). Using intron specific primers we observed a significant increase in AVP hnRNA in the SON of BDL rats. These findings are consistent with previous studies indicating that hnRNA may be a more accurate indicator of AVP transcriptional activity (50–52) and that increased activity of vasopressin MNCs supports elevated plasma vasopressin during liver failure. The lack of a significant increase in AVP hnRNA in magnocellular PVN was not anticipated and could indicate a fundamental difference in the relationship between AVP transcription, immunoreactivity, and activity between magnocellular neurones in these two regions. Alternatively, this finding could be due to differences in the impact of nonosmotic factors on SON versus PVN causing SON to make a greater contribution to elevated circulating vasopressin in this model. Additional research will be necessary to address these issues.

Effects of BDL on TRP channels

Laser captured AVP neurones from SON and PVN exhibited no significant changes in TRPV1 and TRPV3 mRNA expression after BDL. These results do not preclude the possibility that TRPV1 and TRPV3 protein production in these cells may be altered. Since we did not test for changes in the mRNA for the N-terminal splice variant of TRPV1, which has previously been shown to be involved in osmoregulation, it is possible that the mRNA expression of this splice variant might be enhanced during BDL.

TRPV4 mRNA content was enhanced after BDL in SON but not PVN. This is consistent with our report that showed increased TRPV4 protein levels in the SON of cirrhotic rats, and unaltered levels of TRPV4 in the PVN (41). It also extends these observations by providing evidence that increased TRPV4 transcriptional activity contributes to increased protein content in the SON following BDL.

We also observed increased gene and protein expression of TRPV2 in BDL rats, and these increases were observed in both SON and PVN. This contrasts with our results with TRPV4 which increased only in SON. The results from immunohistochemistry double labelling experiments confirm that this change in TRPV2 protein expression appears to be specific to AVP MNCs. In both SON and PVN, the numbers of TRPV2 positive profiles were significantly increased, as was colocalisation of AVP and TRPV2, following BDL. TRPV2 and OXY colocalisation was not increased in either SON or PVN of BDL rats.

Previous studies have found that TRPV2 is involved in osmotic cell swelling in murine aortic myocytes (53, 54) and that administration of TRPV2 antisense oligonucleotides causes suppression of hypotonicity induced responses in mouse aorta. Hence, changes in the abundance of TRPV2 mRNA and protein in PVN and SON vasopressin MNCs suggests a possible alteration in the osmosensitivity of AVP neurones.

Apart from the common functional aspect that TRP channels are involved in sensory transduction, several studies have suggested TRPV channel involvement in osmotic regulation (29–32, 55). TRP channels have been shown to form functional homomultimers or heteromers within their own subfamily (56, 57). Since both TRPV4 and TRPV2 are activated by hypoosmotic stimulation (30, 53, 54), increased expression of these channels could alter the intrinsic osmosensitivity of vasopressin MNCs contributing to inappropriate vasopressin release in BDL rats. However, the contribution of TRPV4 to this effect may be specific to SON. Alternatively, these changes in TRPV4 and TRPV2 expression could be a consequence of hyponatremia.

In summary, our findings provide evidence of the co-existence of TRPV1-4 in vasopressin MNCs of SON and PVN. The results also demonstrate that BDL, an animal model characterised by dysregulated AVP release and increased water retention, is associated with increased TRPV2 gene and protein expression in vasopressin MNCs of both SON and PVN. In contrast, increased transcriptional activity for TRPV4 occurred only in SON. Increased AVP gene expression, as determined by qRT-PCR for AVP hnRNA, significantly increased in the SON but not PVN. Further studies are needed to explore the regulation of TRPV channels in modifying vasopressin release during physiological and pathophysiological states.

Figure 4.

Quantification and representative immunoblots from Western blot analysis of TRPV2 protein abundance in the SON (A) and PVN (B) from sham ligation (Sham, n = 7–8) and BDL (n = 8–9) rats. Total lysate was obtained from brain punches containing the SON and PVN. Relative expression of TRPV2 was determined by normalising the density of TRPV2 with GAPDH. * is p<0.05 compared to sham.