Abstract
Encephalomyocarditis virus (EMCV) can infect many host species and cause acute myocarditis and sudden death in preweaned piglets. In this study, an EMCV strain (NJ08) was isolated from newborn pigs with clinical signs on a pig farm in mideastern China. It was identified by indirect immunofluorescence assay and reverse-transcription polymerase chain reaction. Experiments showed that the isolate could cause severe clinical symptoms and pathological changes in mice but no obvious clinical and pathological changes in commercial piglets. Complete genomic sequencing showed that the NJ08 strain was 78.3% to 100% identical with other isolates in regions coding for various proteins. Phylogenetic analysis showed that the NJ08 isolate belonged to subgroup Ia. This study confirmed that an EMCV isolate from pigs could be fatal to mice and provided new epidemiologic data on EMCV in China.
Résumé
Le virus de l’encéphalomyocardite (EMCV) peut infecter plusieurs espèces hôtes et causer une myocardite aiguë et une mortalité subite chez des porcelets en période pré-sevrage. Dans la présente étude, une souche d’EMCV (NJ08) a été isolée d’un porcelet nouveau-né avec des signes cliniques sur une ferme porcine en Chine. La souche fut identifiée par une épreuve d’immunofluorescence indirecte et réaction d’amplification en chaîne par la polymérase inverse. Les expériences ont démontré que l’isolat pouvait causer des symptômes cliniques sévères et des changements pathologiques chez les souris mais aucun signe clinique ni changement pathologique évident chez des porcs commerciaux. Le séquençage génomique complet a montré que la souche NJ08 était de 78,3 % à 100 % identique à d’autres isolats dans des régions codant pour diverses protéines. Les analyses phylogénétiques ont montré que l’isolat NJ08 appartenait au sous-groupe Ia. La présente étude a confirmé qu’un isolat d’EMCV provenant de porc pourrait être fatal pour la souris et a fourni de nouvelles données épidémiologiques sur l’EMCV en Chine.
(Traduit par Docteur Serge Messier)
Encephalomyocarditis virus (EMCV) belongs to the genus Cardiovirus in the family Picornaviridae. It has been recognized worldwide as a pathogen infecting many species, including pigs, rodents, cattle, baboons, macaques, chimpanzees, bonobos, and humans (1–4). Usually rats and mice are the natural hosts of EMCV, and pigs are considered the domestic animal most commonly and severely infected (5). The virus is a single-stranded, positive-sense RNA approximately 7.8 kb in length that contains a large open reading frame (ORF) (6). It is covalently linked at the 5′ end to virion protein, genome-linked, and in the 5′ untranslated region (UTR), which contains the internal ribosome entry site and a long homo-polymeric cytosine tract (7). The 3′-UTR terminates with a short, heterogeneous poly(A) tail. Although EMCV has been isolated in the south and north of China (8), it has not been reported in the mid-east, and its pathogenicity and molecular epidemiology have not been deeply understood.
Three clinically ill newborn pigs from 1 pig farm in mideastern China that died suddenly before weaning were diagnostically studied in August 2008. The clinical signs had included anorexia, rapid breathing, listlessness, trembling, and staggering or paralysis. Necropsy showed no obvious gross lesions except for excessive pericardial fluid and white necrotic areas in the heart muscle. For virus isolation, heart and brain tissue were homogenized with Dulbecco’s modified Eagle’s medium (DMEM), frozen and thawed 3 times, and centrifuged at 10 000 × g for 10 min at 4°C. The supernatant was passed through a 0.22-nm filter and inoculated into BHK-21 cells. The cultures were examined daily for cytopathic effect. After 3 passages, 1 cytopathic isolate, characterized by cell rounding, pyknosis, and degeneration of the cell monolayer, was detected 24 h after inoculation. It was named NJ08 and stored at −20°C for further characterization.
The virus titer was 109.2 TCID50 (median tissue culture infective dose) per milliliter. Indirect immunofluorescence assay (IFA) showed that the isolate reacted strongly with monoclonal antibody against EMCV VP1 protein (made in our laboratory by vaccination of BALB/c mice with recombinant VP1 protein). For further identification of the isolate, total RNA was extracted from the cell cultures with TRIzol reagent (Invitrogen, Carlsbad, California, USA). Reverse transcription was carried out with M-MLV (Promega, Madison, Wisconsin, USA) in a 25-μL reaction mixture containing 2 μg of RNA. The VP1 gene was amplified with use of the primers VP1-f (5′-GCTGGATCCGGAGTAGAAAACGCTGAAAATCTCAC-3′) and VP1-r (5′-GGCAAGCTTTTACTCTAGCATCAAGACTCCAG-3′) and cloned into pMD-18T vector for sequencing with the T7 promoter primer (Invitrogen). The polymerase chain reaction (PCR) product was 831 base pairs (bp) in length. Sequence alignment indicated that the NJ08 isolate matched isolates in GenBank.
The following experimental activities were approved by the Institutional Animal Care and Ethics Committee of Nanjing Agricultural University (permit IACECNAU20100609) and met the International Guiding Principles for Biomedical Research Involving Animals.
To determine the pathogenicity of the isolate, fourteen 50-day-old BALB/c mice free of EMCV were divided into 2 groups. Each mouse in group 1 was inoculated with 0.1 mL of 108.0 TCID50/mL EMCV NJ08 by the celiac route. The mice in group 2 were inoculated with 0.1 mL of DMEM medium and served as negative controls. The clinical status of the mice was observed daily for 21 d. The mice in group 1 showed symptoms and signs as early as 12 h after inoculation and died 3 to 6 d after inoculation. Signs of depression and nerve effects included hunched posture, lethargy, and hindlimb paralysis. Cerebrovascular engorgement, hemorrhagic pneumonia, and petechial cardionecrosis were observed at necropsy. Heart and brain tissue sections were fixed in 10% neutral buffered formalin and stained with hematoxylin and eosin for histopathological examination, and IFA was performed to detect EMCV antigen in the brain tissue, as previously described (9), with the use of monoclonal antibody against EMCV VP1 protein.
All of the infected mice showed evidence of encephalitis and meningitis, including perivascular infiltration with mononuclear cells and some neuronal degeneration with necrosis (Figure 1A), as well as signs of myocarditis, including focal or diffuse accumulation of mononuclear cells, edema, and degeneration of the myocardial fibers with necrosis (Figure 1B). Moreover, EMCV antigen was detected in the brain of all the infected mice, presenting in the cytoplasm (Figure 1C): the brownish-yellow positive signal was distributed in different layers of cells, especially the granular and external pyramidal layer. No lesions were observed in the control group.
Figure 1.
Inflammation and degenerative changes in heart (A) and brain (B) tissue of mice infected with encephalomyocarditis virus (EMCV) (hematoxylin and eosin). Indirect immunohistochemistry assay demonstrates EMCV antigen in brain tissue (C): red arrow points at brown positive signal. Original magnification × 400.
Five 21-d-old suckling piglets free of EMCV [negative by reverse-transcription PCR (RT-PCR) and enzyme-linked immunosorbent assay (ELISA)] were inoculated with 3 mL of 109.0 TCID50/mL EMCV NJ08 by both intramuscular and intranasal routes and observed daily for 21 d. Although the piglets did not show clinical signs or visible gross lesions after inoculation, EMCV was detected by RT-PCR in blood samples collected on days 2 and 3 after inoculation from all 5 piglets. As well, serum antibody to EMCV was detected by ELISA with purified EMCV NJ08 antigen in blood samples collected on days 14 and 21 after inoculation from all 5 piglets. Five control suckling piglets inoculated with 3 mL of DMEM and housed in another room remained healthy and showed no evidence of EMCV infection and no antibody to EMCV in the blood.
These findings indicate that the EMCV NJ08 isolate could infect piglets but not cause clinical signs. Further investigation is necessary to determine the pathogenicity of the isolate in newborn pigs and progeny sows. The variable clinical appearance of EMCV in domestic pigs in various countries might be explained by differences in the pathogenicity of various strains (10,11).
To understand the genetic relationships between NJ08 and other isolates and the evolution of EMCV, the genome of the virus was sequenced completely. Primers for PCR (Table I) were designed on the basis of the sequence of EMCV strain BJC3 (GenBank accession number DQ464062); 5 fragments were amplified with AccuPrime Pfx DNA polymerase (Invitrogen). In addition, the 5′- and 3′-UTRs of EMCV NJ08 were amplified by the 5′ and 3′ Full RACE Core sets (TaKaRa Biotechnology Company, Dalian, China) according to the manufacturer’s instructions. The 5′-phosphorylated primers and the 3′ RACE adapter primer were used as reverse primers to synthesize 1st-strand cDNA, which was used as the template for amplification. The PCR products were subjected to gel electrophoresis, purified with a purification kit (TaKaRa), and cloned into the pMD18-T vector (TaKaRa) according to the manufacturer’s instructions. Three positive clones for each fragment were sequenced. After the sequence of each fragment was assembled, the complete genome sequence of NJ08 was obtained. The phylogenetic relationships were studied with the use of MEGA4 software (http://www.megasoftware.net) according to the nucleotide sequences of EMCV NJ08 (GenBank no. HM641897) and other known EMCV isolates worldwide, including Chinese isolates GX0602 (FJ604853), GXLC (FJ897755), BJC3 (DQ464062), and HB1 (DQ464063), Korean isolates CBNU (DQ517424), K3 (EU780148), and K11 (EU780149), European isolates BEL-2887A (AF356822), PV21 (X74312), and Mengo-M (L22089), and American isolates EMCV-R (M81861), PEC9 (DQ288856), D variant (M37588), EMCV-B (M22457), EMCV-D (M22458), and Mengo Rz-pMwt (DQ294633). Phylogenetic trees were constructed with MEGA4 by the neighbor-joining method. Reliability was assessed by bootstrap analysis with 1000 replicates. The results showed that the NJ08 genome is 7724 bp in length, with a 5′-UTR of 714 nt, a 3′-UTR of 131 nt, and a large ORF that encoded a polyprotein of 2292 amino acids. The isolate belongs to subgroup Ia together with all the tested isolates from pigs and mice except for the European isolate Mengo-M and 4 of the 6 American isolates (D variant, EMCV-B, EMCV-D, and Mengo Rz-pMwt) (Figure 2). Since domestic pigs and mice live in the same environment, it could be that the virus spreads between these 2 species.
Table I.
Oligonucleotide primers for amplifying the complete genome of the NJ08 strain of encephalomyocarditis virus (EMCV)
| Primer | Sequence (5′ → 3′) | Positiona | Product [size (number of base pairs)] |
|---|---|---|---|
| EV1F | ATTGTATGGGATCTGATCTGGGG | 603–625 | F1 (1526) |
| EV1R | GGTCTTGACGGCTGTGTTGG | 2109–2128 | |
| EV2F | TGCTGGTACCTGGTATTCTA | 1936–1955 | F2 (1580) |
| EV2R | ATCTAACCTCCAAACCTCTA | 3496–3515 | |
| EV3F | GATTTCGGCACTCTGTTCTT | 3260–3279 | F3 (2146) |
| EV3R | AGTTACGCTCCTGTACTTTCG | 5385–5405 | |
| EV4F | GACGAGGTCAGTTTCCATTCC | 5294–5314 | F4 (1002) |
| EV4R | CAACGGTGGGGCGTAGTGCT | 6277–6296 | |
| EV5F | GGCGGTAGTGAATGCCTTTG | 6196–6215 | F5 (1316) |
| EV5R | CCTGCTTACCAGAATGAACG | 7492–7511 | |
| 5′-GSP1 | GAGGAGGAGTTATTCTTGTCTGAGG | 942–966 | 5′-UTR |
| 5′-GSP2 | GGGGCCTAGACGTTTTTTAACCTC | 659–682 | |
| 5′-RACE outer primer | CATGGCTACATGCTGACAGCCTA | ||
| 5′-RACE inner primer | CGCGGATCCACAGCCTACTGATCAGTCGATG | ||
| 3′-GSP1 | ATGTTGTCATACTATCGTCCAGG | 7430–7452 | 3′-UTR |
| 3′-RACE outer primer | TACCGTCGTTCCACTAGTGATTT |
UTR — untranslated region.
Based on the sequence of EMCV strain BJC3 (GenBank accession number DQ464062).
Figure 2.
Phylogenetic analysis of EMCV isolates based on complete genome sequences. The numbers at the nodes represent bootstrap values greater than 50% of 1000 replicates. The scale bar represents 0.005 inferred substitutions per site.
To detect any differences in the deduced ORF amino acid sequences between NJ08 and the other tested isolates, the sequences were analyzed and aligned by means of DNAStar software (DNAStar, Madison, Wisconsin, USA). The results indicated that the ORFs of NJ08 encoded 11 proteins that were similar to those reported previously for other EMCV strains: VP1 to VP4, 2A to 2C, 3A to 3D, and a virus-leading protein (L protein) (12,13). Sequence comparisons revealed 78.3% to 100% identity of the proteins with those of the other 15 isolates (Table II). The most conserved proteins were VP2 and 3D, and the most variable proteins were VP1 and 2A. However, previous studies indicated that the predominant antigen epitopes of EMCV were located in the VP1 and VP3 proteins (11). This discrepancy might be due to the impact of selection pressure. Thus, the molecular epidemiology and the variation in VP1 of new EMCV isolates should be monitored.
Table II.
Percentage similarity in deduced amino acid sequence of the open reading frames of NJ08 and other encephalomyocarditis virus isolates encoding various proteins
| Protein; sequence similarity (%) | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| Strain | VP4 | VP2 | VP3 | VP1 | 2A | 2B | 2C | 3A | 3B | 3C | 3D |
| BEL-2887A | 100 | 100 | 100 | 98.6 | 99.4 | 100 | 99.8 | 98.9 | 100 | 100 | 100 |
| CBNU | 100 | 100 | 100 | 99.3 | 99.4 | 100 | 100 | 100 | 100 | 99.5 | 100 |
| EMCV-R | 100 | 100 | 100 | 98.9 | 99.4 | 100 | 99.9 | 100 | 100 | 99.5 | 100 |
| GX0602 | 98.6 | 98.8 | 100 | 97.8 | 97.9 | 100 | 99.9 | 96.6 | 100 | 99.0 | 99.8 |
| GXLC | 100 | 99.6 | 100 | 98.9 | 98.1 | 100 | 100 | 100 | 100 | 100 | 99.8 |
| HB1 | 100 | 100 | 99.6 | 99.6 | 98.7 | 100 | 99.9 | 100 | 100 | 100 | 99.6 |
| BJC3 | 98.6 | 100 | 99.1 | 98.6 | 98.7 | 99.3 | 99.8 | 100 | 100 | 100 | 99.8 |
| K3 | 100 | 100 | 99.6 | 99.6 | 98.7 | 100 | 99.9 | 100 | 100 | 100 | 99.6 |
| K11 | 100 | 99.6 | 99.6 | 97.5 | 99.4 | 100 | 99.9 | 100 | 100 | 99.5 | 99.8 |
| PEC9 | 100 | 99.6 | 99.1 | 98.2 | 98.1 | 100 | 99.7 | 100 | 100 | 99.5 | 99.6 |
| PV21 | 100 | 99.2 | 100 | 99.3 | 98.6 | 100 | 99.9 | 98.9 | 100 | 99.0 | 100 |
| D variant | 98.6 | 98.8 | 100 | 98.9 | 99.4 | 99.3 | 99.7 | 98.9 | 95.0 | 100 | 100 |
| EMCV-B | 95.7 | 98.0 | 99.1 | 97.1 | 86.6 | 96.3 | 99.0 | 92.0 | 85.0 | 92.7 | 96.7 |
| EMCV-D | 95.7 | 98.4 | 99.1 | 96.8 | 86.0 | 96.3 | 98.7 | 93.2 | 85.0 | 92.2 | 96.5 |
| Mengo Rz-pMwt | 95.7 | 98.4 | 99.1 | 97.1 | 86.6 | 96.3 | 98.7 | 93.2 | 85.0 | 92.2 | 96.5 |
| Mengo-M | 97.1 | 97.7 | 97.8 | 96.4 | 78.3 | 97.1 | 97.8 | 90.9 | 85.0 | 88.0 | 93.3 |
In summary, this study confirmed the presence of EMCV in a pig herd in mideastern China. The isolate, NJ08, has high pathogenicity in mice and is closely related in genomic sequence to the tested Korean, European, and other Chinese isolates. These findings provide new epidemiologic data on EMCV in China.
Acknowledgments
This work was supported by grants from the National Key Genomic Engineering Program (2009ZX08009-143B), the National Natural Science Foundation (30871868), and the National Key Program in Agriculture (201003060).
References
- 1.LaRue R, Myers S, Brewer L, et al. A wild-type porcine encephalomyocarditis virus containing a short poly(C) tract is pathogenic to mice, pigs, and cynomolgus macaques. J Virol. 2003;77:9136–9146. doi: 10.1128/JVI.77.17.9136-9146.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Reddacliff LA, Kirkland PD, Hartley WJ, Reece RL. Encephalomyocarditis virus infections in an Australian zoo. J Zoo Wildl Med. 1997;28:153–157. [PubMed] [Google Scholar]
- 3.Jones P, Cordonnier N, Mahamba C, et al. Encephalomyocarditis virus mortality in semi-wild bonobos (Pan panicus) J Med Primatol. 2011;40:157–163. doi: 10.1111/j.1600-0684.2010.00464.x. Epub 2011 Feb 16. [DOI] [PubMed] [Google Scholar]
- 4.Oberste MS, Gotuzzo E, Blair P, et al. Human febrile illness caused by encephalomyocarditis virus infection, Peru. Emerg Infect Dis. 2009;15:640–646. doi: 10.3201/eid1504.081428. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Billinis C, Paschaleri-Papadopoulou E, Psychas V, et al. Persistence of encephalomyocarditis virus (EMCV) infection in piglets. Vet Microbiol. 1999;70:171–177. doi: 10.1016/s0378-1135(99)00137-6. [DOI] [PubMed] [Google Scholar]
- 6.Palmenberg AC, Kirby EM, Janda MR, et al. The nucleotide and deduced amino acid sequences of the encephalomyocarditis viral polyprotein coding region. Nucleic Acids Res. 1984;12:2969–2985. doi: 10.1093/nar/12.6.2969. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Martin LR, Neal ZC, McBride MS, Palmenberg AC. Mengovirus and encephalomyocarditis virus poly(C) tract lengths can affect virus growth in murine cell culture. J Virol. 2000;74:3074–3081. doi: 10.1128/jvi.74.7.3074-3081.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Zhang GQ, Ge XN, Guo X, Yang HC. Genomic analysis of two porcine encephalomyocarditis virus strains isolated in China. Arch Virol. 2007;152:1209–1213. doi: 10.1007/s00705-006-0930-9. [DOI] [PubMed] [Google Scholar]
- 9.Vlemmas J, Billinis C, Psychas V, et al. Immunohistochemical detection of encephalomyocarditis virus (EMCV) antigen in the heart of experimentally infected piglets. J Comp Pathol. 2000;122:235–240. doi: 10.1053/jcpa.1999.0365. [DOI] [PubMed] [Google Scholar]
- 10.Billinis C, Paschaleri-Papadopoulou E, Anastasiadis G, et al. A comparative study of the pathogenic properties and transmissibility of a Greek and a Belgian encephalomyocarditis virus (EMCV) for piglets. Vet Microbiol. 1999;70:179–192. doi: 10.1016/s0378-1135(99)00145-5. [DOI] [PubMed] [Google Scholar]
- 11.Koenen F, Vanderhallen H, Papadopoulos O, et al. Comparison of the pathogenic, antigenic and molecular characteristics of two encephalomyocarditis virus (EMCV) isolates from Belgium and Greece. Res Vet Sci. 1997;62:239–244. doi: 10.1016/s0034-5288(97)90197-1. [DOI] [PubMed] [Google Scholar]
- 12.An DJ, Jeong W, Jeoung HY, et al. Encephalomyocarditis in Korea: Serological survey in pigs and phylogenetic analysis of two historical isolates. Vet Microbiol. 2009;137:37–44. doi: 10.1016/j.vetmic.2009.01.005. [DOI] [PubMed] [Google Scholar]
- 13.Denis P, Liebig HD, Nowotny N, et al. Genetic variability of encephalomyocarditis virus (EMCV) isolates. Vet Microbiol. 2006;113:1–12. doi: 10.1016/j.vetmic.2005.10.032. [DOI] [PubMed] [Google Scholar]


