Skip to main content
Infection and Immunity logoLink to Infection and Immunity
. 2012 Apr;80(4):1361–1372. doi: 10.1128/IAI.06311-11

Strain-Specific Regulatory Role of Eukaryote-Like Serine/Threonine Phosphatase in Pneumococcal Adherence

Shivangi Agarwal 1, Shivani Agarwal 1, Preeti Pancholi 1, Vijay Pancholi 1,✉
Editor: A Camilli
PMCID: PMC3318399  PMID: 22311926

Abstract

Streptococcus pneumoniae exploits a battery of virulence factors to colonize the host. Although the eukaryote-like Ser/Thr kinase of S. pneumoniae (StkP) has been implicated in physiology and virulence, the role of its cotranscribing phosphatase (PhpP) has remained elusive. The construction of nonpolar markerless phpP knockout mutants (ΔphpP) in two pathogenic strains, D39 (type 2) and 6A-EF3114 (type 6A), indicated that PhpP is not indispensable for pneumococcal survival. Further, PhpP also participates in the regulation of cell wall biosynthesis/division, adherence, and biofilm formation in a strain-specific manner. Additionally, we provide hitherto-unknown in vitro and in vivo evidence of a physiologically relevant biochemical link between the StkP/PhpP-mediated cognate regulation and the two-component regulatory system TCS06 (RR06/HK06) that regulates the expression of the gene encoding an important pneumococcal surface adhesin, CbpA, which was found to be significantly upregulated in ΔphpP mutants. In particular, StkP (threonine)-phosphorylated RR06 bound to the cbpA promoter with high efficiency even in the absence of the HK06-responsive and catalytically active aspartate 51 residue. Together, our findings unravel the significant contributions of PhpP in pneumococcal physiology and adherence.

INTRODUCTION

Streptococcus pneumoniae (pneumococcus), a Gram-positive pathogen, remains a significant health threat to both children and adults worldwide, despite the availability of antibiotics and polysaccharide-based vaccines (9, 37). The astounding ability of pneumococcus to alter its serotypes poses a major challenge in developing an effective broad-spectrum vaccine (9).

By utilizing a combination of surface adhesins, pneumococcus asymptomatically colonizes the mucosal surfaces of the host nasopharynx and upper airway. Subsequently, and depending on the host susceptibility, it exploits a variety of virulence factors to actively invade host cells, crosses blood-brain barriers, utilizes the host fibrinolytic system, and progressively metastasizes in distant organs, resulting in pneumonia, septicemia, and meningitis (14, 17, 19). The dynamic temporal expression repertoire of these virulence factors in many pathogens, including pneumococcus, is believed to be primarily controlled by the His-Asp phospho-relay two-component systems (TCSs) and also stand-alone regulators (5, 41, 46, 51). However, recent evidence has also pointed toward the involvement of eukaryote-like serine/threonine kinases (ESTKs) and cotranscribing phosphatases (ESTPs) in governing virulence of several Gram-positive pathogens (43), including Streptococcus pyogenes (1, 18, 39), Staphylococcus aureus (6, 7), Listeria monocytogenes (3), and Bacillus anthracis (48). While on one hand the ubiquitous existence of these cotranscribing modules in pathogens has generated a renewed interest in understanding their role in pathogenesis, the nature of their physiologically relevant relationship with other established regulators has remained elusive.

Besides harboring 13 well-characterized TCSs (41), S. pneumoniae also possesses a single gene encoding the membrane-associated eukaryote-type Ser/Thr kinase (StkP) cotranscribing with PP2C-type phosphatase (PhpP) (12, 38). stkP gene deletion has been shown to confer pleiotropic effects and found to be detrimental to pneumococcal multiplication, competence development, and virulence (12, 34). StkP has also been evaluated recently as a potential vaccine candidate against pneumococcal sepsis and pneumonia (13, 30). However, the precise role of its cotranscribing PhpP has not been studied so far.

The generalized notion that ESTPs are essential for bacterial survival (38, 43, 44, 48) has created a big void in our understanding of their precise role in bacterial pathogenesis. The phpP gene is therefore believed to be essential for pneumococcal survival (38), unlike its cognate kinase StkP, as reported before (35), and hence the role of PhpP in general remains enigmatic. However, recent reports demonstrating the first successful construction and in-depth characterization of STP mutants in two different strains of S. pyogenes (1) and S. aureus (6, 7), indicating an essential role of ESTPs in regulating virulence but not survival, and the lack of any available literature on the characterization of a PhpP knockout (ΔphpP) mutant to date (55) prompted us to hypothesize that phpP is not essential for the survival of S. pneumoniae and plays an important role as a counterpart to StkP in pneumococcal physiology and regulation.

In the present study, we therefore generated nonpolar markerless PhpP mutants in two distinct strains as the first step to understand the role of PhpP in pneumococcal physiology and pathogenesis. Based on the characterization of the mutants and on the gene expression profiles, we also demonstrate that PhpP plays an important role in pneumococcal adherence. In particular, we establish a physiologically relevant direct biochemical relation between the eukaryote-type StkP/PhpP- and HK06/RR06 TCS-mediated signaling modules that control the expression of a major pneumococcal adhesin, CbpA (29, 50).

MATERIALS AND METHODS

Bacterial strains, growth conditions, and cell culture.

The wild-type (WT) Streptococcus pneumoniae strains type 6A (EF3114) (2, 24) and D39 (type 2) (23) and their corresponding mutants were grown routinely at 37°C in Todd-Hewitt broth (Difco) supplemented with 0.5% (wt/vol) yeast extract (THY). For transformation experiments, cells were grown in chemically defined medium (21) with 0.5% yeast extract (C+Y). Escherichia coli strains DH5α, BL21(pLysS), and MC1061 were grown in Luria-Bertani (LB) broth or agar at 37°C. The concentrations of antibiotics used were as follows: streptomycin (Sm), 150 μg/ml; kanamycin (Km), 500 μg/ml; chloramphenicol (Chl), 10 μg/ml for E. coli and 2.5 μg/ml for S. pneumoniae. Detroit 562 human pharyngeal cell line (ATCC CCL138) was cultured and maintained in standard tissue culture minimal essential medium (MEM) as described previously (18).

Transformation and construction of S. pneumoniae ΔphpP mutants.

For all transformation experiments, pneumococci grown in C+Y medium (optical density at 600 nm [OD600], 0.2) were made competent by addition of 250 ng/ml of synthetic competence-stimulating peptide I (CSP-I; Biomatik Corp.) and naturally transformed by addition of DNA (200 ng) and further incubation for 90 min at 37°C before plating onto the selective medium.

The 6A and D39 strains of S. pneumoniae were used for generating isogenic ΔphpP mutants (SPD_1543 in D39 strains and equivalent in type 6A) by employing the widely used Janus cassette (constituting the kanamycin resistance gene [kan] followed by the recessive rpsL gene [Lys56 large ribosomal subunit protein]-based two-step negative selection strategy [52]). The sequences of all the oligonucleotides used are described in Table S1 of the supplemental material. PCR-amplified rpsL (possessing a K56T substitution) obtained with primer pair SG0F/SG0R was transformed in 6A and D39 wild-type strains for allelic replacement to generate the streptomycin-resistant primary recipients. For the first round of transformation, PCR fragments (800 bp each) encompassing the regions immediately upstream and downstream of phpP were amplified from the chromosomal DNA with SG1F/SG1R and SG2F/SG2R primers, respectively. The kan-rpsL fragment was amplified from the Janus strain with the SG3F and SG3R primers. For splicing by overlap extension (SOE), each primer pair contained one hybrid primer designed in such a way that it was complementary to the Janus cassette primers introduced at the 3′ end of the upstream DNA fragment and the 5′ end of the downstream DNA fragment. These PCR products were sequentially attached to the Janus cassette by SOE followed by transformation in 6A-Smr and D39-Smr. Transformants were selected on kanamycin-treated tryptic soy agar (TSA) plates, and their antibiotic susceptibility phenotype (Sms/Kmr) was confirmed before proceeding for the second round of transformation. To replace the Janus cassette, the second round of transformation was carried out with an engineered DNA fragment using primers pairs SG4F/SG4R and SG5F/SG5R, corresponding to the flanking upstream and downstream regions of phpP spliced together via SOE. The transformants obtained were selected on streptomycin-treated TSA plates, and their antibiotic susceptibility phenotype (Kms/Smr) was confirmed. The generation of unmarked ΔphpP mutants in both strains (6AΔphpP and D39ΔphpP) was confirmed by PCR with the flanking primers (SG1F and SG2R) and screening primers (SG6F and SG6R) followed by DNA sequencing. The detection of PhpP and StkP in ΔphpP mutants was ascertained by Western blot analysis using anti-StkkP and anti-PhpP polyclonal antibodies.

Complementation of 6AΔphpP and D39ΔphpP mutant strains with pDC123.phpP.

The PCR-amplified wild-type phpP with its ribosome-binding site (RBS) obtained using the primer pair SG7F and SG7R was cloned between BamHI and KpnI restriction sites located downstream of the tetracycline promoter (Ptet) of the complementation vector pDC123 (8, 54) to obtain pDC123.phpP. The latter was then used to transform 6AΔphpP and D39ΔphpP mutant strains to generate 6AΔphpP::phpP and D39ΔphpP::phpP strains, respectively. The expression of PhpP in the whole-cell lysates of the complemented strains was analyzed by chemiluminescence-based immunoblotting using anti-PhpP polyclonal antibody.

Production of 6×His-tagged recombinant PhpP and StkP proteins and generation of polyclonal antibodies.

To obtain recombinant His tag PhpP (SPD_1543) and the kinase domain of StkP (SPD_1542; StkkP), the corresponding gene-specific PCR-amplified products were obtained using primer pairs SG8F/SG8R (741 bp) and SG9F/SG9R (1.0 kbp), respectively (see Table S1 in the supplemental material). These PCR products were cloned into pET14B at the NdeI/BamHI site, and the corresponding proteins were expressed in BL21(pLysS) after 1 mM isopropyl-β-d-thiogalactopyranoside induction (1, 18) and purified by Ni+2-nitrilotriacetic acid affinity chromatography. Rabbit polyclonal antibodies against the active recombinant proteins PhpP and StkkP were custom-made by Lampire Biological Laboratories (Pipersville, PA) using a 50-day express-line protocol (18).

In vitro reversible phosphorylation assay.

The enzymatic activities of PhpP and StkkP proteins were assessed in an in vitro protein kinase assay by measuring autophosphorylation of StkkP and its ability to phosphorylate myelin basic protein in the presence of [γ-32P]ATP, essentially as described previously (18). The activity of PhpP was measured by its ability to dephosphorylate StkkP in an in vitro kinase assay, and its catalytic coefficients Km/Vmax were determined by measuring phosphatase activity on p-nitrophenyl phosphate (pNPP) substrate and derivation of a Lineweaver-Burk plot as described previously (18).

Growth profile under normal and stress conditions.

Pneumococcal wild-type strains 6A and D39 and their respective isogenic ΔphpP mutant strains were grown in THY medium, and their growth profiles were spectrophotometrically measured (based on the OD600) every 1 h for a period of 10 h. The bacterial cell viability for all strains was determined by enumerating the CFU after 10 h of growth by plating cells onto Columbia blood agar plates.

The wild-type 6A and D39 strains and their respective ΔphpP mutants strains were grown in C+Y medium (pH 8.0) under different culture conditions, viz. high temperature (40°C versus 37°C), high salt/osmotic shock (0.4 M NaCl), low pH/acid tolerance (pH 6.5 versus pH 8.0), and oxidative stress (50 mM H2O2). To determine the effect of oxidative stress on the viability of the wild-type and ΔphpP mutant strains, 50 mM H2O2 was added into the cultures of pneumococcal strains grown to an OD600 of 0.4 for 5, 10, 20, 40, and 60 min at 37°C in triplicates as described previously (47). The viable cells were determined based on the CFU counts before and after exposure to H2O2, and the results are expressed as the percent survival.

Microscopic analyses.

The effects of deletion of the phpP gene in 6A and D39 strains were initially determined by light microscopy (Gram staining) followed by fluorescence microscopy (BacLight LIVE/DEAD bacterial viability stain; Invitrogen) as per the manufacturer's instructions. The changes at the ultrastructural level were determined by transmission electron microscopy (TEM) using a cryo-capable digital transmission electron microscope (Technai G2 Spirit; EFI) as described previously (18).

Bacterial adherence assay.

The ability of each of the wild-type 6A and D39 strains and corresponding ΔphpP mutants and phpP-complemented strains to adhere to Detroit 562 human nasopharyngeal cells was determined essentially as described previously (39). Briefly, the adherence assay was performed using confluent Detroit 562 cells infected with the bacterial strains (multiplicity of infection, 100:1 [bacteria:cell]) for 3 h. The adherent bacteria were enumerated as CFU on Columbia blood agar plates. The experiment was performed thrice in six independent wells. The statistical analysis was performed with a nonparametric t test with Welch's corrections using GraphPad Prism 4.

Biofilm formation.

To initiate biofilm formation, wild-type, mutant, and complemented strains derived from 6A and D39 were grown to early stationary phase and seeded at a density of 1 × 107 cells in THY medium in a 96-well polystyrene plate. The plate was incubated at 37°C for 72 h. The nonadherent planktonic bacterial population in the medium was aspirated, and the biofilm was stained with crystal violet (0.1%) for 1 h. Absolute ethanol was added to extract the crystal violet, and the released dye associated with the biofilms was quantified by measuring the absorbance at 562 nm. Biofilm formation is represented as the mean ± standard deviation of absorbance obtained from 10 wells in two independent experiments. THY medium alone was also kept under identical conditions and was stained similarly to assess any bacterial contamination during the growth period. Results were statistically analyzed employing Student's t test.

qRT-PCR.

The wild-type 6A and D39 strains and the corresponding ΔphpP mutant strains were grown to late log phase. Total RNA was extracted from three independently grown cultures (biological replicates) using a Qiagen RNeasy kit as per the manufacturer's instructions. First-strand cDNA was generated, and the mRNA levels were quantitated in triplicate wells (technical replicates) by real-time PCR using Brilliant SYBR green quantitative real-time reverse transcriptase PCR (qRT-PCR) master mix (Roche) and specific primers (see Table S2 in the supplemental material) and a LightCycler 480 real-time PCR instrument (Roche). The copy numbers for all the genes were normalized with the housekeeping gene 16S rRNA. The linear fold changes in mRNA expression levels were analyzed using Exor4 software (Roche), and ≥2-fold up- or downregulation was considered significant.

Cloning of the rr06 gene, site-directed mutagenesis, expression and purification of the recombinant RR06 and its catalytic variant RR06D51A protein, and in vitro phosphorylation assay.

The gene encoding the response regulator rr06 (SPD_2020 in D39 and its equivalent in strain 6A; 654 bp) of TCS06 was PCR amplified using the genomic DNA of strain 6A and gene-specific primers SG10F and SG10R (see Table S1 in the supplemental material). PCR-amplified rr06 was cloned in pET14b at the NdeI/BamHI site to obtain pET14b-Pn-RR06. The latter was used as a template to mutate the conserved D51 residue and replace it with alanine by employing a site-directed mutagenesis kit (Stratagene) and the SG11F and SG11R primer pair (see Table S1) (1). The recombinant Pn-RR06 and Pn-RR06D51A proteins were then expressed and purified as described above. The polyclonal antibody against Pn-RR06 was generated in a CD-1 female mouse (4 to 6 weeks old) by immunizing the recombinant 6×His-tagged Pn-RR06 emulsified in Freund's complete adjuvant. Anti-RR06-specific IgG was affinity purified using protein A-agarose from the immune sera as per standard protocols. The abilities of the purified proteins (Pn-RR06 and Pn-RR06D51A) to function as substrates for StkkP were tested in an in vitro kinase assay using 300 ng of Pn-RR06 alone or in conjunction with StkkP (1 μg). Dephosphorylation of the phosphorylated Pn-RR06 was determined in the presence of PhpP (500 ng) in the assay mixture, as described previously (18).

Determination of the target residue specificity.

Phospho-amino acid analysis was performed by thin-layer liquid chromatography as described previously (18). Briefly, the protein bands corresponding to the StkkP-phosphorylated Pn-RR06 and Pn-RR06D51A were excised and subjected to hydrolysis with 6 M HCl. The samples along with the standard phosphorylated amino acids (serine, threonine, and tyrosine) were spotted onto cellulose sheets (EMD Chemicals Inc., Gibbstown, NJ) and separated by two-dimensional thin-layer chromatography (18). The dried plates were stained with ninhydrin to reveal the positions of the migrated phospho-amino acid standards, and the radioactive hydrolyzed products were visualized by autoradiography.

In vivo detection of Thr-phosphorylated Pn-RR06 from S. pneumoniae type 6A wild-type and 6AΔphpP mutant strains.

The 6A wild-type and the isogenic 6AΔphpP mutant strains grown to log phase were harvested, washed with 1× phosphate-buffered saline (PBS), and lysed in lysis buffer (PBS containing lyzsozyme, 1% [vol/vol] NP-40, DNase, RNase, and protease [Calbiochem]-phosphatase inhibitor [Roche] cocktails). The native RR06 in the pneumococcal lysates was immunoprecipitated with a 1:20 dilution of protein A-conjugated affinity-purified polyclonal mouse-anti-Pn-RR06 IgG and protein A-conjugated affinity-purified polyclonal mouse IgG (control serum) with incubation at 4°C for 16 h. The immunoprecipitated RR06-IgG complex in the lysate was sequestered by using protein A-Sepharose beads, washed thoroughly, suspended in reducing sample buffer, and boiled. The proteins were then resolved by SDS-PAGE and immunoblotting using anti-Pn-RR06 (input control) and anti-phosphothreonine (42H4) mouse monoclonal antibody (9386S; Cell Signaling).

Promoter-binding studies with RR06 of S. pneumoniae.

Electrophoretic mobility shift experiments were performed using end-labeled 26-bp Oligo-2 (encompassing the promoter element upstream of cbpA) essentially as described previously (27). The labeled oligonucleotide was incubated at 30°C for 90 min with various concentrations of StkkP-phosphorylated Pn-RR06 and Pn-RR06D51A in 20 μl binding buffer. The same concentrations of nonphosphorylated wild-type and mutant RR06 proteins were also used for the binding experiments. To establish the specificity of the StkkP-phosphorylated wild-type RR06 in binding to DNA, PhpP was also included in the reaction mixture. The autophosphorylated StkkP was incubated with the 32P-labeled 26-bp promoter element PcbpA26bp as a control. Protein-DNA complexes were separated on 4% native PAGE gels at 120 V for 90 min and visualized by autoradiography. The band intensities were quantitated using AlphaInnotech ImageQuant densitometric software. The ratio of the concentration of nonphosphorylated RR06 versus phosphorylated RR06 required to achieve 50% of the maximum binding of phosphorylated RR06 to PcbpA was used to determine the relative binding efficiency of StkkP-phosphorylated RR06 to PcbpA.

RESULTS

Construction of markerless, nonpolar Ser/Thr phosphatase knockout (ΔphpP) mutants in S. pneumoniae strains.

Since phpP and stkP are cotranscribed in an operon with the transcription of phpP (SPD_1543) preceding stkP (SPD_1542) (Fig. 1A), and considering the substantial diversity in pneumococcal serotypes (9), we employed the well-established two-step Janus cassette-based strategy to derive nonpolar, markerless ΔphpP mutants, D39ΔphpP and 6AΔphpP, from two distinct strains, the type 2 D39 strain (23) and a type 6A (EF3314) strain (2, 24), respectively. Genotypic integrity of these mutants was confirmed by PCR and DNA sequencing and was based on (i) combination of flanking primers that showed a PCR product of 2.0 kb in the mutants (Fig. 1B, lanes 3 and 6), unlike the 2.7-kb product in the wild types (Fig. 1B, lanes 2 and 4), and (ii) the presence or absence of the gene-specific PCR product in the wild types (Fig. 1C, lanes 1 and 4) and the corresponding ΔphpP mutants (Fig. 1C, lanes 3 and 5).

Fig 1.

Fig 1

Construction of nonpolar PhpP mutants in 6A and D39 strains of S. pneumoniae. (A) Schematic representation of the genome organization of the wild-type S. pneumoniae phpP-stkP operon with an intergenic region depicting a transcription terminator between SPD_1542 and SPD_1541. Forward and reverse arrows indicate the primers used for confirming gene deletion in the mutants. (B) PCR amplification confirming the deletion of phpP in the mutants by using SG1F/SG2R is described in the text and Table S1. The arrow (2.7 kb) and arrowhead (2.0 kb) indicate PCR products obtained from the wild-type and ΔphpP mutant strains. (C) PCR amplification with phpP-gene specific primers (see Table S1 in the supplemental material). DNA gel showing the presence of PCR product with genomic DNA templates from only wild-type 6A/D39 strains and not with those from the 6AΔphpP and D39ΔphpP strains. (D) Western blot analysis using anti-PhpP (α-PhpP) antibody showing the presence of PhpP in the total cell lysates of wild-type (lanes 1 and 4) and PhpP-complemented (lanes 2 and 6) strains and the absence of PhpP in the mutants (lanes 3 and 5). (E) Demonstration of PhpP expression by Western blot analysis using anti-PhpP antibody in the culture supernatants (extracellular) of the wild-type and mutant strains. MW, prestained molecular weight marker. (F) The level of cotranscribing StkP in the 6A-WT (lane 1) and D39-WT (lane 3) strains and in their corresponding ΔphpP mutants (lanes 2 and 4) as assessed by Western blot analysis using anti-StkP antibody. Expression of glyceraldehyde-3-phosphate dehydrogenase (GAPDH)/streptococcal surface dehydrogenase (SDH) (40) in the total cell lysates was used as a loading control (18). (G and H) Growth characteristics of the wild types (G) and D39 and their isogenic mutant strains (6AΔphpP [G] and 6AΔphpP [H]) in THY broth. Growth was monitored spectrophotometrically at A600 over 10 h. The bar diagram underneath each growth curve represents the CFU of the indicated strain grown to A600 of 0.8. Error bars represent means ± standard deviations obtained from at least three independent experiments.

Western blot analysis using anti-PhpP antibody revealed the absence of PhpP protein in the cell lysates of both 6AΔphpP and D39ΔphpP mutant strains (Fig. 1D, lanes 3 and 5). The absence of PhpP protein in the extracellular medium harvested from both the mutant strains compared with their corresponding wild-type strains eliminated the possibility of the presence of PhpP even in the extracellular fraction (Fig. 1E). The complementation of 6AΔphpP and D39ΔphpP mutant strains with the wild-type phpP gene revealed successful restoration of PhpP expression in the mutant strains (Fig. 1D, lanes 2 and 6).

The detection of an immunoreactive band corresponding to StkP at ∼72 kDa in the mutants (Fig. 1F), comparable to their wild-type strains, confirmed the unaltered expression of the downstream stk gene. Further, these results were also verified by unaltered expression of an stkP-specific mRNA transcript in both the 6AΔphpP and the D39ΔphpP mutant strains (see Table S3 in the supplemental material), confirming the nonpolarity of the phpP mutants. The presence of a strong Rho-independent transcription terminator, 5′-1563622AATCAATCTTTGTCATGATTTCATGGCAAAGATTT TTT1563570-3′ (with a free energy of −17.6 kCal/mol) in the 114-bp intergenic region between open reading frame SPD_1541 and SPD_1542 in D39 and an equivalent region in 6A (Fig. 1A) (11) ensured the nonpolarity of the mutants.

The growth patterns of the ΔphpP mutants over a period of 12 h (Fig. 1G and H) and the biomass (CFU results in Fig. 1G and H) achieved at 10 h were found to be comparable to those of the corresponding wild-type strains, indicating that the deletion of phpP did not affect pneumococcal replication. Additionally, overnight cultures (16 h) of ΔphpP mutants displayed increased autolysis in comparison to their respective wild types (see Fig. S1 in the supplemental material). The latter corroborated the results showing upregulation of the autolysin-encoding gene lytA (2.4- to 3.5-fold) (Table 1).

Table 1.

Real-time PCR results for phpP-deleted strains derived from wild-type 6A and D39 S. pneumoniae strainsa

Functional category and gene(s) 6AΔphpP
D39ΔphpP
Normalized ratio Fold change Normalized ratio Fold change
Biofilm and adherence-associated genes
    cbpA/pspC 4.3 ± 0.6 +4.3 2.0 ± 0.4 +2.0
    pavA 20.6 ± 4.4 +20.0 8.0 ± 3.3 +8.0
    lytA 2.4 ± 0.4 +2.4 3.5 ± 0.5 +3.5
    enolase 6.2 ± 0.5 +6.0 5.8 ± 0.7 +5.8
    pcpA 2.6 ± 1.2 +2.6 7.0 ± 2.7 +7.0
    cps2A 0.07 ± 0.01* −14.0 12.0 ± 5.0 +12
    lytB 2.6 ± 0.1 +2.6 3.7 ± 0.5 +3.7
Cell growth and division-associated genes
    pcsB 0.9 ± 0.08* +1.0 2.8 ± 0.4 +2.8
    ftsZ 8.3 ± 0.8 +8.3 3.3 ± 0.4 +3.3
Regulators
    stk 1.7 ± 0.3* +1.7 1.0 ± 0.07* +1.0
    stp 4.7e−4 ± 5.3−6 −2127.7 4.4e−5 ± 5.8e−6 −22,727
    rr02/vicR 2.5 ± 0.12 +2.5 4.0 ± 0.4 +4.0
a

Real-time qRT-PCR results, showing linear (means ± standard deviations) as well as the fold changes (calculated as described in Materials and Methods) for the indicated genes in phpP-deleted strains derived from the wild-type 6A and D39 S. pneumoniae strains. The primer sequences for PCR amplification are described in Table S2 of the supplemental material. Normalized ratios depict the mRNA copy number for the specific gene from the mutants versus that in the corresponding wild-type strain, after normalizing against 16S rRNA value. The linear fold change in mRNA expression level was analyzed using Exor4 software (Roche), and ≥2-fold up- (+) or downregulation (−) was considered significant.

*

, nonsignificant.

Role of PhpP in cell division/septum formation.

Since StkP and its homologs have been implicated in regulating cell division and hence bacterial growth in pneumococci and other pathogens (6, 12, 18, 34, 47), we hypothesized that the cotranscribing PhpP plays a cognate role in cell division. As a corollary to the growth patterns, we did not observe any apparent phenotypic (colony size and morphology) changes in the 6AΔphpP and D39ΔphpP mutants. Microscopic examination of the Gram-stained wild-type (6A and D39) and mutant (6AΔphpP and D39Δphp) strains, however, revealed that the mutants were aggregated and formed long chains, but without any obvious cell division defects (Fig. 2A and B). The ability of SYTO-9 to enter the cells with the exclusion of propidium iodide (PI; which permeates only dead cells) in both the ΔphpP mutants revealed them to be viable long-chain-forming bacteria (Fig. 2C). Transmission electron microscopy revealed both the ΔphpP mutants with cell walls relatively thicker than those of the wild-type strains (Fig. 2D to G). Additionally, the peripheral electron-dense fuzz observed around the 6A and D39 wild-type strains was completely absent in the 6AΔphpP strain, but only a subtle difference was observed in the D39ΔphpP mutant (Fig. 2F and G), indicating a possible direct or indirect regulatory role of PhpP in the expression of surface components, including surface proteins, capsule, and factors modulating cell wall biosynthesis.

Fig 2.

Fig 2

PhpP is involved in cell division and chain formation. (A and B) Gram-stained (A) and LIVE/DEAD-stained (B) overlay images of green SYTO-9 and red PI of the 6A and D39 wild-type and 6AΔphpP and D39ΔphpP mutant strains. (C to F) Transmission electron micrographs showing the ultrastructure of the 6A (C) and D39 (E) wild types and 6AΔphpP (D) and D39ΔphpP (F) mutant strains. Black and white arrows indicate the outer electron-dense layer and inner membrane, respectively.

PhpP provides a strain-specific survival advantage to S. pneumoniae under stressful conditions.

The role of StkP has been established in conferring to S. pneumoniae an ability to resist several hostile conditions encountered within the host (47). We therefore hypothesized that the dephosphorylation activity of the cotranscribing PhpP may confer opposing effects, and the mutant lacking PhpP may display increased resistance to the stress conditions. To investigate this, the 6AΔphpP and D39ΔphpP mutants were subjected to several stress conditions. Our results demonstrated that the deletion of phpP did not affect the growth rates (doubling time) of the ΔphpP mutants grown in chemically semidefined medium (C+Y) (Fig. 3A and B). When we compared the two ΔphpP mutants to their respective wild-type strains under various stress conditions (elevated temperature, high salt/osmotic stress, low pH, and H2O2 exposure/oxidative stress), only the 6AΔphpP mutant displayed retarded growth patterns under all stress conditions (Fig. 3C, E, G, and I). In contrast, the D39ΔphpP mutant displayed significant growth retardation only when exposed under high salt stress conditions (Fig. 3F versus B, D, H, and I), indicating that the ability of PhpP to provide a survival advantage to pneumococcus under certain stress conditions is strain specific and is not cognately regulated by StkP.

Fig 3.

Fig 3

The growth patterns of 6A and D39 wild types and their corresponding ΔphpP mutants grown under different stress conditions. The 6A and D39 wild types and corresponding ΔphpP mutants were grown in C+Y medium either under nonstress conditions (A and B) or various stress conditions (C to J) for a period of 10 to 12 h. The growth patterns of the indicated wild-type and mutants strains were spectrophotometrically measured at elevated temperatures (C and D), under high-salt conditions (E and F), at low pH (G and H), and under oxidative stress (I and J). The impact of oxidative stress on pneumococcal survival was measured based on the percentage of survival of the wild type and ΔphpP mutants (OD600, 0.4) exposed to 50 mM H2O2 for different time periods. Each data point represents an average of three independent readings plus the standard deviation.

Strain-specific role of PhpP in pneumococcal adherence and biofilm formation.

The type 6A (EF3114) strain has been shown to adhere effectively to human pharyngeal cells (2). D39, on the other hand, is a highly encapsulated and virulent strain (23), and although the capsule in general has been shown to prevent pneumococcal adherence (14, 15), it has been shown to be necessary for adherence and colonization (28). In this context, the predominant loss of the outermost dense structures in the 6AΔphpP mutant strain (Fig. 2D and E) in comparison to D39ΔphpP (Fig. 2F and G) prompted us to evaluate the potential of these mutant strains to adhere to Detroit 562 human pharyngeal cells. Our results demonstrated that the 6AΔphpP mutant was able to adhere effectively to the pharyngeal cells, unlike the D39ΔphpP mutant compared to its corresponding wild type (Fig. 4A). Upon complementation of these mutants with the wild-type phpP, these increased and decreased adherence patterns were restored to the levels presented by the respective wild-type strains (Fig. 4A).

Fig 4.

Fig 4

Effect of deletion of the phpP gene in pneumococcal adherence to human pharyngeal cells and biofilm formation. (A) The ability of 6A and D39 pneumococcal wild type strains and their corresponding 6AΔphpP and D39ΔphpP mutants to adhere to Detroit 562 human nasopharyngeal cells. (B) Ability to form biofilms by the wild type (6A and D39) strains and their corresponding ΔphpP mutant and phpP-complemented strains. The data represent means ± standard deviations of A595 values from two independent experiments performed in 10 wells.

A similar pattern was observed for the biofilm-forming abilities of the mutant strains. The 6AΔphpP mutant displayed increased biofilm within 72 h of incubation in comparison to the wild-type 6A strain. (Fig. 4B). In contrast, although D39 displayed adherence to the plate, the corresponding D39ΔphpP mutant displayed only a marginal reduction in biofilm formation (Fig. 4B). Together, the results shown in Fig. 4A and B corroborate those shown in Fig. 2 and once again highlight the strain-specific role of PhpP in the regulation of pneumococcal adherence and biofilm formation, which are controlled by numerous surface components/proteins (14).

Gene expression profile in the absence of PhpP.

Based on the distinct strain-specific roles of PhpP in controlling pneumococcal cell division, adherence, and biofilm formation in S. pneumoniae, we envisaged that the expression profiles of certain key genes controlling such phenotypes in these mutants would also show a similar pattern. To investigate and validate this, we measured the mRNA/transcript abundance of 10 genes whose products have been shown to be directly or indirectly related to chain length, adherence, and biofilm formation.

The qRT-PCR analyses of these 10 genes for ΔphpP mutants displayed differential expression of genes with a distinct pattern (Table 1). The expression profile of the 6AΔphpP mutant strain displayed downregulation of the gene cpsA (capsule), with upregulation of the other remaining genes. In contrast to these findings, the D39ΔphpP mutant displayed severalfold upregulation of all the genes included in the study (Table 1). In particular, the upregulation of rr02 (vicR) (2.5- to 4-fold), pcsB (up to 3-fold), and ftsZ (3- to 8-fold) correlated well with the observed increased chain lengths and aggregating natures of both the mutants (Fig. 2A and B). Similarly, down- and upregulation of cpsA in 6AΔphpP and cps2A in D39ΔphpP, respectively, also corroborated the loss of the outer electron-dense structure only in 6AΔphpP (Fig. 2D to G). In conjunction with these results, upregulation of many genes encoding surface proteins, including cbpA (14, 25, 27, 50), displayed a parallel pattern of adherence and biofilm formation in 6AΔphpP (Fig. 3). The opposite pattern that was observed in the D39ΔphpP strain was likely due increased cps2A expression /capsule.

RR06 is reversibly phosphorylated by StkP-PhpP in vitro and in vivo.

Among many pneumococcal adhesins, CbpA has been shown to be a major adhesin that plays an important role in pneumococcal pathogenesis (14, 25, 27, 50). In pneumococcus, CbpA expression is controlled by TCS06 via histidine kinase HK06-mediated phosphorylation of RR06 (27, 50). RR06-mediated functions have also been found to occur in the absence of HK06 (27). In this context, and based on the increased ability of 6AΔphpP mutant to adhere to pharyngeal cells (Fig. 4) and upregulation (4.3-fold) of cbpA gene expression in this mutant (Table 1), we hypothesized that the phosphatase activity of PhpP negatively regulates CbpA expression, and in the absence of PhpP, the unrestricted activity of StkP serves as an alternative kinase to phosphorylate RR06.

To investigate this, we performed in vitro reversible phosphorylation of RR06 in the presence of StkP and PhpP. In the direct in vitro reversible phosphorylation assay, we observed the ability of StkkP to specifically phosphorylate RR06 and its subsequent dephosphorylation upon the addition of PhpP (Fig. 5A). Our further investigation to detect specific amino acid residues targeted by StkkP by thin-layer chromatography revealed that StkkP specifically phosphorylated threonine residues of RR06 (Fig. 5B). Additionally, our findings also highlighted that StkkP could catalyze the phosphorylation of the mutant RR06 lacking the canonical catalytic aspartate 51 (Asp51) residue, which is classically phosphorylated by its cognate histidine kinase (HK06) (50). Together, these results indicated that StkP phosphorylates RR06 at its threonine residues independently of the HK06-mediated Asp residue-targeted phosphorylation (Fig. 5C and D).

Fig 5.

Fig 5

In vitro and in vivo StkP- and PhpP-mediated reversible phosphorylation of the response regulator Pn-RR06 of TCS06. (A and B) The StkkP-PhpP couple-mediated reversible phosphorylation of the wild-type Pn-RR06 (A) and its catalytic variant RR06D51A (B) as revealed in an in vitro kinase assay. The outcomes under various reaction conditions (shown on top) were measured by resolving proteins in the reaction mixtures by using 16% SDS-PAGE gels stained with Coomassie stain (lower panels) and corresponding autoradiograms (upper panels). MW, molecular mass markers, in kDa. (C and D) The specific phosphorylation at the threonine residues in both StkkP-phosphorylated wild-type Pn-RR06 (C) and RR06D51A (D), as determined by TLC. The TLC plates were sprayed with ninhydrin prior to autoradiography to detect phosphorylated Ser (pS), Thr (pT), and Tyr (pY) amino acids as, indicated by the arrows. (E) Determination of in vivo Thr phosphorylation of RR06 in 6A-WT and 6AΔphpP mutant strains. Western blot analysis showing the reactivities of immunoprecipitated RR06 from the whole-cell lysates of log-phase-grown 6A wild-type and 6AΔphpP mutant strains to mouse anti-RR06 antibody and anti-phospho-Thr antibodies. MW, molecular mass markers, in kDa.

To further investigate whether the observed in vitro StkP-mediated phosphorylation of RR06 occurs in vivo and hence is physiologically relevant, we immunoprecipitated RR06 from the whole-cell extracts of both the 6A-WT and 6AΔphpP strains using anti-RR06 antibody and investigated its reactivity with anti-phosphothreonine antibody in a Western blot analysis. Our results demonstrated that immunoprecipitated RR06 from the 6AΔphpP mutant strain displayed more pronounced reactivity with anti-phosphothreonine antibody (Fig. 5E, lanes 2 and 4), indicating that RR06 undergoes constant reversible phosphorylation at its targeted threonine residues in the wild-type 6A strain, and that StkP-mediated Thr phosphorylation remains unrestricted in the absence of PhpP in the 6AΔphpP mutant strain. The nonspecific IgG was unable to immunoprecipitate RR06 from the whole-cell lysates of 6A-WT and 6AΔphpP mutant strains; hence, the absence of immunoreactivity with anti-phosphothreonine antibody (Fig. 5E, lanes 1 and 4) confirmed the specificity of the experiment.

Thr-phosphorylated RR06 binds efficiently to the PcbpA promoter.

Since RR06 Asp phosphorylation is directly implicated in its efficient binding to the cbpA promoter (27, 50) and StkP phosphorylates RR06 at threonine residues independently of HK06 under both in vitro and in vivo conditions (Fig. 5), we further hypothesized that the direct StkP-mediated phosphorylation of RR06 facilitates efficient binding to the DNA-binding site of the cbpA promoter and drives the transcription of the cbpA gene, and also that the PhpP-mediated dephosphorylation negatively impacts the StkP-driven transcriptional regulation.

To investigate whether Thr-phosphorylated RR06 binds more efficiently to PcbpA, we measured the binding of unphosphorylated RR06, StkkP-phosphorylated RR06, and RR06D51A to the γ-32P-labeled 26-bp binding region of the promoter PcbpA (PcbpA26bp) (27) in an electrophoretic mobility shift assay. Our initial results with three different concentrations (5 to 15 μM) of RR06 phosphorylated with StkkP revealed a dose-dependent increase in binding (Fig. 6A). Notably, StkkP alone did not form any detectable complex with the promoter. Further, the PhpP-treated Thr-phosphorylated RR06 (40 μM) displayed a binding efficiency equal to that of the unphosphorylated RR06 (Fig. 6B), indicating that Thr phosphorylation of RR06 by StkP plays a crucial role in promoter binding and that the PhpP protein cognately regulates this binding. To investigate the kinetics of binding of RR06 to the promoter PcbpA26bp and the impact of Thr phosphorylation on the relative efficiency of its binding, we compared the kinetics of promoter binding by using the same concentrations (0.3 to 20 μM) of RR06 and its variant, RR06D51A (with the canonical catalytic D51 residue replaced by alanine) to their corresponding StkkP-phosphorylated forms (Fig. 6C and E). Densitometric analysis of the DNA-protein adducts formed with the unphosphorylated and the phosphorylated RR06 was carried out to quantify the differences in the DNA-binding efficiencies. The result revealed that the amount of unphosphorylated RR06 required to achieve 50% maximum binding was 3-fold higher (∼9 μM) than with StkkP-phosphorylated RR06 (∼3 μM) (Fig. 6D and F).

Fig 6.

Fig 6

The ability of untreated and Thr-phosphorylated RR06 and its catalytic variant, RR06D51A, to bind to the promoter of cbpA. (A) Electrophoretic mobility shift assay (EMSA) showing slow-migrating DNA-protein complex (marked with a C), formed by different concentrations (in μM) of RR06 and RR06D51A with γ-32P-labeled 26-bp PcbpA26bp (marked with an F). (B) EMSA showing the ability of 20 μM and 40 μM RR06 to form DNA-protein complexes with PcbpA26bp in the presence and absence of StkkP and PhpP. (C and D) EMSA- (C) and densitometry-based kinetic analysis (D) depicting the binding abilities of untreated and StkkP-phosphorylated RR06 (0.3 to 20 μM) to PcbpA26bp. (E and F) EMSA- (E) and densitometry-based kinetic analysis (F) depicting the ability of untreated and StkkP-phosphorylated RR06D51A (0.3 to 20 μM) bind to PcbpA26bp. Arrows in panlels D and F indicate the amount of native RR06 or RR06D51A required for achieving 50% of the maximum binding obtained by their corresponding phosphorylated forms.

These results thus indicated that posttranslational modification of RR06 by the reversible phosphorylation mediated by StkP and PhpP is an important and efficient alternative mechanism to regulate CbpA expression and pneumococcal adherence, similar to the classical phosphorylation of RR06 at its aspartate residue by its cognate HK06 (50).

DISCUSSION

S. pneumoniae, like other well-established Gram-positive pathogens such as S. aureus (36) and S. pyogenes (10), possesses a multitude of virulence factors (14); hence, pneumococcal pathogenesis and virulence in general are multifactorial (19). Since many of the disease symptoms are outcomes of the expression of more than one virulence factor produced in the right quantity, with appropriate modification and available at the right time, the resulting dynamic mechanism of its pathogenesis is highly complex. It is therefore of immense importance and advantage to understand the dynamic nature of virulence regulators that control and/or modify the expression of virulence factors as per the need of the bacterium in a given environment. In this regard for pneumococcus, so far only the two-component systems have received primary attention (41). Recent reports on the pneumococcus eukaryotic-type serine threonine kinase, StkP, and its cotranscribing phosphatase PhpP (12, 13, 55) have provided evidence that StkP can serve as an alternative regulatory system and is capable of fine-tuning the well-established regulatory system. However, information on the function of the cotranscribing PhpP is not available. In this report, we provide the first detailed characterization of pneumococcus PhpP knockout mutants in two different strains. Based on their phenotypic characterizations, we highlighted two major aspects of the role of PhpP in pneumococcus physiology and early events of pneumococcal pathogenesis. (i) Because of the continuous variation in pneumococcal serotypes, the regulatory role of PhpP for many functions is strain specific. (ii) PhpP in conjunction with StkP cognately regulates the function of certain response regulators, such as RR06, for the expression of genes it directly regulates, independently of the canonical HK06-mediated Asp phosphorylation.

It is interesting that, despite the unique capability of pneumococcus to change its serotypes, the genomic organizations of StkP and PhpP and their flanking regions, including the intergenic regions, are completely conserved in all sequenced pneumococci, indicating that the transcription and functions of these gene products are evolutionarily conserved. As a result, although we designed a mutation strategy (primer design) based on the D39 sequenced genome, it was possible to employ the same strategy (including the primer design) to derive and complement the ΔphpP mutant from the type 6A EF3114 strain. Although the latter has not been sequenced, the genetic environment of StkP- and PhpP-coding genes that is available for pneumococcal strains (including the incomplete genome sequences of type 6A CDC1873-00 [[http://www.ncbi.nlm.nih.gov/genome?Db=genomeCmd=ShowDetailView&TermToSearch=5871] and SP06-BS73 [http://www.ncbi.nlm.nih.gov/genome?Db=genome&Cmd=ShowDetailView&TermToSearch=5688]) is identical to SPD_1543 and SPD_1542. The D39 genome and other strains also harbor two more serine/threonine phosphatase homologs (SPD_0539 and SPD_1061, and equivalents in others), but they do not possess any sequence similarity and lack the conserved catalytic motifs, I to XI, the hallmarks of the eukaryote-like PP2C family of phosphatases (49). Thus, the successful creation of D39ΔphpP and 6AΔphpP mutants displaying no growth defects, as has also been reported for STP mutants derived from S. aureus N315 (6), S. pyogenes M1SF370 M1T1 5448 (1), and Enterococcus faecalis (20), emphasizes the fact that PhpP is not essential for either pneumococcal growth or survival. From these published studies and the present study, we conclude that the successful creation of STP mutants in general is due to an appropriate vector-based deletion strategy that allows nonpolar and markerless deletion. A previous unsuccessful attempt to create a ΔphpP mutant in the R6A pneumococcal strain (38) was likely due to the use of a vector that may have resulted in deleterious effects.

One of the striking features of ΔphpP mutants is that they display strain specificity for certain regulation mechanisms. In the present study, we observed strain specificity for adherence and biofilm formation. While type 6A-derived ΔphpP mutants displayed an increased ability to adhere to human pharyngeal cells and form biofilms, the D39-derived ΔphpP mutants displayed either opposite or no changes. We believe that these intriguing strain-specific opposite phenotypes are in part due to the decreased and increased cps2A-specific transcript abundance levels in 6AΔphpP and D39ΔphpP, respectively. Besides the downregulation of a capsule-specific gene, the 6AΔphpP mutant also displayed upregulation of genes encoding many surface adhesins (PavA, enolase, CbpA, and PsaA) (14, 17, 19, 42), and hence the resulting situation for this mutant became more advantageous for adherence and for biofilm formation. The increased capacity of 6AΔphpP to form biofilms could also be attributed to the positive role played by certain upregulated (2- to 4-fold) genes, such as those encoding LytA, LytB, CbpA, and PcpA (33), along with reduced expression of a capsule-forming gene (33) whose expression levels have been shown to play a critical role in biofilm formation. In the case of the D39ΔphpP mutant, despite high expression of many adhesin-encoding genes, the capsule synthesis was not reduced; in fact, the expression of cpsA was upregulated. Thus, the increased expression of capsule abrogated the advantageous situation created by the upregulated adhesin-encoding genes, resulting in reduced adherence and biofilm formation. The ability of highly capsulated the D39 wild type to adhere to human pharyngeal cells as well as the type 6A transparent variant strain used in the present study supports the essential nature of the D39 capsule for colonization (28, 31). It is likely that the initial binding of the D39 wild-type strain to pharyngeal cells is due to a required reduction in the capsule content in response to pharyngeal cell contact (28, 32, 56) and a concomitant availability of the pneumococcal surface adhesins to bind to the pharyngeal cell surface receptors, as has been reported for A549 and Hep-2 cells (15). The mechanism behind the direct or indirect role of PhpP in differentially regulating cpsA in two different strains is presently not known, but it is likely related to the ability of PhpP to interface with other dynamically regulated pneumococcal signaling systems, such as VicR/K (57), which was found to be upregulated in the ΔphpP mutants and has been shown to possess distinct regulatory roles in bacterial chain formation, cell wall thickness, and expression of certain cell surface adhesins in capsulated and noncapsulated pneumococcal strains (4, 57).

As in other prokaryotes, pneumococcal His-Asp phospho-relay systems of TCSs are believed to be the primary regulatory systems that respond and translate environmental cues into cellular responses and thus control multiple facets of pneumococcal physiology, including competence, virulence, fatty acid biosynthesis, and cell division (22, 53). Although the literature on the ability of one-component systems (ESTK/Ps) to overlap, integrate, and control the TCSs initially indicated such a system to be present in nonpathogenic Myxococcus xanthus (26), recent reports have demonstrated the ability of STK to phosphorylate CovR, a two-component response regulator of Streptococcus agalactiae (45), CovR and WalR of S. pyogenes (1, 39), and an orphan RitR regulator of S. pneumoniae (55). Besides the indirect impacts of capsule regulation on the adherence patterns of 6AΔphpP and D39ΔphpP, the upregulation of a major pneumococcal adhesin gene, cbpA (14, 17, 19), in these mutants (4.3-fold and 2.4-fold, respectively) prompted us to establish a physiologically relevant link between the lack of PhpP and the RR06/HK06 of TCS06, which positively and differentially regulates the expression of CbpA in different pneumococcal strains (16, 25, 29, 50). The causal relationship of RR06 and the lack of PhpP expression for CbpA expression are more obvious in light of the fact that the phosphorylated status of RR06 has been observed even in a pneumococcal mutant lacking HK06 (27). Therefore, we speculated that the elevated level of cbpA could possibly be a consequence of StkP-mediated uncontrolled phosphorylation of RR06 and resulting transactivation of the cbpA promoter. In this regard, our three important observations demonstrating (i) reversible in vitro phosphorylation of RR06 and (ii) RR06D51A by StkP and PhpP that is (iii) directed specifically against threonine residues clearly indicated that the StkP-mediated phosphorylation occurs independently of the classical HK06-mediated Asp51-targeted phosphorylation. We substantiated these observations by demonstrating an increased amount of Thr-phosphorylated RR06 immunoprecipitated from the whole-cell lysate of the 6AΔphpP mutant, which possesses unrestricted StkP activity in the absence of PhpP. Additionally, the abilities of the StkkP-phosphorylated RR06 and RR06D51A to bind efficiently to the cbpA promoter but at a 3-fold-lower concentration than that required by the nonphosphorylated native form of RR06 denotes that the phosphorylation by noncognate kinase at alternate sites (Ser/Thr) other than the classical catalytically active Asp51 can also induce the expression of cbpA in an HK06-indpendent manner.

It is not known at present how and what kind of functionally active conformational changes the StkP-mediated Thr-phosphorylation brings in RR06. However, it is clear based on the biochemical properties of Thr phosphorylation versus Asp phosphorylation that the conformational changes brought by Thr phosphorylation are much more stable than that brought by Asp phosphorylation (46). Emerging evidence, however, indicates that this two-state model of RR (active-phosphorylated and inactive-non-Asp-phosphorylated RR) might be an oversimplification, and the number of physiologically relevant conformational states within the population may vary between the RRs (51). The StkP-phosphorylated RR06 seems to possess a hitherto-unknown unique structure that allows efficient promoter binding in vitro and also in vivo and subsequently modulates cbpA gene transcription. The existence of both HK06 and StkP and their corresponding unstable and stable phosphorylation status of RR06 reflect that there exists a critical balance between phosphorylation and dephosphorylation events mediated by both one- and two-component systems driving the expression of CbpA. Overall, our study is the first report demonstrating the convergence of the StkP/PhpP one-component system with the well-studied RR06/HK06 TCS06 in pneumococcus.

Supplementary Material

Supplemental material

ACKNOWLEDGMENTS

We sincerely thank Hua Hua Tong for type 6A and D39 pneumococcal strains, Don Morrison and Samantha King for the Janus cassette, and Shireen A Woodiga for her help in construction of the nonpolar Janus cassette.

This study was in part supported by a Bill and Melinda Gates Foundation Grand Challenge III grant to V.P. and departmental funds to P.P.

Footnotes

Published ahead of print 6 February 2012

Supplemental material for this article may be found at http://iai.asm.org/.

REFERENCES

  • 1. Agarwal S, Agarwal S, Pancholi P, Pancholi V. 2011. Role of serine/threonine phosphatase (SP-STP) in Streptococcus pyogenes physiology and virulence. J. Biol. Chem. 286:41368–41380 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2. Andersson B, et al. 1981. Adhesion of Streptococcus pneumoniae to human pharyngeal epithelial cells in vitro: differences in adhesion capacity among strains isolated from subjects with otitis media septicemia, or meningitis or from healthy carriers. Infect. Immun. 32:311–317 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3. Archambaud C, Gouin E, Pizarro-Cerda J, Cossart P, Dussurget O. 2005. Translation elongation factor EF-Tu is a target for Stp, a serine-threonine phosphatase involved in virulence of Listeria monocytogenes. Mol. Microbiol. 56:383–396 [DOI] [PubMed] [Google Scholar]
  • 4. Barendt SM, et al. 2009. Influences of capsule on cell shape and chain formation of wild-type and pcsB mutants of serotype 2 Streptococcus pneumoniae. J. Bacteriol. 191:3024–3040 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5. Beier D, Gross R. 2006. Regulation of bacterial virulence by two-component systems. Curr. Opin. Microbiol. 9:143–152 [DOI] [PubMed] [Google Scholar]
  • 6. Beltramini AM, Mukhopadhyay CD, Pancholi V. 2009. Modulation of cell wall structure and antimicrobial susceptibility by a Staphylococcus aureus eukaryotic-like serine/threonine kinase and phosphatase. Infect. Immun. 77:1406–1416 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7. Burnside K, et al. 2010. Regulation of hemolysin expression and virulence of Staphylococcus aureus by a serine/threonine kinase and phosphatase. PLoS One 5:e11071. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8. Chaffin DO, Rubens CE. 1998. Blue/white screening of recombinant plasmids in Gram-positive bacteria by interruption of alkaline phosphatase gene (phoZ) expression. Gene 219:91–99 [DOI] [PubMed] [Google Scholar]
  • 9. Croucher NJ, et al. 2011. Rapid pneumococcal evolution in response to clinical interventions. Science 331:430–434 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10. Cunningham MW. 2000. Pathogenesis of group A streptococcal infections. Clin. Microbiol. Rev. 13:470–511 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11. de Hoon MJ, Makita Y, Nakai K, Miyano S. 2005. Prediction of transcriptional terminators in Bacillus subtilis and related species. PLoS Comput. Biol. 1:e25. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12. Echenique J, Kadioglu A, Romao S, Andrew PW, Trombe MC. 2004. Protein serine/threonine kinase StkP positively controls virulence and competence in Streptococcus pneumoniae. Infect. Immun. 72:2434–2437 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13. Giefing C, et al. 2008. Discovery of a novel class of highly conserved vaccine antigens using genomic scale antigenic fingerprinting of pneumococcus with human antibodies. J. Exp. Med. 205:117–131 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14. Hammerschmidt S. 2006. Adherence molecules of pathogenic pneumococci. Curr. Opin. Microbiol. 9:12–20 [DOI] [PubMed] [Google Scholar]
  • 15. Hammerschmidt S, et al. 2005. Illustration of pneumococcal polysaccharide capsule during adherence and invasion of epithelial cells. Infect. Immun. 73:4653–4667 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16. Hendriksen WT, et al. 2007. Regulation of gene expression in Streptococcus pneumoniae by response regulator 09 is strain dependent. J. Bacteriol. 189:1382–1389 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17. Jedrzejas MJ. 2001. Pneumococcal virulence factors: structure and function. Microbiol. Mol. Biol. Rev. 65:187–207 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18. Jin H, Pancholi V. 2006. Identification and biochemical characterization of a eukaryotic-type serine/threonine kinase and its cognate phosphatase in Streptococcus pyogenes: their biological functions and substrate identification. J. Mol. Biol. 357:1351–1372 [DOI] [PubMed] [Google Scholar]
  • 19. Kadioglu A, Weiser JN, Paton JC, Andrew PW. 2008. The role of Streptococcus pneumoniae virulence factors in host respiratory colonization and disease. Nat. Rev. Microbiol. 6:288–301 [DOI] [PubMed] [Google Scholar]
  • 20. Kristich CJ, Little JL, Hall CL, Hoff JS. 2011. Reciprocal regulation of cephalosporin resistance in Enterococcus faecalis. mBio 2:e00199–e00111 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21. Lacks S, Hotchkiss RD. 1960. A study of the genetic material determining an enzyme activity in Pneumococcus. Biochim. Biophys. Acta 39:508–517 [DOI] [PubMed] [Google Scholar]
  • 22. Lange R, et al. 1999. Domain organization and molecular characterization of 13 two-component systems identified by genome sequencing of Streptococcus pneumoniae. Gene 237:223–234 [DOI] [PubMed] [Google Scholar]
  • 23. Lanie JA, et al. 2007. Genome sequence of Avery's virulent serotype 2 strain D39 of Streptococcus pneumoniae and comparison with that of unencapsulated laboratory strain R6. J. Bacteriol. 189:38–51 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24. Li Q, et al. 2011. Essential role of factor B of the alternative complement pathway in complement activation and opsonophagocytosis during acute pneumococcal otitis media in mice. Infect. Immun. 79:2578–2585 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25. Lu L, Ma Y, Zhang JR. 2006. Streptococcus pneumoniae recruits complement factor H through the amino terminus of CbpA. J. Biol. Chem. 281:15464–15474 [DOI] [PubMed] [Google Scholar]
  • 26. Lux R, Shi W. 2005. A novel bacterial signaling system with a combination of a Ser/Thr kinase cascade and a His/Asp two-component system. Mol. Microbiol. 58:345–348 [DOI] [PubMed] [Google Scholar]
  • 27. Ma Z, Zhang JR. 2007. RR06 activates transcription of spr1996 and cbpA in Streptococcus pneumoniae. J. Bacteriol. 189:2497–2509 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28. Magee AD, Yother J. 2001. Requirement for capsule in colonization by Streptococcus pneumoniae. Infect. Immun. 69:3755–3761 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29. McCluskey J, Hinds J, Husain S, Witney A, Mitchell TJ. 2004. A two-component system that controls the expression of pneumococcal surface antigen A (PsaA) and regulates virulence and resistance to oxidative stress in Streptococcus pneumoniae. Mol. Microbiol. 51:1661–1675 [DOI] [PubMed] [Google Scholar]
  • 30. Moffitt KL, et al. 2011. TH17-based vaccine design for prevention of Streptococcus pneumoniae colonization. Cell Host Microbe 9:158–165 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31. Morona JK, Morona R, Paton JC. 2006. Attachment of capsular polysaccharide to the cell wall of Streptococcus pneumoniae type 2 is required for invasive disease. Proc. Natl. Acad. Sci. U. S. A. 103:8505–8510 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32. Morona JK, Paton JC, Miller DC, Morona R. 2000. Tyrosine phosphorylation of CpsD negatively regulates capsular polysaccharide biosynthesis in Streptococcus pneumoniae. Mol. Microbiol. 35:1431–1442 [DOI] [PubMed] [Google Scholar]
  • 33. Moscoso M, Garcia E, Lopez R. 2009. Pneumococcal biofilms. Int. Microbiol. 12:77–85 [PubMed] [Google Scholar]
  • 34. Novakova L, et al. 2010. Identification of multiple substrates of the StkP, Ser/Thr protein kinase, in Streptococcus pneumoniae. J. Bacteriol. 192:3629–3638 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35. Novakova L, et al. 2005. Characterization of a eukaryotic type serine/threonine protein kinase and protein phosphatase of Streptococcus pneumoniae and identification of kinase substrates. FEBS Lett. 272:1243–1254 [DOI] [PubMed] [Google Scholar]
  • 36. Novick RP. 2003. Autoinduction and signal transduction in the regulation of staphylococcal virulence. Mol. Microbiol. 48:1429–1449 [DOI] [PubMed] [Google Scholar]
  • 37. O'Brien KL, et al. 2009. Burden of disease caused by Streptococcus pneumoniae in children younger than 5 years: global estimates. Lancet 374:893–902 [DOI] [PubMed] [Google Scholar]
  • 38. Osaki M, et al. 2009. The StkP/PhpP signaling couple in Streptococcus pneumoniae: cellular organization and physiological characterization. J. Bacteriol. 191:4943–4950 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39. Pancholi V, Boël G, Jin H. 2010. Streptococcus pyogenes Ser/Thr kinase-regulated cell wall hydrolase is a cell division plane-recognizing and chain-forming virulence factor. J. Biol. Chem. 285:30861–30874 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40. Pancholi V, Fischetti VA. 1992. A major surface protein on group A streptococci is a glyceraldehyde-3-phosphate dehydrogenase with multiple binding activity. J. Exp. Med. 176:415–426 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41. Paterson GK, Blue CE, Mitchell TJ. 2006. Role of two-component systems in the virulence of Streptococcus pneumoniae. J. Med. Microbiol. 55:355–363 [DOI] [PubMed] [Google Scholar]
  • 42. Paterson GK, Orihuela CJ. 2010. Pneumococcal microbial surface components recognizing adhesive matrix molecules targeting of the extracellular matrix. Mol. Microbiol. 77:1–5 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43. Pereira SFF, Goss L, Dworkin J. 2011. Eukaryote-like serine/threonine kinases and phosphatases in bacteria. Microbiol. Mol. Biol. Rev. 75:192–212 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44. Rajagopal L, Clancy A, Rubens CE. 2003. A eukaryotic type serine/threonine kinase and phosphatase in Streptococcus agalactiae reversibly phosphorylate an inorganic pyrophosphatase and affect growth, cell segregation, and virulence. J. Biol. Chem. 278:14429–14441 [DOI] [PubMed] [Google Scholar]
  • 45. Rajagopal L, Vo A, Silvestroni A, Rubens CE. 2006. Regulation of cytotoxin expression by converging eukaryotic-type and two-component signaling mechanisms in Streptococcus agalactiae. Mol. Microbiol. 62:941–957 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46. Robinson VL, Buckler DR, Stock AM. 2000. A tale of two components; a novel kinase and regulatory switch. Nat. Struct. Biol. 7:626–633 [DOI] [PubMed] [Google Scholar]
  • 47. Saskova L, Novakova L, Basler M, Branny P. 2007. Eukaryotic-type serine/threonine protein kinase StkP is a global regulator of gene expression in Streptococcus pneumoniae. J. Bacteriol. 189:4168–4179 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48. Shakir SM, et al. 2010. Regulatory interactions of a virulence-associated serine/threonine phosphatase-kinase pair in Bacillus anthracis. J. Bacteriol. 192:400–409 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49. Shi Y. 2009. Serine/threonine phosphatases: mechanism through structure. Cell 139:468–484 [DOI] [PubMed] [Google Scholar]
  • 50. Standish AJ, Stroeher UH, Paton JC. 2005. The two-component signal transduction system RR06/HK06 regulates expression of cbpA in Streptococcus pneumoniae. Proc. Natl. Acad. Sci. U. S. A. 102:7701–7706 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51. Stock AM, Guhaniyogi J. 2006. A new perspective on response regulator activation. J. Bacteriol. 188:7328–7330 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52. Sung CK, Li H, Claverys JP, Morrison DA. 2001. An rpsL cassette, Janus, for gene replacement through negative selection in Streptococcus pneumoniae. Appl. Environ. Microbiol. 67:5190–5196 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53. Throup JP, et al. 2000. A genomic analysis of two-component signal transduction in Streptococcus pneumoniae. Mol. Microbiol. 35:566–576 [DOI] [PubMed] [Google Scholar]
  • 54. Uchiyama S, et al. 2009. The surface anchored NanA protein promotes pneumococcal brain endothelial cell invasion. J. Exp. Med. 206:1845–1852 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55. Ulijasz AT, Falk SP, Weisblum B. 2009. Phosphorylation of the Ritr DNA-binding domain by a Ser-Thr phosphokinase: implications for global gene regulation in the streptococci. Mol. Microbiol. 71:382–390 [DOI] [PubMed] [Google Scholar]
  • 56. Weiser JN, et al. 2001. Changes in availability of oxygen accentuate differences in capsular polysaccharide expression by phenotypic variants and clinical isolates of Streptococcus pneumoniae. Infect. Immun. 69:5430–5439 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57. Winkler ME, Hoch JA. 2008. Essentiality, bypass, and targeting of the YycFG (VicRK) two-component regulatory system in gram-positive bacteria. J. Bacteriol. 190:2645–2648 [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplemental material

Articles from Infection and Immunity are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES