Molecular Markers for Detection and Differentiation of Plasmodium falciparum and Plasmodium vivax in Human Blood Samples by Pyrosequencing

Abstract

PCR amplification coupled with pyrosequencing was used to measure molecular markers that could be used to detect and differentiate Plasmodium falciparum and Plasmodium vivax in human blood samples. The detection rates were in agreement with the results of Giemsa-stained film microscopy, which is the current gold standard for detection. This method provides an exciting alternative for malaria diagnosis.

TEXT

Malaria is a highly prevalent tropical disease that caused an estimated 781,000 deaths in 2009; there are approximately 225 million cases in 106 countries (11). The standard method for laboratory diagnosis of malaria is microscopy of Giemsa-stained thick and thin blood films. Improved diagnostic procedures are needed to facilitate the treatment of infected individuals. Recently, alternative diagnostic methods with sufficient sensitivity, e.g., antigen- and antibody-based detection, hemozoin detection, and molecular (DNA) detection tests (2, 7, 9), have been developed as supportive tools. Here, we report the use of PCR amplification coupled with high-throughput DNA analysis using pyrosequencing to measure the Plasmodium rRNA gene as a molecular marker for the detection and differentiation of Plasmodium falciparum and Plasmodium vivax, the most prevalent plasmodia, in human blood samples. This technology is not currently employed to delineate species of Plasmodium.

Forty-three leftover EDTA blood samples from patients diagnosed with malaria were obtained from the hematology units of Mae-Sod Hospital, Tak Province, northern Thailand, and Phang-nga Hospital, Phang-nga Province, southern Thailand. Thin and thick blood smears were stained using the Giemsa method (10) for examination, with 100 microscopic fields analyzed to confirm diagnosis. Twenty-five samples were positive for P. falciparum, 17 were positive for P. vivax, and one sample showed mixed infection with P. falciparum and Plasmodium malariae. DNA was extracted from 200 μl of EDTA-treated blood samples using a NucleoSpin blood kit (Macherey-Nagel, Duren, Germany). DNA was eluted in 100 μl of 5 mM Tris-HCl (pH 8.5) and was kept at −20°C until testing.

This study was approved by the Khon Kaen University Ethics Committee for Human Research (reference number HE541292). The small-subunit rRNA gene of P. vivax (GenBank accession no. U83877) and that of P. falciparum (GenBank accession no. AF145334) were aligned and targeted using the Plas_F (5′-AACGAAAGTTAAGGGAGTGAAGAC-3′) and Plas_R (5′-CCCAGAACCCAAAGACTTTGAT-3′) primers for PCR amplification; the sequencing primer Plas_S (5′-TAATCTTAACCATAAACTATGCCG-3′) was used for pyrosequencing (Fig. 1). The Plas_F and biotinylated Plas_R primers were used to amplify a 171-bp fragment during the PCR assay, which was carried out using a GeneAmp PCR system 9700 thermal cycler (Applied Biosystems, Singapore). This PCR was performed in a 25-μl volume using 1 μl of template DNA, a 1 μM concentration of each primer, 2.5 μl of 10× PCR buffer (including 1.5 mM MgSO₄ and a 0.2 mM concentration of the deoxynucleoside triphosphates [dNTPs]), and 0.5 U of Platinum Taq DNA polymerase high fidelity (Invitrogen, Carlsbad, CA). The following amplification procedure was used: initial denaturation at 95°C for 5 min; 35 cycles of 94°C for 30 s, 60°C for 30 s, and 72°C for 45 s; and a final extension at 72°C for 7 min. The obtained PCR product was visualized using a 1.5% agarose gel.

Fig 1.

Alignment of the small-subunit rRNA genes derived from P. vivax (GenBank accession no. U83877) and P. falciparum (GenBank accession no. AF145334). Plas_F and Plas_R indicate the positions of forward and reverse PCR primers, respectively; Plas_S indicates the position of the sequencing primer. The target region and four asterisks in the target region indicate the positions that were used to identify and differentiate P. vivax and P. falciparum by pyrosequencing.

Twenty microliters of the biotinylated PCR products was immobilized on streptavidin-coated Sepharose beads (streptavidin Sepharose HP; GE Healthcare BioSciences AB, Uppsala, Sweden) in binding buffer (10 mM Tris-HCl, pH 7.6, 2 M NaCl, 1 mM EDTA, 0.1% Tween 20). Beads containing the immobilized template were captured on filter probes after vacuum application, washed with 70% ethanol, denatured with 0.2 M NaOH, and washed with 10 mM Tris-acetate (pH 7.6) using a pyrosequencing vacuum prep workstation (Biotage, Uppsala, Sweden). Finally, the beads were released into a PSQ 96 plate low (Biotage) containing 40 μl of annealing buffer (20 mM Tris-acetate, 5 mM magnesium acetate, pH 7.6) with a 0.4 μM concentration of sequencing primer. Samples were heated at 80°C for 2 min and were allowed to cool to room temperature before pyrosequencing reactions were performed using PyroMark Gold Q96 SQA reagents on a PSQ 96MA instrument (Biotage). A negative control without PCR-positive template DNA was included. The PSQ 96MA version 2.1 software was used to analyze the sequencing results. Because the target sequences contained up to four homopolymers, the readouts were interpreted manually to compensate for software limitations (8).

Positive-control plasmids of P. vivax and P. falciparum DNA were constructed by amplification of the 171-bp PCR products using Plas_F and nonbiotinylated Plas_R primers and by cloning these products into the pGEM-T easy vector (Promega, WI). Recombinant plasmids were propagated in Escherichia coli JM109. Nucleotide sequences of inserted DNA were sequenced in both directions for confirmation. To confirm the pyrosequencing data, all malaria samples were amplified using Plas_F and Plas_R primers and then sequenced using the Sanger method and the MegaBACE 1000 DNA analysis system (GE Healthcare, Piscataway, NJ).

The 171-bp target fragment was amplified using Plas_F and biotinylated Plas_R primers. The Plas_S sequencing primer was designed to anneal immediately upstream of the target positions, resulting in pyrosequencing read lengths of 24 and 21 bp (Fig. 1 and 2). Figure 2 shows representative results for the detection of 4 different nucleotides. Analysis of positive-control plasmids for P. vivax (Fig. 2a) and P. falciparum (Fig. 2d) showed compatibility with the gene sequences from which the primers were designed, whereas a negative control that lacked a positive DNA template and normal human blood did not result in pyrograms (data not shown). The preparation and analysis were repeated three times, with similar results each time. When using these positions, the pyrosequencing results from all 25 P. falciparum- and 17 P. vivax-infected blood samples from the Tak and Phang-nga Provinces corroborated the results obtained by Giemsa stain microscopy. One sample with mixed P. falciparum and P. malariae, however, was identified as being singly infected with P. falciparum by pyrosequencing. All pyrosequencing results were validated by the Sanger sequencing method, and both methods revealed identical results. Furthermore, there was no intraspecies nucleotide variation derived from different isolates from different areas.

Fig 2.

Pyrograms exhibiting sequence analysis of 24 and 21 base fragments of the small-subunit rRNA genes of P. vivax (a to c) and P. falciparum (d to f), respectively, as detected by pyrosequencing. Pyrosequencing was performed by the addition of enzyme (E) and substrate (S), and four different nucleotides enclosed in two squares in the pyrograms were analyzed to discriminate P. vivax (a to c) and P. falciparum (d to f). Pyrograms represent the two different sequences underlined in P. vivax (a to c), ACTAGGCTTTGGATGAAAGATTTT, and P. falciparum (d to f), ACTAGGTGTTGGATGAAAGTG, derived from positive-control plasmids (a, d) and patients from hospitals in Mae-Sod (b, e) and Phang-Nga (c, f), Thailand. Theoretical pyrogram patterns (top of each panel shown in histograms) and examples of raw data from pyrosequencing (bottom of each panel shown in peaks) are shown. The y axis indicates the level of fluorescence emitted by the incorporation of a particular nucleotide base, and the x axis indicates the total number of bases added at that point in time (A, T, C, and G nucleotide bases).

Pyrosequencing is a DNA-sequencing technology based on sequencing by synthesis principles (1). This method has been used for high-throughput identification of protozoan parasites (4–6), and it offers the ability to detect nucleotide polymorphisms that can be used for the differentiation of species and genotypes. In the present study, we developed a technique for the detection and determination of species in human blood samples singly infected with P. vivax or P. falciparum. Mixed infection remains an unsolved problem. The pyrogram results showed only the P. falciparum sequence in this sample, which may be due to the presence of larger amounts of P. falciparum than P. malariae, and thus the latter may consequently be overshadowed. In case of mixed infection, further optimization through multiplex pyrosequencing is required for the measurement of nucleotide variation among different species of Plasmodium. This approach has already been successfully used for single-nucleotide genotyping and hepatitis C virus (HCV) genotyping (3). This new technique offers another alternative for diagnosis of infection, especially where additional confirmation of malaria is needed, e.g., when Giemsa-stained thick films produce poor results. This application is also a cost-effective method of malaria diagnosis, leading to a reduction in the need for microscopists, as this method measures the parasite burden in 96 blood samples at one time. In modern laboratories, the cost of the instrument used in this method can be offset by its use for other tests. In addition, with the continuous improvements in pyrosequencing methodology and bioinformatics, this method would result in cost reductions and would be more user-friendly, which would inevitably make this technique more accessible to clinical laboratories in the near future.