Skip to main content
Journal of Clinical Microbiology logoLink to Journal of Clinical Microbiology
. 2012 Apr;50(4):1171–1177. doi: 10.1128/JCM.06609-11

Evaluation of Several Biochemical and Molecular Techniques for Identification of Streptococcus pneumoniae and Streptococcus pseudopneumoniae and Their Detection in Respiratory Samples

Els Wessels 1,✉, Jacqueline J G Schelfaut 1, Alexandra T Bernards 1, Eric C J Claas 1
PMCID: PMC3318541  PMID: 22278834

Abstract

The identification and detection of mitis group streptococci, which contain Streptococcus pneumoniae, have been hampered by the lack of sensitive and specific assays. In this study, we evaluated several biochemical and molecular assays for the identification of S. pneumoniae and Streptococcus pseudopneumoniae and their distinction from other mitis group streptococci using a collection of 54 isolates obtained by the routine culturing of 53 respiratory specimens from patients with community-acquired pneumonia. The combined results of the biochemical and molecular assays indicated the presence of 23 S. pneumoniae, 2 S. pseudopneumoniae, and 29 other mitis group streptococcal isolates. The tube bile solubility test that is considered gold standard for the identification of S. pneumoniae showed concordant results with optochin susceptibility testing (CO2 atmosphere) and a real-time multiplex PCR assay targeting the Spn9802 fragment and the autolysin gene. Optochin susceptibility testing upon incubation in an O2 atmosphere, bile solubility testing by oxgall disk, matrix-assisted laser desorption ionization–time of flight mass spectrometry, and sequence analysis of the tuf and rpoB genes resulted in several false-positive, false-negative, or inconclusive results. The S. pseudopneumoniae isolates could be identified only by molecular assays, and the multiplex real-time PCR assay was concluded to be most convenient for the identification of S. pneumoniae and S. pseudopneumoniae isolates. Using this method, S. pneumoniae and S. pseudopneumoniae DNA could be detected in the respiratory samples from which they were isolated and in an additional 11 samples from which only other streptococci were isolated.

INTRODUCTION

Streptococcus pneumoniae is a major cause of community-acquired pneumonia (CAP). There is no true gold standard for S. pneumoniae identification, but the bile solubility test has been shown to have a high level of accuracy and is frequently used for the identification of S. pneumoniae (18). Since this test is relatively time-consuming and sometimes difficult to interpret, several other conventional biochemical and phenotypic tests, like Gram stain morphology, optochin susceptibility, colony morphology, and alpha-hemolysis on sheep blood agar, are currently applied as part of routine procedures in the clinical microbiology laboratory. S. pneumoniae belongs to the mitis group of streptococci, and several molecular assays have been applied in an attempt to discriminate S. pneumoniae from other mitis group streptococci. A variety of genes has been used as target for a (real-time) PCR assay to detect S. pneumoniae, including genes encoding the virulence factors autolysin (lytA) and pneumolysin (ply) and the DNA fragment Spn9802 (1, 4, 7, 16, 22, 25, 32). However, most of these PCR assays are not able to discriminate S. pneumoniae from the recently discovered Streptococcus pseudopneumoniae and other mitis group streptococci. As an alternative approach, sequence analysis of several genes has been used for the species-level identification of streptococci (8, 9, 15, 24, 28, 33, 36). Recently, matrix-assisted laser desorption ionization–time of flight mass spectrometry (MALDI-TOF MS) has also been suggested as a tool for the rapid identification of mitis group streptococci, and although S. pneumoniae was shown previously to be identified correctly by MALDI-TOF MS, other members of the mitis group were also misidentified as such (11, 12, 31).

In 2004, Arbique et al. described a novel streptococcal species called S. pseudopneumoniae (5). It contains no pneumococcal capsules, is resistant or has indeterminate susceptibility to optochin when incubated in a CO2 atmosphere but is susceptible when incubated in an O2 atmosphere, and is not soluble in bile. Since the routine diagnostic procedures in most clinical laboratories do not discriminate S. pseudopneumoniae from S. pneumoniae and other mitis group streptococci, little is known about the clinical importance of this new species. Patients with S. pseudopneumoniae infection may be more likely to have a history of chronic obstructive pulmonary disease (COPD) or an exacerbation of COPD than patients with S. pneumoniae infection (17). Another study also described a potential pathogenic role, since infection with several S. pseudopneumoniae strains killed infected mice (14). The development of an assay that can discriminate S. pseudopneumoniae from S. pneumoniae and other mitis group streptococci and that can easily be implemented in routine diagnostic procedures will result in more insight into the clinical importance of S. pseudopneumoniae.

Here we evaluated several biochemical and molecular assays for the identification of S. pneumoniae and other mitis group streptococci using a collection of isolates obtained by the routine culturing of respiratory specimens from patients with CAP, exacerbation of COPD, or acute sinusitis. The biochemical assays that were used were bile solubility testing by classical tube bile solubility and oxgall disk and optochin susceptibility testing upon incubation in CO2 and O2 atmospheres. The molecular assays used were MALDI-TOF MS, real-time PCR assays targeting the Spn9802 fragment and the lytA gene, and sequence analysis of the tuf and rpoB genes (7, 9, 28, 32, 35). In addition, the presence of S. pneumoniae and S. pseudopneumoniae was determined in the respiratory specimens from which the isolates of the collection were isolated.

MATERIALS AND METHODS

Bacterial isolates and clinical specimens.

From March 2010 until March 2011, respiratory specimens from patients with CAP, exacerbation of COPD, or acute sinusitis were collected. Fifty-three sputum samples from which one or more isolates were cultured that were suspected to be S. pneumoniae based on colony morphology were included in this study, together with the corresponding isolates. Isolates (in 15% glycerol broth) and patient samples were stored at −20°C until further investigation. S. pneumoniae (ATCC 6305 and ATCC 49619), S. pseudopneumoniae (CCUG 48465 and CCUG 49455), Streptococcus mitis (LMG 14552 and LMG 14557), Streptococcus oralis (LMG 14532 and LMG 14533), and Streptococcus pyogenes (ATCC 19615) were used as reference strains.

Bile solubility testing.

Two tests were used for bile solubility testing. The tube bile solubility test was performed by incubating the isolates overnight in tryptic soy broth and, after centrifugation, adding phosphate-buffered saline (pH 7.0) to the pellet to make a suspension with a final density of a McFarland standard of >1.5. Three to four drops of Na-taurocholate and Na-glycocholate (10%; Oxoid Ltd., United Kingdom) were then added to the suspension, which was carefully mixed. The tubes were incubated at 35°C for 3 h until analysis. Isolates were considered bile soluble if the suspension was clear and negative when opaque. The test was not interpretable if the suspension was not homogeneous. S. pneumoniae and S. pyogenes were used as positive and negative controls, respectively.

The oxgall disk test was performed by overnight incubation on blood agar plates with oxgall disks containing 1,000 μg oxgall (Rosco Diagnostica, Denmark) in a CO2 atmosphere. Solubility in bile was defined as a zone diameter of ≥19 mm. A zone diameter of 18 was considered an ambiguous result, and zone diameters of ≤17 mm indicated the growth of a microorganism that is not soluble in bile.

Optochin susceptibility test.

The optochin susceptibility test was performed by the incubation of the isolate overnight on blood agar plates with optochin tablets (Rosco Diagnostica, Denmark) in CO2 and O2 atmospheres. Optochin susceptibility and resistance were defined as zones of inhibition of ≥18 mm and <16 mm (upon CO2 incubation) or ≥20 mm and <18 mm (upon O2 incubation), respectively. Zone diameters of 16 or 17 (upon CO2 incubation) and 18 or 19 (upon O2 incubation) were considered ambiguous results.

MALDI-TOF MS.

MALDI-TOF MS was performed as described previously (35). Briefly, a single colony was transferred in duplicate onto the target plate and overlaid with matrix solution (saturated solution of α-cyano-4-hydroxycinnamic acid in 50% acetonitrile and 2.5% trifluoroacetic acid). Samples were analyzed with a Microflex mass spectrometer (Bruker Daltonik, Bremen, Germany) using FlexControl software. Pattern-matching scores below 1.7 and the result “not yet present” or “no peaks found” were considered no reliable identification. Scores of ≥1.7 to <2.0, ≥2.0 to <2.3, and ≥2.3 to <3.0 were considered identification reliable to the genus level (+), identification reliable to the genus level and probably to the species level (++), and identification reliable to the species level (+++), respectively.

DNA extraction for real-time PCR and sequence analysis.

The DNA of isolates was extracted from a solution with a McFarland standard of 0.5 by using the QIAamp DNA blood minikit (Qiagen, Hilden, Germany). DNA from clinical respiratory specimens was extracted by using the Total Nucleic Acid Kit—High Performance on the MagNA Pure LC system (Roche Diagnostics, Penzberg, Germany). Both extraction methods were performed according to the manufacturer's instructions.

Real-time PCR assays targeting Spn9802 and lytA.

The real-time PCR assays targeting the Spn9802 and lytA fragments were adapted from methods described previously by Suzuki et al. (32) and Carvalho et al. (7). The primers and probes for the inhibition and extraction control phocine herpesvirus (PhHV) were described previously (34). All primers and probes are described in Table 1. The real-time PCR assays were performed with a 50-μl reaction mixture consisting of 25 μl HotStar Taq Master Mix (Qiagen, Hilden, Germany), 3.5 mM MgCl2, 0.3 μM each primer, 0.3 μM (Spn9802 and lytA) or 0.05 μM (PhHV) probe, and 10 μl DNA. The thermal cycling conditions consisted of an initial incubation step for 15 min at 95°C followed by 45 cycles of 30 s at 95°C, 30 s at 55°C, and 30 s at 72°C. Real-time PCR was performed by using a CFX96 real-time PCR detection system (Bio-Rad, Veenendaal, Netherlands).

Table 1.

Sequences of oligonucleotides used in this study

Primer or probe Sequence and label (5′–3′)a Product size (bp)
Spn9802 forward CAAGTCGTTCCAAGGTAACAAGTCT 162
Spn9802 reverse CTAAACCAACTCGACCACCTCTTT
Spn9802 MGB probe 6-FAM–TAGTTTCCTACATGTACG–MGBNFQ
LytA forward ACGCAATCTAGCAGATGAAGCA 75
LytA reverse TCGTGCGTTTTAATTCCAGCT
LytA TaqMan probe Q705-TGCCGAAAACGCTTGATACAGGGAG-BHQ2
PhHV forward ATGCATTTAAAACCCTCAAA 89
PhHV reverse GCATCAACTTCTTCGACAAT
PhHV TaqMan probe Cy5-CCTGGTTTTTATCGTACGGGAACA-BHQ2
Tuf forward TTGGTTGAAATGGAAATCCGTG 514
Tuf reverse GTCCACCTTCTTCTTTAGTAAG
RpoB forward CCAAACGTYGGKGAAGATGC 705
RpoB reverse TGIARTTTRTCATCAACCATGTG
a

FAM, carboxyfluorescein; MGBNFQ, minor groove binding nonfluorescent quencher; BHQ2, black hole quencher 2; Q705, Quasar 705; Cy5, indodicarbocyanine.

Sequence analysis of the tuf and rpoB genes.

Both tuf and rpoB primers were designed based on alignments of tuf and rpoB gene sequences available in the GenBank database (Table 1). The rpoB reverse primer was obtained from Drancourt et al. (9). The PCR assays were performed in a 50-μl reaction mixture consisting of 25 μl HotStar Taq Master Mix (Qiagen, Hilden, Germany), 1.5 mM MgCl2, 0.2 μM each primer, and 5 μl DNA. The thermal cycling conditions consisted of an initial incubation step for 15 min at 95°C, followed by 35 cycles of 10 s at 95°C, 20 s at 50°C, and 2 min at 72°C and a final elongation step for 10 min at 72°C. PCR was performed by using a MyCycler thermal cycler (Bio-Rad, Veenendaal, Netherlands). Sequence analysis of the tuf and rpoB genes was performed as described previously (19).

RESULTS

Biochemical assays for detection of S. pneumoniae and S. pseudopneumoniae.

The routine procedure for the detection of S. pneumoniae in our laboratory is optochin susceptibility testing in CO2 in combination with bile solubility testing. Since the tube bile solubility test is time-consuming, we evaluated whether bile solubility testing by use of an oxgall disk is a good alternative. To enable the detection of S. pseudopneumoniae, optochin susceptibility testing in O2 was also performed in this study. One isolate was excluded from the biochemical analysis since it could not be recultured. The results of the tube and disk bile solubility tests were concordant for 33 isolates and not concordant for 6 isolates, and for the remaining 14 isolates, one of the results was not interpretable or was ambiguous (Table 2 and see Table S1 in the supplemental material). Of the 33 concordant results, 23 isolates were soluble in bile and thus were most likely S. pneumoniae isolates. These 23 isolates were optochin susceptible upon incubation in O2 and CO2 atmospheres. As described below, a real-time PCR targeting the Spn9802 fragment and the lytA gene can discriminate S. pneumoniae and S. pseudopneumoniae from other streptococci, since the Spn9802 PCR detects S. pneumoniae and S. pseudopneumoniae, and the lytA PCR detects only S. pneumoniae. The results of these real-time PCR assays indicated that 22 of these isolates were S. pneumoniae and that 1 isolate was S. pseudopneumoniae. The isolate that was soluble in bile by tube bile solubility testing but not soluble in bile by oxgall disk testing was optochin resistant upon incubation in CO2 and optochin susceptible upon incubation in O2. The results of the real-time PCR assays indicated that this isolate was an S. pseudopneumoniae isolate. The other five isolates that showed no concordant results in the bile solubility tests were all optochin resistant upon incubation in CO2. Three of these isolates were also optochin resistant upon incubation in O2, whereas one isolate was susceptible and one isolate showed ambiguous results. The results of the real-time PCR assays indicated that these five isolates were not S. pneumoniae or S. pseudopneumoniae. The results of optochin testing upon incubation in CO2 and the tube bile solubility test were always concordant, except for one isolate, which was most likely an S. pseudopneumoniae isolate. However, the tube bile solubility test result was not interpretable for nine isolates, making this test less reliable than optochin testing.

Table 2.

Summary of results of several biochemical assays compared to the interpretation of Spn9802 and lytA real-time PCR resultsa

No. of isolates Biochemical assay result
Interpretation of RT-PCR results
Bile solubility Optochin CO2 Optochin O2 Oxgall disk
21 Soluble Susceptible Susceptible Soluble S. pneumoniae
1 Soluble Susceptible ND Soluble S. pneumoniae
1 ND ND ND ND S. pneumoniae
1 Soluble Resistant Susceptible Not soluble S. pseudopneumoniae
1 Soluble Susceptible Susceptible Soluble S. pseudopneumoniae
10 Not soluble Resistant Resistant Not soluble Other
5 Not interpretable Resistant Resistant Not soluble Other
4 Not soluble Resistant Resistant Ambiguous Other
3 Not soluble Resistant Resistant Soluble Other
3 Not interpretable Resistant Resistant Ambiguous Other
1 Not soluble Resistant Ambiguous Soluble Other
1 Not soluble Resistant Susceptible Soluble Other
1 Not soluble Resistant Susceptible Ambiguous Other
1 Not interpretable Resistant Resistant Soluble Other
a

RT-PCR, real-time PCR; other, not S. pneumoniae or S. pseudopneumoniae; ND, not determined.

Molecular assays for identification of S. pneumoniae and S. pseudopneumoniae.

Biochemical assays cause a delay in the identification of S. pneumoniae, since they always need overnight growth of the isolate and are unable to determine the presence of S. pseudopneumoniae. Therefore, the application of MALDI-TOF MS for the determination of mitis group streptococci was investigated. MALDI-TOF MS resulted in species-level identification (++ and +++) for 31 isolates and genus-level identification (+) for 11 isolates (Table 3 and see Table S1 in the supplemental material). For the remaining 10 isolates, no reliable identification was obtained. Of the 31 isolates that were identified to the species level, 28 were identified as S. pneumoniae, 1 was identified as S. pseudopneumoniae, 1 was identified as S. gordonii, and 1 was identified as S. sanguinis. Only 17 of the 28 isolates that were identified as S. pneumoniae by MALDI-TOF MS were identified as such by other methods.

Table 3.

Summary of results of several molecular methods for identification of S. pneumoniae, S. pseudopneumoniae, and other mitis group streptococcia

No. of isolates Organism identified by MALDI-TOF MS PCR result
Organism identified by sequence analysis
Spn9802 lytA tuf gene rpoB gene
11 S. pneumoniae Positive Positive S. pneumoniae S. pneumoniae
5 S. pneumoniae Positive Positive Mitis group S. pneumoniae
3 No reliable identification Positive Positive S. pneumoniae S. pneumoniae
2 ND Positive Positive S. pneumoniae S. pneumoniae
1 S. pneumoniae Positive Positive S. pneumoniae NA
1 Streptococcus spp. Positive Positive S. pneumoniae S. pneumoniae
1 S. pseudopneumoniae Positive Negative S. pseudopneumoniae S. pseudopneumoniae
1 S. pneumoniae Positive Negative S. pseudopneumoniae S. mitis
4 S. pneumoniae Negative Negative Mitis group S. mitis
2 S. pneumoniae Negative Negative S. oralis Mitis group
2 S. pneumoniae Negative Negative S. mitis S. mitis
2 Streptococcus spp. Negative Negative Mitis group S. infantis
2 Streptococcus spp. Negative Negative Mitis group S. mitis
2 Streptococcus spp. Negative Negative S. oralis Mitis group
2 Streptococcus spp. Negative Negative Mitis group Mitis group
2 No reliable identification Negative Negative Mitis group S. mitis
1 S. pneumoniae Negative Negative S. pseudopneumoniae Mitis group
1 S. pneumoniae Negative Negative S. mitis Mitis group
1 S. gordonii Negative Negative Mitis group S. gordonii
1 S. sanguinis Negative Negative S. sanguinis S. sanguinis
1 Streptococcus spp. Negative Negative S. parasanguinis S. parasanguinis
1 Streptococcus spp. Negative Negative S. oralis S. mitis
1 No reliable identification Negative Negative S. parasanguinis S. parasanguinis
1 No reliable identification Negative Negative Mitis group S. pseudopneumoniae
1 No reliable identification Negative Negative S. mitis S. mitis
1 No reliable identification Negative Negative S. parasinguinis NA
1 No reliable identification Negative Negative Mitis group Mitis group
a

ND, not determined; NA, not available. The mitis group consists of S. mitis, S. sanguinis, S. parasanguinis, S. gordonii, S. cristatus, S. oralis, S. infantis, S. peroris, S. australis, S. sinensis, S. orisratti, S. oligofermentans, S. massiliensis, S. pseudopneumoniae, and S. pneumoniae.

Reference strains of S. pneumoniae, S. pseudopneumoniae, S. mitis, and S. oralis were used to evaluate the multiplex real-time PCR assay targeting the Spn9802 fragment and the lytA gene. The Spn9802 PCR detected the tested reference strains of S. pneumoniae and S. pseudopneumoniae but not S. mitis and S. oralis, and the lytA PCR detected only S. pneumoniae reference strains. Thus, a combination of both real-time PCR assays allowed the discrimination of S. pneumoniae and S. pseudopneumoniae from S. mitis and S. oralis, thereby showing its potential for the rapid detection of S. pneumoniae and S. pseudopneumoniae. Low threshold cycle (CT) values (median CT values of 20.5 and 21.0, respectively) were obtained with the Spn9802 and lytA real-time PCR assays for 23 isolates, indicative for S. pneumoniae (Table 3 and see Table S1 in the supplemental material). The identification of these 23 isolates as S. pneumoniae isolates was concordant with the results of the biochemical assays. Two isolates were identified as S. pseudopneumoniae isolates, based on a positive Spn9802 real-time PCR with a low CT value (CT of 19.3 and CT of 19.5) and negative PCR results for lytA. The remaining 29 isolates were negative in the PCR assays and therefore were not considered S. pneumoniae or S. pseudopneumoniae isolates. Thus, the real-time PCR assays are convenient for the identification of S. pneumoniae and S. pseudopneumoniae.

For the identification of mitis group streptococci, sequence analysis of the tuf and rpoB genes was evaluated (Table 3 and see Table S1 in the supplemental material). Sequence analysis of the rpoB gene was concordant with the identification of S. pneumoniae for 22 of the 23 isolates. For the other isolate, no amplicon was obtained. Sequence analysis of the tuf gene confirmed the identification of S. pneumoniae for 18 of the 23 isolates. The other five isolates could be identified only to the mitis group level. Both isolates that were identified as S. pseudopneumoniae by real-time PCR were also identified as such by sequence analysis of the tuf gene, but sequence analysis of the rpoB gene identified one isolate as S. pseudopneumoniae and the other one as S. mitis. The rpoB genes of 28 of the 29 non-S. pneumoniae or non-S. pseudopneumoniae isolates could be amplified. The amplification of the tuf gene was successful for all isolates. However, sequence analysis of the tuf and rpoB amplicons resulted in species-level identifications for only 14 and 19 of the isolates, respectively. The other isolates could be identified only to the mitis group level. Species identifications were considered reliable if the sequence analysis of both genes resulted in identical species identifications. This was the case for only six non-S. pneumoniae or non-S. pseudopneumoniae isolates, making sequence analysis of the tuf and rpoB genes not suitable for the identification of mitis group streptococci.

Spn9802 and lytA real-time PCR assays on respiratory specimens.

Since the multiplex real-time Spn9802 and lytA PCR assays performed well on bacterial isolates, the diagnostic potential of the primers was evaluated on clinical specimens. The results of the real-time PCR assays on the respiratory specimens from which the isolates of the collection were isolated are depicted in Table S2 in the supplemental material. All respiratory samples from which an S. pneumoniae isolate was cultured were positive in both PCR assays with low CT values, thus indicative of the presence of S. pneumoniae in the sample. The median CT values of the Spn9802 and lytA PCRs were 22.3 (CT range, 17.6 to 29.1) and 21.7 (CT range, 17.9 to 29.6), respectively. Both respiratory samples from which S. pseudopneumoniae was isolated were positive only by the Spn9802 PCR, with CT values of 26.6 and 27.2.

Real-time PCRs on respiratory specimens from which mitis group streptococci other than S. pneumoniae or S. pseudopneumoniae were isolated were positive for both Spn9802 and lytA PCRs in four samples (median CT values of 24.8 [range, 19.2 to 35.6] and 25.3 [range, 19.2 to 33.5], respectively). Seven specimens showed positive results only by the Spn9802 PCR (median CT value, 32.9 [range, 25.9 to 35.7]), one specimen was positive only in the lytA PCR (CT value, 33.1), 12 specimens were negative in both PCRs, and the PCR was inhibited for four specimens. Thus, the results are suggestive of the presence of S. pneumoniae or S. pseudopneumoniae in 11 samples from which these species were not cultured.

DISCUSSION

In this study, we evaluated several biochemical and molecular methods for the identification of S. pneumoniae and S. pseudopneumoniae. The tube bile solubility test that is often considered the gold standard showed results comparable to those of optochin testing in a CO2 atmosphere and a multiplex real-time PCR assay targeting Spn9802 and lytA. The other biochemical and molecular assays tested in this study (optochin testing in O2, oxgall disk test, MALDI-TOF MS, and sequence analysis of the tuf and rpoB genes) yielded several false-positive or ambiguous results or were not able to discriminate S. pneumoniae and S. pseudopneumoniae from other mitis group streptococci.

S. pseudopneumoniae isolates have been described to be resistant or to have indeterminate susceptibility to optochin when incubated in CO2 but to be susceptible when incubated in O2 (5, 17). The first reports on S. pseudopneumoniae described it to be insoluble in bile, whereas a recent study described an S. pseudopneumoniae isolate that was soluble in bile (Table 4) (20). Since there is no gold standard for the identification of S. pseudopneumoniae, the multiplex real-time PCR targeting Spn9802 and lytA was considered the gold standard in this study. This PCR indicated the presence of two S. pseudopneumoniae isolates in the collection tested in this study. Both isolates were optochin susceptible when incubated in O2 and soluble in bile using the tube bile solubility test. However, one isolate was resistant to optochin when incubated in CO2 and not soluble in bile using the oxgall disk test, whereas the other isolate was susceptible to optochin when incubated in CO2 and soluble in bile using the oxgall disk test. The S. pseudopneumoniae reference strains originated from the group that first described S. pseudopneumoniae, and their biochemical characteristics were concordant with those described in that study (Table 4) (5). If the multiplex real-time PCR targeting Spn9802 and lytA is considered to be the gold standard for the identification of S. pseudopneumoniae, different S. pseudopneumoniae isolates have different biochemical characteristics. A possible explanation for this might be that S. pseudopneumoniae contains subspecies with different biochemical characteristics, which cannot be discriminated by molecular methods. To test this hypothesis, further analyses will be performed on prospectively collected S. pseudopneumoniae isolates.

Table 4.

Summary of biochemical characteristics of S. pseudopneumoniae isolates

Source or reference for S. pseudopneumoniae isolate Test resulta
Bile solubility Optochin CO2 Optochin O2 Oxgall disk
This study (isolate 29) Soluble Resistant Susceptible Not soluble
This study (isolate 68) Soluble Susceptible Susceptible Soluble
Reference strain CCUG 48465 Not soluble Resistant Susceptible Not soluble
Reference strain CCUG 49455 Not soluble Ambiguous Susceptible Soluble
5 (35 isolates) Not soluble Resistant Susceptible ND
17 (35 isolates) Not soluble Ambiguous Susceptible ND
20 (1 isolate) Soluble Susceptible Susceptible ND
a

ND, not determined.

To enable the investigation of the putative pathogenic role of S. pseudopneumoniae, we aimed to develop a fast and convenient assay to identify S. pseudopneumoniae. Several previous studies showed that a PCR assay targeting the Spn9802 fragment detects only S. pneumoniae and S. pseudopneumoniae but not S. mitis (4, 10, 32). False-positive results with Spn9802 primers have been described, and therefore, it remains unknown whether the Spn9802 DNA fragment is specific for S. pneumoniae and S. pseudopneumoniae or whether specificity is obtained by particular signatures (26). The latter scenario has been described for the lytA gene. This gene is usually considered specific for S. pneumoniae, but despite the use of the same target gene, the real-time lytA PCR described previously by McAvin et al. is not specific for S. pneumoniae, whereas the lytA PCR described previously by Carvalho et al. is (7, 22). This discrepancy can be explained by the finding that all S. pneumoniae isolates harbored typical lytA alleles, whereas lytA alleles detected in isolates that belong to other members of the mitis group were always atypical (21). Thus, the presence of the lytA gene is not specific for S. pneumoniae, but specific signatures within the lytA gene are. Therefore, we developed a multiplex real-time PCR targeting the Spn9802 fragment and the typical lytA gene. This assay should allow the rapid identification of S. pneumoniae and S. pseudopneumoniae, since S. pneumoniae isolates are positive in both PCR assays and S. pseudopneumoniae isolates are positive only in the Spn9802 PCR. Recently, another S. pseudopneumoniae-specific PCR assay was described (30). The target of this PCR is the recA gene, and since this PCR has also been validated on a limited number of S. pseudopneumoniae isolates, it would be interesting to test the available isolates by both PCR assays.

The tube bile solubility test is considered the gold standard for the identification of S. pneumoniae. The results of the multiplex PCR targeting Spn9802 and lytA and the tube bile solubility test were comparable for all S. pneumoniae isolates tested in this study. Also, the results were comparable for other mitis group streptococci, but the tube bile solubility results were not always interpretable, whereas the PCR results were. Therefore, the multiplex PCR, which most likely is also able to identify S. pseudopneumoniae, was considered the new gold standard. Compared to this new gold standard, the results of optochin testing in CO2 were concordant. Neither other biochemical assays nor MALDI-TOF was suitable for the proper identification of members of the mitis group of streptococci.

The use of tuf and rpoB sequence analysis for the identification of mitis group streptococci was investigated in this study. Although both genes have been described to be more suitable than the 16S rRNA gene (CLSI guidelines) (8a, 9, 28), only 6 out of 29 non-S. pneumoniae or non-S. pseudopneumoniae isolates could be reliably identified to the species level. Most isolates were identified only to the mitis group level. However, as sequences were analyzed by using the Basic Local Alignment Search Tool (BLAST) of the National Center for Biotechnology Information (NCBI) to search GenBank, the reliability of the result will be compromised by the fact that the accuracy and quality of the data are not guaranteed. The lack of a gold standard for the identification of mitis group streptococci makes it conceivable that GenBank contains wrong annotations, hampering correct identifications. Recently developed software allows the identification of mitis group streptococci via the Internet, but since sequences of seven housekeeping genes are required, it is not yet suitable for rapid routine diagnostic identification (6).

The multiplex real-time PCR assay described in this study also enables the detection of S. pneumoniae and S. pseudopneumoniae in clinical samples. S. pneumoniae is the leading cause of CAP worldwide, but a highly sensitive and specific detection method is still lacking. A positive blood culture provides a definite diagnosis, and therefore, several studies have investigated the role of S. pneumoniae PCR on blood samples in the diagnosis of pneumococcal pneumonia (2, 23, 27, 29). In comparison with blood cultures, the use of S. pneumoniae PCR leads to increased sensitivity, since antimicrobial treatment prior to the drawing of the blood sample has little or no influence on the positivity rate. However, since detectable bacteremia may accompany pneumococcal pneumonia in only a minority of cases, the sensitivity of the detection of S. pneumoniae in blood samples for the confirmation of pneumococcal pneumonia will remain low. The suggestion that a high S. pneumoniae load in blood might be a useful tool for the assessment of severity in patients with pneumococcal pneumonia shows the additional value of S. pneumoniae real-time PCR on blood (29). Several studies have investigated the use of PCR assays for the detection of S. pneumoniae in respiratory samples, but most studies were hampered by a low specificity of the used PCR assay (1, 3, 13, 23). This is the first study that investigated the presence of S. pneumoniae and S. pseudopneumoniae in respiratory specimens. Two recent studies described the presence of S. pneumoniae in respiratory samples with the Spn9802 real-time PCR that detects both S. pneumoniae and S. pseudopneumoniae, without a discrimination of the two species (3, 4). The data described in this paper show that for all respiratory samples from which S. pneumoniae or S. pseudopneumoniae isolates were cultured, S. pneumoniae or S. pseudopneumoniae was detected by real-time PCR with CT values lower than 30. For 4 out of 28 respiratory samples from which no S. pneumoniae or S. pseudopneumoniae was isolated, real-time PCR detected S. pneumoniae DNA. For one sample, the routine diagnostic procedure resulted in a culture of S. pneumoniae, but most likely, another isolate (not S. pneumoniae) was stored and used for this study. The other three discrepancies can be explained by the increased sensitivity of real-time PCR compared to that of culture, especially for patients treated with antibiotics prior to sputum collection. For those patients, real-time PCR might detect DNA from nonviable instead of viable bacteria. Another explanation might be that upon performing more than one real-time PCR on clinical samples, it is possible that the positive PCR results are obtained from different species within the sample. It is remarkable that seven specimens from which no S. pseudopneumoniae was cultured were positive only by the Spn9802 PCR and thus contained S. pseudopneumoniae, although S. pseudopneumoniae was cultured from only two specimens. This yields a low sensitivity of S. pseudopneumoniae culture (22%; 2 out of 9) compared to that of S. pneumoniae culture (85%; 23 out of 27). This may be due to the relatively low S. pseudopneumoniae load (median CT value of 32.9 for specimens from which S. pseudopneumoniae was not cultured, compared to CT values of 26.6 and 27.2 for specimens from which S. pseudopneumoniae was cultured) or the lack of a specific colony morphology. This study was not designed to discriminate between respiratory tract infections and the colonization of healthy individuals, and therefore, only patients with pneumonia, exacerbation of COPD, or acute sinusitis were included, and no control group was present. The methods described in this study may be a valuable tool for a prospective analysis to investigate the influence of a fast, sensitive, and specific identification of S. pneumoniae in respiratory materials on outcomes for patients with CAP.

During the inclusion period of this study, the routine diagnostic procedure for the identification of S. pneumoniae consisted of optochin susceptibility testing upon incubation in CO2 and bile solubility testing by use of an oxgall disk. When the results of these assays were discriminative or inconclusive, the classical tube bile solubility test was performed. Since this study showed that the oxgall disk test added no additional value to optochin susceptibility testing upon incubation in CO2, the routine diagnostic procedure for suspected S. pneumoniae isolates in our laboratory has been changed to optochin susceptibility testing alone. When the results are inconclusive or unexpected (e.g., penicillin-resistant S. pneumoniae), the real-time multiplex PCR targeting Spn9802 and lytA is performed on the bacterial suspension (without DNA isolation).

In summary, this study shows an extensive comparison between several molecular and biochemical methods for the identification and detection of S. pneumoniae and S. pseudopneumoniae. A combination of two real-time PCR assays targeting the Spn9802 and lytA genes was shown to be a valuable tool for the investigation of the presence of S. pneumoniae and S. pseudopneumoniae in respiratory specimens. The application of this method in a prospective analysis will elucidate the necessity of detecting S. pseudopneumoniae in a clinical microbiology laboratory.

Supplementary Material

Supplemental material

ACKNOWLEDGMENT

This study was supported by the Department of Clinical Microbiology, Leiden University Medical Center, Netherlands.

Footnotes

Published ahead of print 25 January 2012

Supplemental material for this article may be found at http://jcm.asm.org/.

REFERENCES

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplemental material

Articles from Journal of Clinical Microbiology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES