Skip to main content
Applied and Environmental Microbiology logoLink to Applied and Environmental Microbiology
. 2012 Apr;78(8):2923–2929. doi: 10.1128/AEM.07402-11

Assessing the Contributions of the LiaS Histidine Kinase to the Innate Resistance of Listeria monocytogenes to Nisin, Cephalosporins, and Disinfectants

Barry Collins a, Caitriona M Guinane b,c, Paul D Cotter b,c,✉, Colin Hill a,c,✉, R Paul Ross b,c
PMCID: PMC3318795  PMID: 22327581

Abstract

The Listeria monocytogenes LiaSR two-component system (2CS) encoded by lmo1021 and lmo1022 plays an important role in resistance to the food preservative nisin. A nonpolar deletion in the histidine kinase-encoding component (ΔliaS) resulted in a 4-fold increase in nisin resistance. In contrast, the ΔliaS strain exhibited increased sensitivity to a number of cephalosporin antibiotics (and was also altered with respect to its response to a variety of other antimicrobials, including the active agents of a number of disinfectants). This pattern of increased nisin resistance and reduced cephalosporin resistance in L. monocytogenes has previously been associated with mutation of a second histidine kinase, LisK, which is a predicted regulator of liaS and a penicillin binding protein encoded by lmo2229. We noted that lmo2229 transcription is increased in the ΔliaS mutant and in a ΔliaS ΔlisK double mutant and that disruption of lmo2229 in the ΔliaS ΔlisK mutant resulted in a dramatic sensitization to nisin but had a relatively minor impact on cephalosporin resistance. We anticipate that further efforts to unravel the complex mechanisms by which LiaSR impacts on the antimicrobial resistance of L. monocytogenes could facilitate the development of strategies to increase the susceptibility of the pathogen to these agents.

INTRODUCTION

Lantibiotics are ribosomally produced antimicrobial peptides which are enzymatically modified to generate lanthionine residues. Nisin is the prototype lantibiotic and has been used effectively for 50 years by the food industry to prevent the growth of both spoilage and pathogenic Gram-positive microorganisms, including Listeria monocytogenes (10). L. monocytogenes is an important food pathogen that causes the life-threatening disease listeriosis and is a major problem for the food industry (3). While nisin and several other lantibiotics possess significant clinical potential in that they are active at low concentrations against many targets (2, 35), are effective at killing antibiotic-resistant bacteria (39, 40), and are noncytotoxic and heat stable (29), it has been noted that Listeria spp. are relatively more nisin resistant than other Gram-positive pathogens (13). The continued use of nisin for food preservation and its potential clinical applications will be influenced by our ability to overcome the relatively greater innate resistance of specific targets, such as L. monocytogenes, and to prevent the emergence of populations that develop even greater levels of nisin resistance. It is first necessary to develop an understanding of the mechanisms and genetic loci that could potentially lead to the development of resistance. Indeed, with this knowledge, it may be possible to develop approaches to enhance the sensitivity of strains which are innately resistant. Many of the genes involved in nisin resistance fall into one of three subgroups: those which impact on the general composition of the cell envelope (38, 45), various transporters (11, 23, 27), or regulators and two-component signal transduction systems (2CS). 2CS not only play a role in nisin resistance, but some also have been linked to cephalosporin resistance and resistance to environmental stresses (6, 18, 20, 26). Notably, L. monocytogenes is innately resistant to cephalosporins (8), which is particularly significant when one considers that these antibiotics are routinely employed to treat infections of unknown etiology, such as an as-yet-undiagnosed case of listeriosis. Regulators which have been linked with nisin resistance include sigma factors, such as σB of L. monocytogenes (1), as well as a number of 2CS, including LisRK and LiaRS (8, 33). Indeed bacteria routinely employ 2CS to interface environmental stimuli and adaptive responses. As the name implies, they consist of two components: a histidine kinase (HK) and a response regulator (RR). The histidine kinase is a membrane-bound sensor protein which becomes phosphorylated upon activation by a stimulus and which in turn leads to the phosphorylation of the cytoplasmic response regulator which controls expression of the regulon (15). L. monocytogenes EGD-e has 16 2CS (47), which the pathogen utilizes to respond to stressful conditions across a wide variety of environments, including soil, food, and mammalian environments. A number of Listeria 2CS have been studied in detail, including LisRK, VirRS (required for virulence and defense against cationic antimicrobial peptides), and CesRK (control cell envelope-related genes upon exposure to surface-acting antimicrobials) (6, 17, 30). The HK-encoding hpk1021 (liaS) has also been investigated to some extent. It has previously been shown that expression of LiaS is altered in a spontaneous nisin-resistant mutant of L. monocytogenes, designated 412N (19). Although disruption of liaS in the 412N background through plasmid integration resulted in a reversion to nisin sensitivity, disruption of the gene in the corresponding parental strain, 412 (to create AG111), surprisingly did not impact on nisin resistance (18, 19). It has also been noted that the expression of both liaS and the penicillin-binding protein (PBP)-encoding lmo2229 is altered in the nisin-resistant ΔlisK mutant (8). Notably, transcriptomics has recently highlighted the importance of LiaSR with respect to inducing major changes to the composition of the cell envelope of L. monocytogenes EGD-e in response to cell wall-acting antimicrobials (14). However, the ΔliaS and ΔliaR mutants of EGD-e did not display an altered sensitivity to any of a variety of cell envelope-acting antibiotics, including vancomycin, bacitracin, fosfomycin, and polymyxin (14). Here, we return to the issue of the phenotypic consequences of mutating liaS and reveal that a ΔliaS mutant of strain LO28 displays an altered response to nisin, several cephalosporins, and other chemicals, including the active agents of a number of disinfectants.

MATERIALS AND METHODS

Strains, media, and plasmids.

L. monocytogenes strains were cultured using tryptone soy agar or tryptone soy broth (Merck, Darmstadt, Germany) supplemented with 0.6% yeast extract (TSA-YE or TSB-YE) unless otherwise stated. All strains, plasmids, and primers utilized are listed in Table 1. Escherichia coli was cultured in Luria-Bertani broth medium. Antibiotics were used at the following concentrations; erythromycin (EM), 5 μg/ml for Listeria, 250 μg/ml for E. coli; tetracycline, 10 μg/ml; and chloramphenicol (CAM), 10 μg/ml.

Table 1.

Strains, plasmids, and primers

Strain, plasmid, or primer Relevant feature or sequence (5′→3′)a Reference
Strains
    E. coli DH10B Cloning host strain Invitrogen
    L. monocytogenes LO28 Serotype 1/2a strain, genome sequenced P. Cossart
    ΔlisK mutant LO28 with deletion of lisK 8
    ΔliaS mutant LO28 with deletion of liaS This study
    ΔliaS ΔlisK mutant LO28 with deletion of liaS and lisK This study
    Lmo2229::pori mutant LO28 with disruption in lmo2229
    LO28 pPTPLPpbp mutant LO28 containing pPTPL with lmo2229 promoter region This study
    ΔlisK pPTPLPpbp mutant LO28 ΔlisK mutant containing pPTPL with lmo2229 promoter region This study
    ΔliaS pPTPLPpbp mutant LO28 ΔliaS mutant containing pPTPL with lmo2229 promoter region This study
    ΔliaS ΔlisK pPTPLPpbp mutant LO28 ΔliaS ΔlisK mutant containing pPTPL with lmo2229 promoter region This study
Primers
    liaS_PstI_SOEA AAACTGCAGATGGCTGCTTGC This study
    liaS_SOEB TTCTAAAAAGTTCTCTCGTCTTC This study
    liaS_SOEC GAAGACGAGAACTTTTTAGAAACTGGTATTCAGCAATTATTAAA This study
    liaS_EcoRI_SOED GCCGAATTCGGCAACTCGTTC This study
    liaS_OutFor CCATTTCATGATCATCTAC This study
    liaS_OutRev AGCAGATCTATCGTACGG This study
    pbpporiF GAAAAGCTTGAACGCTCG This study
    pbpporiR CCGAATTCTTTTACTTTATCG This study
    liaSprom1 TTAAAGATCTCGTACGTGC This study
    Pbpprom1 AAGTAGATCTGCTTTTGCGTC This study
    Pbpprom2 CCTATCTTCTAGACGGTATTA This study
    liaScompF_NcoI TAGGCAATGGGTTTTTCGAAC This study
    liaScompR_PstI AGCTGCAGCACCTATACGTACC This study
    M13R CAGGAAACAGAGCTATGAC
Plasmids
    pKSV7 Temperature-sensitive integration vector, Cmr 42
    pORI19 Integration vector, RepA− Eryr 28
    pPTPL Tetr; promoter probe vector 37
a

Bolding represents an overlap with the SOEB primer; underlining represents a restriction site.

Nonpolar deletion of liaS.

In-frame deletions of liaS were made in LO28 and the LO28 ΔlisK mutant. The procedure was carried out using splicing by overlap extension (SOE) PCR and double-crossover homologous recombination as described previously (9). Briefly, two pairs of primers were designed (liaSSOEA-SOEB and liaSSOEC-SOED) (Table 1) to amplify two fragments of equal size on either side of the region to be deleted. The resulting products were mixed in a 1:1 ratio and spliced through amplification with the SOEA and SOED primers. The resultant product was digested, cloned into the temperature-sensitive CAMr shuttle vector pKSV7 (42), and ultimately introduced into the relevant L. monocytogenes cells. Transformants were identified on the basis of growth on brain heart infusion (BHI)-CAM agar after incubation at 30°C. Chromosomal integration of the plasmid was selected for at 42°C by serial subculturing of a transformant in prewarmed BHI-CAM broth and streaking onto prewarmed BHI-CAM agar. Plasmid excision (following a second homologous recombination event) and curing was brought about by serial subculturing in BHI broth at 30°C with periodical spread plating onto BHI agar and incubation at 30°C. The resultant colonies were replica plated onto BHI and BHI-CAM plates to identify those which were CAMs, and from these ΔliaS mutants were identified through PCR using the primers liaSSOEE and liaSprom1 (Table 1), located 5′ and 3′ of the SOEA and SOED primers (Table 1), respectively.

Complementation of LiaS.

PCR primers LiaScompNCOF (containing the liaS start site) and LiaScompPSTR (50 bp downstream of the stop codon) were used to amplify liaS from LO28. This PCR product was digested with NcoI and PstI, cloned downstream of the constitutive P44 promoter in pNZ44 (34), and introduced into the LO28 ΔliaS mutant. The ΔliaS pNZ44 mutant was also generated to serve as a control.

pORI19 insertion mutations.

Insertion mutagenesis was carried out using the pVE6007 (CAMr RepA+, temperature sensitive)/pORI19 (EMr RepA) system (28) to disrupt lmo2229 in LO28, ΔliaS, and ΔliaS ΔlisK strains. The previously generated pORI19lmo2229 construct from L. monocytogenes EGD-e (21) was isolated and introduced into L. monocytogenes strains containing the accessory plasmid pVE6007. These cultures were grown at 30°C in order to maintain pVE6007. The loss of pVE6007 was then achieved by transferring 10 μl of an overnight culture to 10 ml of TSB-YE broth prewarmed to 42°C and incubating for 16 h. Aliquots were then spread plated onto prewarmed TSA-YE–EM plates and incubated overnight at 42°C. Successful integration was indicated by an EMr/CAMs phenotype. In each case, integration was confirmed by PCR using one primer outside the region of integration (pbpprom1) and another for the plasmid (M13R).

Antimicrobial sensitivity assays.

The growths of L. monocytogenes strains (2% inoculum in TSB-YE) in the presence of different levels of nisin (0, 100, 300, 500 μg/ml Nisaplin [2.5% nisin]; Danisco), benzethonium chloride, and iodoacetate (Sigma, St. Louis, MO) were compared by monitoring optical density at 600 nm (OD600) with a SpectraMax 340 spectrophotometer (Molecular Devices, CA). MIC determination assays were also employed to assess the sensitivity of L. monocytogenes strains to nisin (high-performance liquid chromatography [HPLC]-purified nisin A) and a variety of other antimicrobials (Sigma, St. Louis, MO). These involved the use of TSB-YE and a variation of the Clinical and Laboratory Standards Institute (CLSI) method. A total of 5 × 105 CFU/ml of cultures was added to increasing antibiotic concentrations in 96-well plates and incubated at 37°C for 16 h. The lowest concentration of antibiotic that inhibited growth was noted as the MIC for that strain. MIC data were utilized to determine fold differences in sensitivity/resistance to selected strains.

Phenotype microarray analysis.

Phenotype microarray (PM) analysis using Biolog phenotype arrays (Biolog, Inc., Hayward, CA) was carried out to compare wild-type L. monocytogenes LO28 and its ΔliaS derivative. Tests were performed using the Biolog 96-well microtiter plates PM 9-20 according to the manufacturer's instructions (PM 9-10 osmolytes and pH, PM 11-20 chemicals). To facilitate this, the strains were grown overnight at 37°C on Columbia blood agar, picked from the surface of the plate using a sterile Biolog cotton swab, and resuspended in IF-0 inoculating fluid (Biolog). Once cell density was adjusted to 81% transmittance, this inoculating fluid was added at the appropriate level to PM9+ inoculating fluid according the manufacturer's instructions. Each well was inoculated with 100 μl of inoculated PM9+ fluid, and the inoculated plates were monitored hourly for over 24 h in the Omnilog PM system (Biolog, Inc., Hayward, CA). Kinetic data were analyzed with the Omnilog PM software. A sensitivity difference threshold of 60 and a metabolic difference of 50 were used as a measure of difference between the wild type and mutant.

RT-PCR.

RNA isolation and reverse transcriptase PCR (RT-PCR) were carried out using the methods described in reference 7. RNA was isolated from overnight cultures (for stationary phase) or at an OD600 of 0.35 to 0.4 (for log phase) in TSB-YE. cDNA was amplified by PCR with specific primers (Table 1), and samples were taken at regular intervals (15, 22, 30, and 35 cycles) and run on agarose gels. Primers for the 16S rRNA gene of LO28 were used to confirm that cDNA concentrations were equimolar.

Construction of LacZ fusions and β-galactosidase assays.

A DNA fragment containing the promoter region of lmo2229 was amplified with primers pbpprom1 and pbpprom2. This fragment was cloned into plasmid pPTPL, a promoter probe vector, using the XbaI multiple cloning site (37). The resultant construct was initially introduced into the intermediate E. coli host MC1000 before introduction into the relevant L. monocytogenes strain and selection on the basis of tetracycline resistance. For β-galactosidase assays, cultures were grown to an OD600 of 0.3 to 0.4 and an OD600 of 0.8 to 1.0 in TSB-YE and permeabilized with 0.1% SDS and chloroform as described previously (25). The specific activities were calculated as follows, in Miller units per 10 ml of culture, and represent the average of three independent experiments: (522 × OD420 of reaction mixture)/(OD600 of cells used in reaction mixture × reaction of time in minutes × vol in ml of culture used).

RESULTS AND DISCUSSION

Sensitivity of the LO28 ΔliaS mutant to nisin and cephalosporins.

The L. monocytogenes sensor kinase LiaS has previously been indirectly linked with altered resistance to nisin (8, 18, 19). The LiaSR system has also been shown to regulate the response of the cell to environmental stresses (14). LiaS belongs to the group of intramembrane-sensing histidine kinases and has a high degree of similarity to the B. subtilis histidine kinase LiaSR as well as VraS from Staphylococcus aureus and CesS from Lactococcus lactis (16, 31, 32, 33). These are small histidine kinases with a small N-terminal sensing domain that is almost entirely located in the cytoplasmic membrane. It is thought that these proteins sense stimuli inside or at the surface of the cytoplasmic membrane. Notably, LiaS, VraS, and CesS contribute to the ability of associated cells to sense, and ultimately respond to, the presence of cell wall-acting antibiotics. LiaS is the only class II histidine kinase in L. monocytogenes LO28 (12), and liaS is located within an eight-gene cluster (Fig. 1A) flanked by putative stem-loop terminators. An in-frame nonpolar deletion mutant of liaS was generated in strain LO28, and the relative sensitivity of the ΔliaS mutant and wild-type LO28 to nisin was tested. It was established that, although the two strains grew in an almost identical fashion in the absence of nisin, the ΔliaS strain grew more successfully than its counterpart in the presence of nisin (200 μg/ml Nisaplin) (Fig. 1B). The original phenotype was restored by the reintroduction of liaS under the control of a constitutive promoter on pNZ44 (Fig. 2). To contextualize the increased nisin resistance of the ΔliaS mutant, another LO28 histidine kinase mutant, the ΔlisK strain, which also has a nisin-resistant phenotype and in which liaS expression is altered (8), was investigated in the same way. It is apparent that although the ΔlisK mutant had an advantage over the wild type in that it entered log phase more rapidly in the presence of nisin (200 μg/ml Nisaplin) (Fig. 1B), the nisin resistance phenotype of the ΔliaS mutant was more dramatic. To determine if these benefits were additive, a ΔliaS ΔlisK double mutant was created. The nisin resistance of this mutant was marginally greater than that of the ΔliaS mutant in that it entered logarithmic growth more quickly and achieved a higher OD after 20 h. The nisin resistance phenotype of the strains was further assessed using MIC determination assays with purified nisin A. These revealed that the ΔlisK mutant is 2-fold more nisin resistant than the wild type and that the ΔliaS and ΔlisK ΔliaS mutants are a further 2-fold more resistant (Table 2). Given that a link between altered nisin and cephalosporin sensitivity in L. monocytogenes has been noted on a number of occasions (4, 5, 8, 19, 21), we also determined the MICs of the ΔlisK, ΔliaS, and ΔliaS ΔlisK mutants to a number of cephalosporins, including cefuroxime (CXM), cefotaxime (CTX), and ceftazidime (CAZ). These assays revealed that the ΔliaS mutant is cephalosporin sensitive, being 2-fold more sensitive to CXM and CTX and 4-fold more sensitive to CAZ than the wild type. This is not the first occasion upon which mutation of this family of histidine kinases has been associated with altered cephalosporin resistance, as deletion of vraS from S. aureus results in increased sensitivity to ceftizoxime (16), while phenotypic array studies revealed that a Streptococcus mutans ΔliaS mutant exhibited enhanced resistance to a selection of compounds, including cephalosporins and polymyxins (48). Comparisons revealed that the ΔlisK mutant is consistently 2-fold more sensitive to cephalosporins than the ΔliaS mutant (Table 2). While the sensitivity of the ΔlisK ΔliaS strain to CTX and CAZ is equal to that of the ΔlisK mutant, the double mutant is 2-fold more sensitive to CXM (Table 2).

Fig 1.

Fig 1

(A) Organization of the liaSR region. All genes in schematic are drawn to scale. The black region of the liaS arrow is the deleted region in the ΔliaS mutant. Lollipop symbols indicate putative terminators. (B) Kinetic growth assay, showing growth of L. monocytogenes LO28 (●), ΔlisK mutant (○), ΔliaS mutant (▼), ΔliaS ΔlisK mutant (△), LO28pORI19::lmo2229 (■), and ΔliaS ΔlisKpORI19::lmo2229 (□) in TSB-YE in the absence (I) and presence (II) of 200 μg/ml nisaplin. Error bars are the standard deviations of the means from triplicate experiments.

Fig 2.

Fig 2

Complementation of the nisin resistance phenotype of the ΔliaS mutant by using the pNZ44 constitutive expression system. Growth of ΔliaS pNZ44 (●) and ΔliaS pNZ44-liaS (○) in TSB-YE with no (A) and with 200 μg/ml (B) nisaplin. Error bars are the standard deviations of the means from triplicate experiments.

Table 2.

MIC determination for antimicrobials

L. monocytogenes LO28 strain MIC (μg/ml) for antimicrobialsa
CAZ CXM CTX Nisin IOA BNZ
LO28 (wild type) 128 8 8 6.25 31.2 0.49
ΔlisK mutant 32 1 2 12.5 ND ND
ΔliaS mutant 64 2 4 25 15.6 0.98
ΔliaS ΔlisK mutant 16 1 2 25 ND ND
LO28pORI19::lmo2229 mutant 32 2 2 3.12 ND ND
ΔliaS ΔlisK pORI19::lmo2229 mutant 16 1 1 0.78 ND ND
a

Values are means from triplicate experiments. Antimicrobials used are ceftazidime (CAZ), cefuroxime (CXM), cefotaxime (CTX), nisin, iodoacetate (IAO), and benzethonium chloride (BNZ). ND, not determined.

Phenotype array-based comparison of LO28 and the ΔliaS mutant.

In order to further investigate the phenotypic consequences of liaS deletion, a phenotype array was employed. The Biolog phenotype array system utilizes a tetrazolium-based dye reaction to determine relative respiration. The chemical sensitivity suite of arrays was employed, and variations with respect to the relative behavior of the LO28 and the ΔliaS mutant were evident in the presence of 11 chemicals and 2 metabolic substrates. The ΔliaS mutant was more tolerant than LO28 to compound 48/40, benzethonium chloride, 5,7-dichloro-8-hydroxy-quinaldine (clioquinol), and 5-chloro-7-iodo-8-hydroxyquinoline and was more metabolically active than the wild type in the presence of 6% NaCl-creatine and l-cystic acid at pH 4.5. Notably, clioquinol (5-chloro-7-iodo-8-hydroxyquinoline) is an antibacterial and antifungal agent which is commonly used as a topical antibiotic (36), compound 48/80 is a cell membrane-active compound which is similar in action to polymyxin B (22), and benzethonium chloride is a synthetic quaternary ammonium salt which is used in a variety of different applications, including the food industry as a hard-surface disinfectant, as a first-aid antiseptic, and in foaming hand sanitizers (41). It was also apparent that the ΔliaS mutant is more sensitive than LO28 to chloroxylenol, novobiocin, chloramphenicol, iodoacetate, doxycycline, pentachlorophenol, and sodium metaborate (Table 3). Chloroxylenol functions by disrupting the membrane potential of cells and is used in antibacterial soaps as well as being the active ingredient in the household antiseptic Dettol (44), novobiocin inhibits DNA gyrase, pentachlorophenol is used as a wood preservative and, previously, in disinfectant cleaners (46), iodoacetate is an inhibitor of glycolytic pathway enzyme GAPDH (glyceraldehyde-3-phosphate dehydrogenase) (43), and sodium metaborate is used in hard-surface cleaners to remove grease, rust, and scale from metal, glass, and detergents (24). It would thus seem that the status of the LiaSR system in L. monocytogenes impacts differently on the resistance of the pathogen to a variety of disinfectants and industrial hygiene agents. Growth curve and MIC-based analysis with two representative chemicals, benzethonium chloride and iodoacetate, validated these results by confirming the enhanced and reduced resistance, respectively, of the ΔliaS mutant to these compounds (Fig. 3, Table 2).

Table 3.

Biolog phenotype microarray comparison of LO28 versus the ΔliaS mutanta

Phenotype PM Well Test Difference Mode of action
Phenotypes gained: faster growth/resistance PM17 E07 Compound 48/80 90.07 Cell cycle modulation
PM15 B12 5,7-Dichloro-8-hydroxy-quinaldine 86.98 Chelator, lipophilic
PM16 A12 5-Chloro-7-iodo-8-hydroxyquinoline 92.5 Chelator, lipophilic
PM12 E09 Benzethonium chloride 67.01 Membrane, detergent, cationic
PM09 B11 NaCl 6% + creatinine 60.47 Unknown
PM10 D06 pH 4.5 + l-cystic acid 116.45 Unknown
Phenotypes lost: slower growth/sensitivity PM16 H07 Chloroxylenol −142.41 Fungicide
PM12 D09 Novobiocin −85.79 DNA unwinding, gyrase (GN)
PM14 D06 Iodoacetate −94.37 Oxidation, sulfhydryl
PM14 F04 Chloramphenicol −98.23 Protein synthesis
PM13 C06 Doxycycline −102.05 Protein synthesis, tetracycline
PM18 C11 Pentachlorophenol −97.96 Respiration, ionophore, H+
PM14 E12 Sodium metaborate −109.17 Toxic anion
a

OmniLog PM software generates time course curves for turbidity and calculates differences in the areas for mutant and control cells. Units are arbitrary.

Fig 3.

Fig 3

Kinetic growth assays showing the L. monocytogenes LO28 wild type (●) and ΔliaS mutant (○) grown in TSY-YE containing 2 μg/ml benzethonium chloride (A) and 10 μg/ml sodium iodoacetate (B). Error bars are the standard deviations of the means from triplicate experiments.

Impact of liaS mutation on expression of Lmo2229.

It has been noted previously that the expression of liaS, lmo2229, and lmo2487 is reduced in the nisin-resistant LO28ΔlisK mutant (8), yet the expression of these three loci is increased in the spontaneously nisin-resistant 412N strain (19). In addition, these genes were found to be upregulated in the EGD-e ΔliaS transcriptome (14). Here, we investigated the impact of deleting liaS on the expression of liaS, lmo2229, and lmo2487 during logarithmic growth in both the LO28 and ΔlisK backgrounds. Although the expression of liaS and lmo2487 were not noticeably altered (data not shown), the expression of lmo2229 was increased in the ΔliaS mutant and, even more dramatically, in the ΔlisK ΔliaS mutant (Fig. 4). To further investigate this phenomenon, β-galactosidase assays were performed using a derivative of the promoter probe vector pPTPL (37) into which the lmo2229 promoter had been cloned. β-Galactosidase assays reveal that the promoter activity of lmo2229 is increased at log phase and at stationary phase in both the ΔliaS and ΔliaS ΔlisK mutants, yet relatively little alteration in promoter activity is seen in the ΔlisK mutant. Given that mutation of lmo2229 results in a nisin-sensitive phenotype in L. monocytogenes 412 (18), the nisin-resistant phenotype of the ΔliaS mutant may be directly attributable to the increased production of the corresponding PBP. To further assess this possibility, we attempted to mutate lmo2229 in the LO28, ΔliaS, and ΔliaS ΔlisK strains using the previously generated pORI19::lmo2229 construct (21). While a ΔliaS ΔlisK pORI19::lmo2229 mutant was successfully created, the single ΔliaS clone was unfortunately recalcitrant to pORI19::lmo2229 mutation. The antimicrobial sensitivity of the ΔliaS ΔlisK pORI19::lmo2229 and LO28 pORI19::lmo2229 mutants was assessed, and as expected the LO28 pORI19::lmo2229 mutant displayed an enhanced sensitivity to nisin compared to that of the parental strain, in accordance with previous work (18, 20). Notably, the mutation of lmo2229 in the ΔliaS ΔlisK mutant not only eliminated the nisin-resistant phenotype of the strain but resulted in a level of sensitivity that far exceeded that of LO28 pORI19::lmo2229 (Fig. 1B). This phenomenon was also investigated through MIC determination assays. This approach revealed that mutation of lmo2229 increases the sensitivity of LO28 by 2-fold, an increase in sensitivity comparable to that observed when lmo2229 was mutated in L. monocytogenes EGD-e (20), and highlighted the dramatic consequences of mutating lmo2229 in the ΔliaS ΔlisK mutant in that the MIC dropped from 25 μg/ml to 0.78 μg/ml, representing a 32-fold increase in sensitivity. It is thus apparent that Lmo2229 is of key importance with respect to the nisin-resistant phenotype of the double mutant (Table 2). The fact that the sensitivity of ΔliaS ΔlisKpORI19::lmo2229 is greater than that of LO28pORI19::lmo2229 suggests that other changes brought about by the mutation of liaS and lisK sensitize the cell to nisin but that these impacts are masked through the overexpression of lmo2229. MIC determination assays were also performed to assess the cephalosporin sensitivity of these mutants. It has been previously documented that Lmo2229 has a role in the cephalosporin resistance phenotype of L. monocytogenes (18, 20). In this study, mutation of lmo2229 in LO28 reduced cephalosporin resistance by 4-fold, mutation of lmo2229 in the ΔliaS ΔlisK mutant did not impact on the level of sensitivity of this strain to CAZ or CXM, and sensitivity to CTX was increased by 2-fold. It is thus apparent that altered lmo2229 expression is not responsible for the cephalosporin sensitivity of the ΔliaS ΔlisK mutant.

Fig 4.

Fig 4

RT-PCRs to compare transcription of genes liaS, lmo2487, and lmo2229 in log phase of growth in LO28, ΔlisK, ΔliaS, and ΔliaS ΔlisK strains (A) and promoter activity of the gene lmo2229 in growth by Miller assay (B). Miller assay results are averages of triplicate experiments. ●, LO28; ○, ΔlisK mutant; ■, Δ liaS mutant; □, ΔliaS ΔlisK mutant.

The LiaSR regulatory system has previously been found to be of importance with respect to the nisin resistance of the spontaneously nisin-resistant L. monocytogenes mutant 412N (19), and recent transcriptomic studies have highlighted the role that this system plays in the cell envelope stress response (14). We were particularly interested in investigating the role that LiaS plays in the innate nisin resistance of L. monocytogenes in light of the fact that previous investigations indicated that LiaS does not impact on the nisin resistance of the wild-type 412 strain and revealed that the deletion of liaS from L. monocytogenes EGD-e failed to impact on the sensitivity of the strain to a number of cell envelope-acting antimicrobials. It is clear from our investigations with a nonpolar deletion mutant of L. monocytogenes LO28 that liaS is indeed an important nisin sensitivity determinant and is also a key factor with respect to the response of L. monocytogenes to a variety of other antimicrobial agents. Notably, LiaS contributes to the innate cephalosporin resistance of the pathogen. This family of antibiotics is frequently employed when treating infections prior to the identification of the etiological agent, and thus the innate cephalosporin resistance of L. monocytogenes can have major implications in such circumstances. This study thus represents yet another example of a connection between altered sensitivity to nisin and cephalosporin antibiotics. This phenomenon has also been observed in L. monocytogenes mutants in which anrB, telA, lisK, and lmo2229 have been mutated (4, 5, 8, 19, 21). Future investigation of the concurrence of these phenotypes may yield useful insights into the overlap between the nisin and cephalosporin resistance pathways. The contribution of LiaS in dictating the sensitivity of the pathogen to domestic and industrial disinfectants is also potentially very significant.

We have also identified lmo2229 as a potentially important contributor to the liaS-related nisin resistance phenotype. While this gene could not be disrupted in the ΔliaS background, its mutation resulted in a significant reduction in the previously substantial nisin resistance of the ΔliaS ΔlisK mutant. Given that it has now been established that this gene product contributes strongly to nisin resistance in both the wild type and nisin-resistant mutants of L. monocytogenes, it appears to be an excellent target for sensitizing strains to this lantibiotic. Similarly, it is evident that a more detailed understanding of mechanisms by which LiaSR controls the response of L. monocytogenes to a wide variety of unrelated antimicrobials could also lead to the development of strategies to increase the susceptibility of the pathogen to these agents.

ACKNOWLEDGMENTS

This work was supported by the Irish Department of Agriculture by a Food Institutional Research Measure (FIRM) grant (Funlac).

We thank Karen Daly for her considerable effort in attempting to generate the ΔliaS::lmo2229 mutant and Joss Delves-Broughton (Danisco) for Nisaplin powder.

Footnotes

Published ahead of print 10 February 2012

REFERENCES

  • 1. Begley M, Hill C, Ross RP. 2006. Tolerance of Listeria monocytogenes to cell envelope-acting antimicrobial agents is dependent on SigB. Appl. Environ. Microbiol. 72:2231–2234 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2. Brotz H, et al. 1998. Role of lipid-bound peptidoglycan precursors in the formation of pores by nisin, epidermin and other lantibiotics. Mol. Microbiol. 30:317–327 [DOI] [PubMed] [Google Scholar]
  • 3. Carpentier B, Cerf O. 2011. Review—persistence of Listeria monocytogenes in food industry equipment and premises. Int. J. Food Microbiol. 145:1–8 [DOI] [PubMed] [Google Scholar]
  • 4. Collins B, Curtis N, Cotter PD, Hill C, Ross RP. 2010. The ABC transporter, AnrAB, contributes to the innate resistance of Listeria monocytogenes to nisin, bacitracin and various beta-lactam antibiotics. Antimicrob. Agents Chemother. 54:4416–4423 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5. Collins B, Joyce S, Hill C, Cotter PD, Ross RP. 2010. TelA contributes to the innate resistance of Listeria monocytogenes to nisin and other cell wall-acting antibiotics. Antimicrob. Agents Chemother. 54:4658–4663 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6. Cotter PD, Emerson N, Gahan CG, Hill C. 1999. Identification and disruption of lisRK, a genetic locus encoding a two-component signal transduction system involved in stress tolerance and virulence in Listeria monocytogenes. J. Bacteriol. 181:6840–6843 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7. Cotter PD, Gahan CG, Hill C. 2001. A glutamate decarboxylase system protects Listeria monocytogenes in gastric fluid. Mol. Microbiol. 40:465–475 [DOI] [PubMed] [Google Scholar]
  • 8. Cotter PD, Guinane CM, Hill C. 2002. The LisRK signal transduction system determines the sensitivity of Listeria monocytogenes to nisin and cephalosporins. Antimicrob. Agents Chemother. 46:2784–2790 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9. Cotter PD, Ryan S, Gahan CG, Hill C. 2005. Presence of GadD1 glutamate decarboxylase in selected Listeria monocytogenes strains is associated with an ability to grow at low pH. Appl. Environ. Microbiol. 71:2832–2839 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10. Delves-Broughton J. 2005. Nisin as a food preservative. Food Australia 57:525–527 [DOI] [PubMed] [Google Scholar]
  • 11. Draper LA, Ross RP, Hill C, Cotter PD. 2008. Lantibiotic immunity. Curr. Protein Pept. Sci. 9:39–49 [DOI] [PubMed] [Google Scholar]
  • 12. Fabret C, Feher VA, Hoch JA. 1999. Two-component signal transduction in Bacillus subtilis: how one organism sees its world. J. Bacteriol. 181:1975–1983 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13. Field D, et al. 2010. Studies with bioengineered nisin peptides highlight the broad-spectrum potency of nisin V. Microb. Biotechnol. 3:473–486 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14. Fritsch F, et al. 2011. The cell envelope stress response mediated by the LiaFSRLm three-component system is controlled via the phosphatase activity of the bifunctional histidine kinase LiaSLm. Microbiology 157:373–386 [DOI] [PubMed] [Google Scholar]
  • 15. Gao R, Stock AM. 2009. Biological insights from structures of two-component proteins. Annu. Rev. Microbiol. 63:133–154 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16. Gardete S, Wu SW, Gill S, Tomasz A. 2006. Role of VraSR in antibiotic resistance and antibiotic-induced stress response in Staphylococcus aureus. Antimicrob. Agents Chemother. 50:3424–3434 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17. Gottschalk S, et al. 2008. The two-component system CesRK controls the transcriptional induction of cell envelope-related genes in Listeria monocytogenes in response to cell wall-acting antibiotics. J. Bacteriol. 190:4772–4776 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18. Gravesen A, et al. 2004. pbp2229-mediated nisin resistance mechanism in Listeria monocytogenes confers cross-protection to class IIa bacteriocins and affects virulence gene expression. Appl. Environ. Microbiol. 70:1669–1679 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19. Gravesen A, Sorensen K, Aarestrup FM, Knochel S. 2001. Spontaneous nisin-resistant Listeria monocytogenes mutants with increased expression of a putative penicillin-binding protein and their sensitivity to various antibiotics. Microb. Drug Resist. 7:127–135 [DOI] [PubMed] [Google Scholar]
  • 20. Guinane CM, Cotter PD, Hill C, Ross RP. 2006. Spontaneous resistance in Lactococcus lactis IL1403 to the lantibiotic lacticin 3147. FEMS Microbiol. Lett. 260:77–83 [DOI] [PubMed] [Google Scholar]
  • 21. Guinane CM, Cotter PD, Ross RP, Hill C. 2006. Contribution of penicillin-binding protein homologs to antibiotic resistance, cell morphology, and virulence of Listeria monocytogenes EGDe. Antimicrob. Agents Chemother. 50:2824–2828 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22. Hall JB, et al. 1983. Antimicrobial action of compound 48/80–II mechanism of action. Biochem. Pharmacol. 32:449–453 [DOI] [PubMed] [Google Scholar]
  • 23. Hansen ME, Wangari R, Hansen EB, Mijakovic I, Jensen PR. 2009. Engineering of Bacillus subtilis 168 for increased nisin resistance. Appl. Environ. Microbiol. 75:6688–6695 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24. Houlsby RD, Ghajar M, Chavez GO. 1986. Antimicrobial activity of borate-buffered solutions. Antimicrob. Agents Chemother. 29:803–806 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25. Israelsen H, Madsen SM, Johansen E, Vrang A, Hansen EB. 1995. Environmentally regulated promoters in Lactococci. Dev. Biol. Stand. 85:443–448 [PubMed] [Google Scholar]
  • 26. Kallipolitis BH, Ingmer H, Gahan CG, Hill C, Sogaard-Andersen L. 2003. CesRK, a two-component signal transduction system in Listeria monocytogenes, responds to the presence of cell wall-acting antibiotics and affects beta-lactam resistance. Antimicrob. Agents Chemother. 47:3421–3429 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27. Kramer NE, van Hijum SA, Knol J, Kok J, Kuipers OP. 2006. Transcriptome analysis reveals mechanisms by which Lactococcus lactis acquires nisin resistance. Antimicrob. Agents Chemother. 50:1753–1761 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28. Law J, et al. 1995. A system to generate chromosomal mutations in Lactococcus lactis which allows fast analysis of targeted genes. J. Bacteriol. 177:7011–7018 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29. Maher S, McClean S. 2006. Investigation of the cytotoxicity of eukaryotic and prokaryotic antimicrobial peptides in intestinal epithelial cells in vitro. Biochem. Pharmacol. 71:1289–1298 [DOI] [PubMed] [Google Scholar]
  • 30. Mandin P, et al. 2005. VirR, a response regulator critical for Listeria monocytogenes virulence. Mol. Microbiol. 57:1367–1380 [DOI] [PubMed] [Google Scholar]
  • 31. Martinez B, Zomer AL, Rodriguez A, Kok J, Kuipers OP. 2007. Cell envelope stress induced by the bacteriocin Lcn972 is sensed by the lactococcal two-component system CesSR. Mol. Microbiol. 64:473–486 [DOI] [PubMed] [Google Scholar]
  • 32. Mascher T. 2006. Intramembrane-sensing histidine kinases: a new family of cell envelope stress sensors in Firmicutes bacteria. FEMS Microbiol. Lett. 264:133–144 [DOI] [PubMed] [Google Scholar]
  • 33. Mascher T, Zimmer SL, Smith TA, Helmann JD. 2004. Antibiotic-inducible promoter regulated by the cell envelope stress-sensing two-component system LiaRS of Bacillus subtilis. Antimicrob. Agents Chemother. 48:2888–2896 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34. McGrath S, Fitzgerald GF, van Sinderen D. 2001. Improvement and optimization of two engineered phage resistance mechanisms in Lactococcus lactis. Appl. Environ. Microbiol. 67:608–616 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35. Morgan SM, O'Connor MP, Cotter PD, Ross RP, Hill C. 2005. Sequential actions of the two-component peptides of the lantibiotic lacticin 3147 explain its antimicrobial activity at nanomolar concentrations. Antimicrob. Agents Chemother. 49:2606–2611 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36. Morris SD, Rycroft RJ, White IR, Wakelin SH, McFadden JP. 2002. Comparative frequency of patch test reactions to topical antibiotics. Br. J. Dermatol. 146:1047–1051 [DOI] [PubMed] [Google Scholar]
  • 37. O'Driscoll J, et al. 2004. Lactococcal plasmid pNP40 encodes a novel, temperature-sensitive restriction-modification system. Appl. Environ. Microbiol. 70:5546–5556 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38. Peschel A, et al. 1999. Inactivation of the dlt operon in Staphylococcus aureus confers sensitivity to defensins, protegrins, and other antimicrobial peptides. J. Biol. Chem. 274:8405–8410 [DOI] [PubMed] [Google Scholar]
  • 39. Piper C, Draper LA, Cotter PD, Ross RP, Hill C. 2009. A comparison of the activities of lacticin 3147 and nisin against drug-resistant Staphylococcus aureus and Enterococcus species. J. Antimicrob. Chemother. 64:546–551 [DOI] [PubMed] [Google Scholar]
  • 40. Rea MC, et al. 2007. Antimicrobial activity of lacticin 3,147 against clinical Clostridium difficile strains. J. Med. Microbiol. 56:940–946 [DOI] [PubMed] [Google Scholar]
  • 41. Shintre MS, Gaonkar TA, Modak SM. 2006. Efficacy of an alcohol-based healthcare hand rub containing synergistic combination of farnesol and benzethonium chloride. Int. J. Hyg. Environ. Health 209:477–487 [DOI] [PubMed] [Google Scholar]
  • 42. Smith K, Youngman P. 1992. Use of a new integrational vector to investigate compartment-specific expression of the Bacillus subtilis spoIIM gene. Biochimie 74:705–711 [DOI] [PubMed] [Google Scholar]
  • 43. Solem C, Koebmann BJ, Jensen PR. 2003. Glyceraldehyde-3-phosphate dehydrogenase has no control over glycolytic flux in Lactococcus lactis MG1363. J. Bacteriol. 185:1564–1571 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44. Stubbs WP, Bellah JR, Vermaas-Hekman D, Purich B, Kubilis PS. 1996. Chlorhexidine gluconate versus chloroxylenol for preoperative skin preparation in dogs. Vet. Surg. 25:487–494 [DOI] [PubMed] [Google Scholar]
  • 45. Thedieck K, et al. 2006. The MprF protein is required for lysinylation of phospholipids in listerial membranes and confers resistance to cationic antimicrobial peptides (CAMPs) on Listeria monocytogenes. Mol. Microbiol. 62:1325–1339 [DOI] [PubMed] [Google Scholar]
  • 46. Topp E, Crawford RL, Hanson RS. 1988. Influence of readily metabolizable carbon on pentachlorophenol metabolism by a pentachlorophenol-degrading Flavobacterium sp. Appl. Environ. Microbiol. 54:2452–2459 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47. Williams T, Bauer S, Beier D, Kuhn M. 2005. Construction and characterization of Listeria monocytogenes mutants with in-frame deletions in the response regulator genes identified in the genome sequence. Infect. Immun. 73:3152–3159 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48. Zhang J, Biswas I. 2009. A phenotypic microarray analysis of a Streptococcus mutans liaS mutant. Microbiology 155:61–68 [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Applied and Environmental Microbiology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES